Application of PpSAMS protein and related biological materials thereof in regulating and controlling ripening and softening of plant fruits

Abstract

The invention discloses application of PpSAMS protein and related biological materials thereof in regulating and controlling ripening and softening of plant fruits. According to the invention, overexpression of the PpSAMS gene in tomato shows that the overexpression of the PpSAMS gene can promote maturation of tomato fruits; the overexpression of the PpSAMS gene in the apple callus shows that the overexpression of the PpSAMS gene can up-regulate the activity of cell wall modification related enzymes of the apple callus, regulate the expression level of cell wall metabolism related genes and promote the depolymerization of cell wall pectin and the hydrolysis of cellulose; the overexpression of the PpSAMS gene in the peach fruit discovers that the overexpression of the PpSAMS gene is unfavorable for maintaining the storage quality of the peach fruit during the normal-temperature / low-temperature storage period after the peach fruit is picked, but the silent PpSAMS gene is contrary to the normal-temperature / low-temperature storage period after the peach fruit is picked. The results show that the PpSAMS protein can regulate and control the ripening and softening of the plant fruits, and a foundation is laid for the research of improving the storage quality of the plant fruits.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of PpSAMS protein and its related biomaterials in regulating the ripening and softening of plant fruits. Background Art

[0002] China is the origin country of peaches, and peach trees are one of the oldest cultivated fruit trees in China. The peach industry in China has developed rapidly. In 1993, the cultivated area and output of peaches in China exceeded those of Italy and the United States in an all-round way, becoming the world's largest peach-producing country, and has remained so ever since. At present, there are industrialized cultivations of peaches in 29 provincial-level administrative regions across the country. Peaches are the third largest deciduous fruit trees in China after apples and pears. In 2021, the total output value of the peach industry in China was nearly 100 billion yuan, and the number of employees in production, circulation and retail exceeded 10 million. It is the main economic pillar to boost the prosperity of rural industries and the affluence of farmers. Peaches are not resistant to storage and transportation. The regulation of the market supply period mainly relies on varieties matching the maturity period, off-season production in facilities and the utilization of diverse climates. With the rapid development of biotechnology, the ripening and shelf life of fruits can be regulated through molecular techniques. The key lies in understanding the molecular mechanism of ripening and softening and excavating key regulatory genes with significant functions for ripening and softening.

[0003] During fruit development, the texture of the fruit is closely related to the cell wall components and pectin content. As a climacteric fruit, peaches are more likely to ripen and soften due to their own respiration characteristics. This process is mainly accompanied by the degradation of cell wall components, especially pectin, and the degradation of pectin is the result of the combined action of multiple structural enzymes. Pectin and cellulose in cell wall substances will damage the cell wall structure of fruit tissues under the catalytic action of cell wall modification enzymes, and finally reduce the storage quality and shelf life of postharvest fruits. Plant hormones, as key substances for fruit development and ripening, affect the growth, ripening and softening of fruits through various complex physiological and biochemical processes. At present, the regulatory effects of plant hormones such as ethylene, abscisic acid, and auxin on the softening of postharvest fruits have been confirmed in various fruits. It can be seen that the changes in the expression levels of these hormone-related genes can reflect the process of fruit ripening and softening. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to regulate the ripening (or softening) and storage quality of plant fruits. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0005] To solve the above technical problems, the present invention first provides a new use of PpSAMS protein or a substance that regulates the content and / or activity of the PpSAMS protein.

[0006] The present invention relates to the use of the PpSAMS protein or a substance that regulates the content and / or activity of the PpSAMS protein in any one of the following A1)-A10):

[0007] A1) Regulating the ripening or softening of plant fruits;

[0008] A2) Regulating the storage quality of plant fruits;

[0009] A3) Regulating plant cell wall metabolism;

[0010] A4) Cultivating plants with altered fruit ripening degree, softening degree, storage quality or cell wall metabolism;

[0011] A5) Plant breeding;

[0012] A6) Preparing a product for regulating the ripening or softening of plant fruits;

[0013] A7) Preparing a product for regulating the storage quality of plant fruits;

[0014] A8) Preparing a product for regulating plant cell wall metabolism;

[0015] A9) Preparing a product for cultivating plants with altered fruit ripening degree, softening degree, storage quality or cell wall metabolism;

[0016] A10) Preparing a product for plant breeding;

[0017] The PpSAMS protein is any one of the following B1)-B4):

[0018] B1) A protein with an amino acid sequence shown in Sequence 2;

[0019] B2) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2;

[0020] B3) A protein with the same function obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in Sequence 2;

[0021] B4) A protein having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having the same function. In the protein described in B2) above, the tag refers to a polypeptide or protein that is fused and expressed together with the target protein by in vitro DNA recombination technology for facilitating the expression, detection, tracing, and / or purification of the target protein. The tags include, but are not limited to: GST (glutathione S-transferase) tag protein, 6His tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein), or AviTag tag protein.

[0022] In some embodiments, the tag is a GUS protein.

[0023] In some embodiments, the tag is an eGFP protein.

[0024] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or several amino acid residues are substitutions and / or deletions and / or additions of no more than 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 amino acid residue(s).

[0025] In the protein described in B4) above, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in BLAST 2.1 Advanced, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search, the identity value (%) of a pair of amino acid sequences can be calculated. The identity includes amino acid sequences having 80% or higher, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher homology with the amino acid sequence shown in SEQ ID NO: 2 of the present invention.

[0026] The proteins described in B1)-B4) above can be artificially synthesized, or their encoding genes can be synthesized first and then biochemically expressed.

[0027] Any of the above substances that regulate the content and / or activity of PpSAMS protein includes substances that increase the content and / or activity of PpSAMS protein or substances that decrease the content and / or activity of PpSAMS protein.

[0028] Furthermore, the substance that increases the activity of PpSAMS protein can be a protein, polypeptide or small molecule compound that enhances or promotes the function of PpSAMS protein.

[0029] The substance that increases the content of PpSAMS protein can be a substance that promotes the synthesis of PpSAMS protein or inhibits the degradation of PpSAMS protein or overexpresses PpSAMS protein.

[0030] The substance that decreases the activity of PpSAMS protein can be a protein, polypeptide or small molecule compound that inhibits the function of PpSAMS protein.

[0031] The substance that decreases the content of PpSAMS protein can be a substance that inhibits the synthesis of PpSAMS protein or promotes the degradation of PpSAMS protein or knockdown (knockdown) or knockout of the PpSAMS protein coding gene.

[0032] Still further, the substance that knockdown (knockdown) the PpSAMS protein coding gene can be any substance that inhibits (or interferes with) the expression of the PpSAMS protein coding gene or silences or knocks out the PpSAMS protein coding gene.

[0033] Even further, the substance that silences the PpSAMS protein coding gene is a substance that virus-induced silencing of the PpSAMS protein coding gene.

[0034] In some embodiments, the substance that virus-induced silencing of the PpSAMS protein coding gene includes the pTRV2 vector and the pTRV1 vector containing a specific fragment of the PpSAMS protein coding gene. The nucleotide sequence of the specific fragment of the PpSAMS protein coding gene is shown as positions 537-886 of Sequence 1.

[0035] To solve the above technical problems, the present invention also provides a new use of a biological material related to PpSAMS protein.

[0036] The present invention provides the application of a biological material related to PpSAMS protein in any one of the following A1)-A10):

[0037] A1) Regulating the ripening or softening of plant fruits;

[0038] A2) Regulating the storage quality of plant fruits;

[0039] A3) Regulating plant cell wall metabolism;

[0040] A4) Cultivating plants with altered fruit ripening degree, softening degree, storage quality, or cell wall metabolism;

[0041] A5) Plant breeding;

[0042] A6) Preparing products for regulating plant fruit ripening or softening;

[0043] A7) Preparing products for regulating plant fruit storage quality;

[0044] A8) Preparing products for regulating plant cell wall metabolism;

[0045] A9) Preparing products for cultivating plants with altered fruit ripening degree, softening degree, storage quality, or cell wall metabolism;

[0046] A10) Preparing products for plant breeding;

[0047] The biological material is any one of the following E1) to E5):

[0048] E1) A nucleic acid molecule encoding the PpSAMS protein;

[0049] E2) A nucleic acid molecule that inhibits the expression of the PpSAMS protein-encoding gene, or silences or knocks out the PpSAMS protein-encoding gene;

[0050] E3) An expression cassette containing the nucleic acid molecule described in E1) or E2);

[0051] E4) A recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3);

[0052] E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4).

[0053] Furthermore, the nucleic acid molecule described in E1) is any one of the following:

[0054] F1) The DNA molecule shown in Sequence 1;

[0055] F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and encoding the PpSAMS protein.

[0056] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding the PpSAMS protein of the present invention by using known methods, such as directed evolution and site-directed mutagenesis. Those nucleotides that have been artificially modified and have 75% or higher identity with the PpSAMS nucleotide sequence isolated from the present invention, as long as they encode the PpSAMS protein and have the same function, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention. The identity refers to the sequence similarity with the natural nucleic acid sequence, including nucleotide sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in Coding Sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0057] E2) The nucleic acid molecule is any one of the following:

[0058] G1) The DNA molecule shown at positions 537 - 886 of Sequence 1;

[0059] G2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in G1) and regulating plant fruit ripening or storage quality.

[0060] The nucleic acid molecule described in E2) above can be gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA or antisense RNA.

[0061] Any of the above-described nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0062] Any of the above-described nucleic acid molecules can be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0063] Any of the above-described expression cassettes may include a promoter, the nucleic acid molecule described in E1) or E2) above, and a terminator. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Further, the expression cassette may further include an enhancer sequence.

[0064] Any of the above-mentioned vectors refers to a vector that can transport the nucleic acid molecule described in E1) or E2) above into a host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), Ti plasmids, viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.).

[0065] Any of the above-mentioned recombinant vectors refers to a recombinant DNA molecule constructed by ligating the nucleic acid molecule described in E1) or E2) above with the vector in vitro. Existing plant expression vectors can be used to construct recombinant vectors containing the nucleic acid molecule described in E1) or E2) above. The plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (from CAMBIA company), etc. The plant expression vector may also contain the 3' untranslated region of the foreign gene, that is, it contains a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor. For example, the nopaline synthase gene Nos of the Agrobacterium tumefaciens Ti plasmid gene and the 3' untranslated region of plant genes (such as soybean storage protein genes) have similar functions. When constructing a plant expression vector using the gene of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the adjacent region start codon, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene encoding an enzyme or a luminescent compound that can produce a color change and can be expressed in plants (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (such as the nptII gene conferring resistance to kanamycin and related antibiotics, the bar gene conferring resistance to the herbicide phosphinothricin, the hph gene conferring resistance to the antibiotic hygromycin, and the dhfr gene conferring resistance to methotrexate, the EPSPS gene conferring resistance to glyphosate) or a marker gene for anti-chemical reagents (such as an anti-herbicide gene), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by adversity.

[0066] Any of the above-mentioned microorganisms may be bacteria, fungi, actinomycetes, protozoa, algae or viruses. Among them, the bacteria may be from the genus Escherichia (Escherichia sp.), the genus Erwinia (Erwinia sp.), the genus Agrobacterium (Agrobacterium sp.), the genus Flavobacterium (Flavobacterium sp.), the genus Alcaligenes (Alcaligenes sp.), the genus Pseudomonas (Pseudomonas sp.), the genus Bacillus (Bacillus sp.), etc., but not limited to these. For example, the bacteria may be Escherichia coli, Bacillus subtilis or Bacillus pumilus. The fungi may be yeasts, and the yeasts may be from the genus Saccharomyces (such as Saccharomyces cerevisiae), the genus Kluyveromyces (such as Kluyveromyces lactis), the genus Pichia (such as Pichia pastoris), the genus Schizosaccharomyces (such as Schizosaccharomyces pombe), the genus Hansenula (such as Hansenula polymorpha), etc., but not limited to these. The fungi may also be from the genus Fusarium (Fusarium sp.), the genus Rhizoctonia (Rhizoctonia sp.), the genus Verticillium (Verticillium sp.), the genus Penicillium (Penicillium sp.), the genus Aspergillus (Aspergillus sp.), the genus Cephalosporium (Cephalosporium sp.), etc., but not limited to these. The actinomycetes may be from the genus Streptomyces (Streptomyces sp.), the genus Nocardia (Nocardia sp.), the genus Micromonospora (Micromonospora sp.), the genus Streptosporangium (Streptosporangium sp.), the genus Actinoplanes (Actinoplanes sp.), the genus Thermoactinomyces (Thermoactinomyces sp.), etc., but not limited to these. The algae may be from the genus Fucus (Fucus sp.), the genus Achnanthes (Achnanthes sp.), the genus Amphiprora (Amphiprora sp.), the genus Amphora (Amphora sp.), the genus Ankistrodesmus (Ankistrodesmus sp.), the genus Asteromonas (Asteromonas sp.), the genus Boekelovia (Boekelovia sp.), etc., but not limited to these. The viruses may be rotavirus, herpes virus, influenza virus, adenovirus, etc., but not limited to these.

[0067] Any of the above-mentioned recombinant microorganisms refers to a recombinant microorganism obtained by operating and modifying the genes of a target microorganism, resulting in a change in its function. For example, a recombinant microorganism obtained by introducing the above-mentioned recombinant vector into a target microorganism. The recombinant microorganism can be understood to refer not only to a specific recombinant microorganism, but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the progeny may not be exactly the same as the original parental cells, but are still included in the scope of recombinant microorganisms.

[0068] In any of the above-mentioned applications, the regulation of plant fruit ripening or softening refers to promoting or inhibiting plant fruit ripening or softening. The regulation method is positive regulation, specifically manifested as: increasing the content and / or activity of PpSAMS protein in plants can promote plant ripening or softening, and decreasing the content and / or activity of PpSAMS protein in plants can inhibit plant ripening or softening.

[0069] The regulation of plant fruit storage quality refers to improving or decreasing the storage quality of plant fruits. The regulation method is negative regulation, specifically manifested as: increasing the content and / or activity of PpSAMS protein in plants can decrease the storage quality of plant fruits, and decreasing the content and / or activity of PpSAMS protein in plants can improve the storage quality of plant fruits.

[0070] Furthermore, the regulation of plant fruit ripening or softening or the regulation of plant fruit storage quality is manifested as any one of the following M1)-M7):

[0071] M1) Regulating the color change of plant fruits;

[0072] M2) Regulating the firmness of plant fruits;

[0073] M3) Regulating the color difference of plant fruits;

[0074] M4) Regulating the content of soluble solids in plant fruits;

[0075] M5) Regulating the electrolyte leakage rate of plant fruits;

[0076] M6) Regulating the weight loss rate of plant fruits;

[0077] M7) Regulating the expression level of genes related to plant fruit ripening.

[0078] Furthermore, the genes related to fruit ripening include MdACS1, MdACO1, MdERF5, MdIAA1, MdNCED2, MdGA2ox, and / or MdAIPT.

[0079] In some embodiments, when the expression level of the PpSAMS protein-coding gene in a plant increases, the fruit firmness of the plant decreases, while the soluble solid content, color difference, electrolyte leakage rate, and weight loss rate increase. The expression levels of the MdACS1, MdACO1, MdERF5, and MdIAA1 genes are up-regulated, and the expression levels of the MdNCED2, MdGA2ox, and MdAIPT genes are down-regulated.

[0080] In some embodiments, when the expression level of the PpSAMS protein-coding gene in a plant decreases, the fruit firmness of the plant increases, while the soluble solid content, color difference, electrolyte leakage rate, and weight loss rate decrease. The expression levels of the MdACS1, MdACO1, MdERF5, and MdIAA1 genes are down-regulated, and the expression levels of the MdNCED2, MdGA2ox, and MdAIPT genes are up-regulated.

[0081] The regulation of plant cell wall metabolism is to promote or inhibit plant cell wall metabolism. The regulation method is positive regulation, which is specifically manifested as follows: increasing the content and / or activity of PpSAMS protein in a plant can promote plant cell wall metabolism (such as promoting the depolymerization of pectin and the hydrolysis of cellulose, and increasing the activity of cell wall modification-related enzymes), and decreasing the content and / or activity of PpSAMS protein in a plant can reduce plant cell wall metabolism (such as inhibiting the depolymerization of pectin and the hydrolysis of cellulose, and decreasing the activity of cell wall modification-related enzymes).

[0082] Furthermore, the regulation of plant cell wall metabolism is manifested as any one of the following N1)-N4):

[0083] N1) Regulating the pectin content in the cell wall of plant fruits;

[0084] N2) Regulating the cellulose content in the cell wall of plant fruits;

[0085] N3) Regulating the hemicellulose content in the cell wall of plant fruits;

[0086] N4) Regulating the enzyme activity of cell wall modification enzymes in the cell wall of plant fruits.

[0087] Furthermore, the pectin includes water-soluble pectin, ionic pectin, and / or covalently bound pectin;

[0088] The cell wall modification-related enzymes include pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase, and / or xyloglucan endotransglycosylase.

[0089] In some embodiments, when the expression level of the PpSAMS protein-coding gene in a plant increases, the contents of water-soluble pectin, ionic pectin, covalently bound pectin, and hemicellulose in the plant cell wall increase, the cellulose content decreases, and the activities of pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase, and xyloglucan endotransglycosylase increase.

[0090] In some embodiments, when the expression level of the PpSAMS protein-coding gene in a plant decreases, the contents of water-soluble pectin, ionic pectin, covalently bound pectin, and hemicellulose in the plant cell wall decrease, the cellulose content increases, and the activities of pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase, and xyloglucan endotransglycosylase decrease.

[0091] The purpose of any of the above-mentioned plant breeding is to cultivate transgenic plants with reduced fruit ripening degree (or softening degree) and improved storage quality.

[0092] To solve the above technical problems, the present invention also provides a method for inhibiting fruit ripening of plants, improving the storage quality of plant fruits, or inhibiting plant cell wall metabolism.

[0093] The method for inhibiting fruit ripening of plants, improving the storage quality of plant fruits, or inhibiting plant cell wall metabolism provided by the present invention includes the following steps: reducing the content and / or activity of PpSAMS protein in the target plant.

[0094] Furthermore, the method for reducing the content and / or activity of PpSAMS protein in the target plant is to introduce a recombinant vector for silencing the PpSAMS protein-coding gene into the target plant.

[0095] Still further, the recombinant vector for silencing the PpSAMS protein-coding gene is a recombinant vector for virus-induced silencing of the PpSAMS protein-coding gene. The recombinant vector for virus-induced silencing of the PpSAMS protein-coding gene includes a pTRV2 vector and a pTRV1 vector containing a specific fragment of the PpSAMS protein-coding gene.

[0096] Even further, the nucleotide sequence of the specific fragment of the PpSAMS protein-coding gene is as shown in positions 537-886 of Sequence 1.

[0097] In some embodiments, the pTRV2 vector containing the specific fragment of the PpSAMS protein-coding gene is the recombinant plasmid pTRV2-PpSAMS. The recombinant plasmid pTRV2-PpSAMS is obtained by replacing the DNA molecule between the BamHI and SmaI restriction enzyme sites of the pTRV2 vector with the DNA molecule shown in positions 537-886 of Sequence 1 and keeping other sequences of the pTRV2 vector unchanged.

[0098] To solve the above technical problems, the present invention also provides a method for promoting the ripening of plant fruits, or reducing the storage quality of plant fruits, or promoting plant cell wall metabolism.

[0099] The method for promoting the ripening of plant fruits, or reducing the storage quality of plant fruits, or promoting plant cell wall metabolism provided by the present invention includes the following steps: increasing the content and / or activity of PpSAMS protein in the target plant.

[0100] Further, the method for increasing the content and / or activity of PpSAMS protein in the target plant is to overexpress PpSAMS protein in the target plant.

[0101] Furthermore, the method of overexpression is to introduce the PpSAMS protein-encoding gene into the target plant. The nucleotide sequence of the PpSAMS protein-encoding gene is as shown in Sequence 1.

[0102] In some embodiments, the PpSAMS protein-encoding gene is introduced into the target plant through the recombinant plasmid pBI121-CaMV35S::PpSAMS-GUS. The recombinant plasmid pBI121-CaMV 35S::PpSAMS-GUS is obtained by replacing the DNA molecule between the two restriction enzyme cleavage sites (BamHI and SmaI) of the pBI121-CaMV 35S::GUS vector with the coding sequence (CDS) of PpSAMS (i.e., the DNA molecule shown in Sequence 1, without the stop codon), and keeping the other sequences of the pBI121-CaMV35S::GUS vector unchanged.

[0103] In some embodiments, the PpSAMS protein-encoding gene is introduced into the target plant through the recombinant plasmid pBI121-CaMV35S::2HA-PpSAMS-eGFP. The recombinant plasmid pBI121-CaMV 35S::2HA-PpSAMS-eGFP is obtained by replacing the DNA molecule between the two restriction enzyme cleavage sites (BamHI and StuI) of the pBI121-CaMV 35S::2HA-eGFP vector with the CDS sequence of the PpSAMS gene (i.e., the DNA molecule shown in Sequence 1, without the stop codon), and keeping the other sequences of the pBI121-CaMV 35S::2HA-eGFP vector unchanged.

[0104] In any of the above applications or methods, the storage quality includes normal temperature storage quality or low temperature storage quality.

[0105] In any of the above-described applications or methods, the plant can be a dicotyledon or a monocotyledon, including but not limited to fruits such as apples, pears, jujubes, peaches, kiwifruits, grapes, oranges, persimmons, plums, apricots, and bananas; vegetable crops such as Arabidopsis thaliana, Chinese cabbages, radishes, peppers, strawberries, tomatoes, watermelons, cucumbers, cabbages, melons, zucchinis, leeks, onions, and carrots; cash crops such as ginseng, tobacco, cotton, sesame, sugarcane, beets, wild sesame, peanuts, and rapeseeds; food crops such as rice, wheat, barley, corn, soybeans, potatoes, legumes, oats, and millet; and flowers such as roses, gladioli, gerberas, carnations, chrysanthemums, lilies, and tulips.

[0106] Further, the plant is a dicotyledon.

[0107] Still further, the dicotyledons include Rosaceae plants and Solanaceae plants.

[0108] Even further, the Rosaceae plants include Malus plants and Prunus plants; the Solanaceae plant is a Solanum plant.

[0109] In some embodiments, the Malus plant is an apple (such as 'Orin').

[0110] In some embodiments, the Prunus plant is a peach (such as 'Laishan Honey').

[0111] In some embodiments, the Solanum plant is a tomato (such as 'Micro-Tom').

[0112] In the present invention, it was found that transient overexpression of the PpSAMS gene in immature 'Micro-Tom' tomato fruits promoted the ripening of tomato fruits; stable overexpression of the PpSAMS gene in 'Orin' apple callus upregulated the activities of cell wall modification-related enzymes, regulated the expression levels of genes related to cell wall metabolism, and promoted the depolymerization of cell wall pectin and the hydrolysis of cellulose; overexpression of the PpSAMS gene in peach fruits showed that overexpression of the PpSAMS gene was not conducive to maintaining the storage quality of peach fruits during postharvest storage at room temperature / low temperature, while virus-mediated silencing of the PpSAMS gene had the opposite effect. These results indicate that the PpSAMS protein can regulate the ripening and softening of plant fruits, laying a foundation for the research on improving the storage quality of plant fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0113] Figure 1 Construction of the pLB-PpSAMS recombinant vector. A: Amplification of the target fragment; B: Colony PCR; C: Double digestion identification; D: Sequencing results.

[0114] Figure 2 For the construction of the recombinant plasmid pBI121-CaMV 35S::PpSAMS-GUS. A: Amplification of the target fragment; B: Colony PCR; C: Double digestion identification; D: Schematic diagram of the recombinant plasmid pBI121-CaMV 35S::PpSAMS-GUS.

[0115] Figure 3 For the effect of overexpressing PpSAMS on the fruit ripening level of 'Micro-Tom' tomatoes. A: Fruit appearance; B: Fruit cross-section; C: Relative expression level of PpSAMS 5 days after overexpression of PpSAMS; D: Hardness; E: Color difference; F: Soluble solids. The relative expression level of PpSAMS was analyzed by independent-samples T-test using SPSS 26.0. Hardness, color difference, and soluble solids were analyzed by one-way ANOVA and Tukey's test using SPSS 26.0.

[0116] Figure 4 For the construction of the recombinant plasmid pBI121-CaMV 35S::2HA-PpSAMS-eGFP. A: Amplification of the target fragment; B: Colony PCR; C: Double digestion identification; D: Schematic diagram of the recombinant plasmid pBI121-CaMV 35S::2HA-PpSAMS-eGFP.

[0117] Figure 5 For the Western blot identification of PpSAMS positive transformed 'Wanglin' callus. A: Theoretical value of the fusion protein molecular weight; B: Western blot results of proteins in the PpSAMS positive transformed cell line.

[0118] Figure 6 For the effect of overexpressing PpSAMS on the cell wall components of 'Wanglin' apple callus. A: Content of water-soluble pectin; B: Content of ionic pectin; C: Content of covalently bound pectin; D: Cellulose content; E: Hemicellulose content.

[0119] Figure 7 For the effect of overexpressing PpSAMS on the activities of cell wall modifying enzymes in 'Wanglin' apple callus. A: Pectin methylesterase activity; B: Polygalacturonase activity; C: Cellulase activity; D: β-Galactosidase activity; E: α-Arabinofuranosidase activity; F: Xyloglucan endotransglycosylase activity.

[0120] Figure 8Effect of overexpressing PpSAMS on the expression of fruit ripening-related genes in the callus of 'Wanglin' apples. A: Detection of the expression level of MdACS1 gene; B: Detection of the expression level of MdACO1 gene; C: Detection of the expression level of MdERF5 gene; D: Detection of the expression level of MdNCED2 gene; E: Detection of the expression level of MdIAA1 gene; F: Detection of the expression level of MdGA2ox gene; G: Detection of the expression level of MdAIPT gene.

[0121] Figure 9 Effect of overexpressing PpSAMS on the appearance and quality of peach fruits during storage at room temperature. A: Fruit appearance; B: Relative expression level of PpSAMS in fruits after 3 days of storage; C: Firmness; D: Color difference; E: Soluble solids; F: Electrolyte leakage rate; G: Weight loss rate.

[0122] Figure 10 Effect of overexpressing PpSAMS on the appearance and quality of peach fruits during storage at low temperature. A: Fruit appearance; B: Relative expression level of PpSAMS in fruits after 3 weeks of storage; C: Firmness; D: Color difference; E: Soluble solids; F: Electrolyte leakage rate; G: Weight loss rate.

[0123] Figure 11 Construction of the pTRV2-PpSAMS recombinant vector. A: Amplification of the target fragment; B: Colony PCR; C: Double digestion identification; D: Schematic diagram of the pTRV2-PpSAMS recombinant plasmid.

[0124] Figure 12 Effect of virus-mediated PpSAMS silencing on the appearance and quality of peach fruits during storage at room temperature. A: Fruit appearance; B: Relative expression level of PpSAMS in fruits after 3 days of storage; C: Firmness; D: Color difference; E: Soluble solids; F: Electrolyte leakage rate; G: Weight loss rate.

[0125] Figure 13 Effect of virus-mediated PpSAMS silencing on the appearance and quality of peach fruits during storage at low temperature. A: Fruit appearance; B: Relative expression level of PpSAMS in fruits after 3 weeks of storage; C: Firmness; D: Color difference; E: Soluble solids; F: Electrolyte leakage rate; G: Weight loss rate. Specific embodiments

[0126] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0127] In the following examples, the experimental methods are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0128] The 'Laishanmi' peach in the following examples is described in the literature "Chen M., Wang Y., Zhao X., Liu M., Jing G., Zhu S. PpPrimPol helps delay postharvest - decay in peach fruit by maintaining mitochondrial function[J]. Postharvest Biology and Technology. 2024, 210, 112795." The public can obtain it from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0129] The 'Micro - Tom' tomato in the following examples is described in the literature "Gonzalez C., Ré M.D., Sossi M.L., Valle E.M., Boggio S.B.. Tomato cv.‘Micro - Tom’as a model system to study postharvest chilling tolerance[J]. Scientia Horticulturae, 2015, 184:63 - 69." The public can obtain it from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0130] The callus of 'Wanglin' apple in the following examples is described in the literature "Wang X., Xu L., Liu X., Xin L., Wu S., Chen X.. Development of potent promoters that drive the efficient expression of genes in apple protoplasts[J]. Horticulture Research, 2021, 8(1):211." The public can obtain it from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0131] The pBI121-CaMV 35S::GUS vector in the following examples is described in the literature "Dai Y., Guo H., Yang Z., et al. Identification of the salt tolerance function of the grape transcription factor VvERF2 [J]. Scientia Agricultura Sinica, 2024, 57(2): 336-348." and can be obtained from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0132] The pBI121-CaMV 35S::2HA-eGFP vector in the following examples is described in the literature "Guo H., Chen A., Yang Z., Yang W., Wang X., Xu, L. Identification of osmotic stress resistance mediated by MdKAI2 in apple [J]. Frontiers in Plant Science, 2024, 15: 1467034." and can be obtained from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0133] The pTRV1 vector in the following examples is described in the literature "Jia HF., Chai YM., Li CL, Qin L, Shen YY. Cloning and characterization of the h subunit of a magnesium chelatase gene (PpCHLH) in peach [J]. Journal of Plant Growth Regulation. 2011, 30: 445-455." and can be obtained from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0134] The pTRV2 vector in the following examples is described in the literature "Jia HF., Chai YM., Li CL, Qin L, Shen YY. Cloning and characterization of the h subunit of a magnesium chelatase gene (PpCHLH) in peach [J]. Journal of Plant Growth Regulation. 2011, 30: 445-455." and can be obtained from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0135] The Agrobacterium tumefaciens strain LBA4404 in the following examples is described in the literature "Pandey V., Misra P., Chaturvedi P., Mishra M.K., Trivedi P.K., Tuli, R.. Agrobacterium tumefaciens-mediated transformation of Withania somnifera (L.) Dunal: an important medicinal plant [J]. Plant Cell Reports, 2010, 29(2): 133-141.", and the public can obtain it from the applicant (Shihezi University). This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0136] Example 1. Obtaining of transient overexpression PpSAMS tomato fruits and analysis of their fruit ripening

[0137] I. Construction of pLB-PpSAMS cloning vector

[0138] 1. Total RNA extraction from peach

[0139] Select 'Laishanmi' peach fruits, and extract the total RNA of peach fruits by the CTAB method (the specific method is described in the literature "Chen Changbao, Zhu Shuhua, Zhou Jie. Improved CTAB method for extracting total RNA from mature Feicheng peach fruits [J]. Shandong Agricultural Sciences, 2009, (05): 102-104.").

[0140] 2. Obtaining of cDNA

[0141] Using OligodT as a primer to synthesize the first strand of cDNA, and the synthesis method refers to the instruction manual of the reverse transcription kit (AG11615) of Aikerui Biological Company.

[0142] 3. Amplification of the full-length CDS of PpSAMS gene

[0143] Using the cDNA obtained in step 2 as a template, and using ApexHF HS DNA Polymerase of Aikerui Biological Company, perform PCR amplification with primers PpSAMS-qc-F and PpSAMS-qc-R to obtain the coding sequence (CDS) of PpSAMS gene. The primer sequences are as follows:

[0144] qcPpSAMS-F: 5'-ATGGAGACCTTCTTGTTCACCT-3';

[0145] qcPpSAMS-R: 5'-TCAAGCTTGGACCTTGTCCCA-3'.

[0146] 4. Construction of the PpSAMS gene cloning vector pLB-PpSAMS

[0147] The target fragment PpSAMS was ligated with the cloning vector (pLB vector) using the pLB zero-background rapid cloning kit (Tiangen, VT205) to obtain the pLB-PpSAMS recombinant cloning vector. It was identified by colony PCR and double digestion (XhoⅠ / KpnⅠ), and then sent for sequencing. The sequencing results showed that the CDS sequence of PpSAMS (i.e., the DNA molecule shown in Sequence 1) had been successfully inserted between the two universal primers of the pLB vector ( Figure 1 ). The primer sequences used for sequencing and colony PCR are as follows:

[0148] pLB-F: 5’-CGACTCACTATAGGGAGAGCGGC-3’;

[0149] pLB-R: 5’-AAGAACATCGATTTTCCATGGCAG-3’.

[0150] II. Construction of the overexpression vector (pBI121-CaMV 35S::PpSAMS-GUS)

[0151] 1. Amplification of the CDS sequence of the PpSAMS gene

[0152] Using the pLB-PpSAMS cloning vector constructed in Step 1 as a template, the CDS sequence of the PpSAMS gene (without the stop codon) with BamHI and SmaI restriction enzyme cleavage sites ligated at both ends was obtained by PCR amplification using the ApexHF HS DNA high-fidelity enzyme from Aikrui Biotech Co., Ltd. and the cloning primers mqPpSAMS-BamHI-F and mqPpSAMS-SmaI-R. The primer sequences are as follows:

[0153] mqPpSAMS-BamHI-F: 5’- cgggatcc ATGGAGACCTTCTTGTTCACCTCT-3’;

[0154] mqPpSAMS-SmaI-R: 5’- tcccccgggga AGCTTGGACCTTGTCCCATTT-3’.

[0155] 2. Enzyme digestion

[0156] The pBI121-CaMV 35S::GUS vector was double-digested with the restriction enzymes BamHI and SmaI to obtain a linearized vector with a size of 14751 bp.

[0157] 3. Recovery and Purification of Linearized Vector and Target Fragment

[0158] The linearized vector with a size of 14751 bp and the target gene sequence were recovered from the gel using Tiangen's ordinary agarose gel DNA recovery kit (DP209).

[0159] 4. Ligation of Linearized Vector and Target Fragment

[0160] T4 DNA ligase was used to ligate the linearized vector with a size of 14751 bp and the target gene sequence at 16 °C to obtain a recombinant vector. The recombinant vector was transformed into competent Escherichia coli DH5α and spread on LB solid medium (kanamycin resistant). Escherichia coli colonies were picked, and colony PCR identification was performed using Ruiboxingke's 2×Taq Plus PCR Master Mix (RB-PCRD01). Positive clones were picked to extract plasmids for restriction enzyme digestion identification (BamHI / SmaI) and sequencing. The plasmid with correct sequencing was designated as pBI121-CaMV 35S::PpSAMS-GUS.

[0161] The sequencing results showed that the recombinant plasmid pBI121-CaMV 35S::PpSAMS-GUS was obtained by replacing the DNA molecule between the two restriction enzyme sites (BamHI and SmaI) of the pBI121-CaMV 35S::GUS vector with the CDS sequence of PpSAMS (i.e., the DNA molecule shown in Sequence 1, excluding the stop codon), and keeping the other sequences of the pBI121-CaMV 35S::GUS vector unchanged( Figure 2 ).

[0162] III. Transformation of Agrobacterium tumefaciens LBA4404

[0163] The overexpression vector of the PpSAMS gene (pBI121-CaMV 35S::PpSAMS-GUS) constructed in Step 2 was transformed into the Agrobacterium tumefaciens strain LBA4404 by the freeze-thaw method, and positive transformed Agrobacterium strains were obtained by PCR identification.

[0164] IV. Transient Transfection of Tomato Fruits and Fruit Ripening Analysis

[0165] 1. Preparation of Infection Solution

[0166] The positive transformed Agrobacterium strain was cultured in 2 mL of LB liquid medium (the solvent of LB liquid medium is water, and the solutes and their concentrations are: yeast extract 5 g·L -1 、tryptone 10 g·L -1 、sodium chloride 10 g·L -1 、rifampicin 50 mg·L -1, kanamycin 50 mg·L -1 ) at 28 °C, 220 r·min -1 Shake culture for 24 h; Pipette 200 μL of the bacterial solution into 10 mL of induced LB liquid medium containing the corresponding antibiotic (the solvent of the induced LB liquid medium containing the corresponding antibiotic is water, and the solutes and their concentrations are respectively: yeast extract 5 g·L -1 , tryptone 10 g·L -1 , sodium chloride 10 g·L -1 , rifampicin 50 mg·L -1 , kanamycin 50 mg·L -1 , 2-morpholinoethanesulfonic acid 10 mmol·L -1 , acetosyringone 200 μmol·L -1 ) at 28 °C, shake culture for 12 h; Centrifuge at 5000 rpm for 10 min, discard the supernatant; Add 10 mL of resuspension solution (the solvent of the resuspension solution is water, and the solutes and their concentrations are respectively: magnesium chloride 10 mmol·L -1 , 2-morpholinoethanesulfonic acid 10 mmol·L -1 , acetosyringone 200 μmol·L -1 ), fully suspend and adjust the OD of the bacterial solution 600 to 0.8, and let it stand at room temperature in the dark for 3 h.

[0167] 2. Transient transformation

[0168] Select the 'Micro-Tom' tomato fruits at 30 days after anthesis as the experimental materials. Use a disposable sterile syringe to slowly inject the infection solution into the tomato fruits from the top of the fruits until the bacterial solution overflows from the calyx. After the injection is completed, place the tomato fruits in an incubator (26 °C, 16 h light / 8 h dark) for continued cultivation. Observe and record the changes of the tomato fruits at 0 day, 3 days, 5 days, and 7 days after the injection, and measure the relevant physical and chemical indexes (color difference, hardness, soluble solids). The measurement methods of color difference, hardness, and soluble solids refer to the method in the literature "Wang C, Huang D, Tian W, Zhu S. Nitric oxide alleviates mitochondrial oxidative damage and maintains mitochondrial functions in peach fruit during cold storage[J]. Scientia Horticulturae. 2021, 287: 110249." At the same time, use the tomato fruits transfected with the positive transformed Agrobacterium tumefaciens strain of the control vector (pBI121-CaMV 35S::GUS, without the CDS sequence of the PpSAMS gene) as the control group (CT).

[0169] The results are as Figure 3 shown. The results indicate that, compared with the control group, transient overexpression of PpSAMS significantly promoted tomato fruit color change, significantly reduced tomato fruit firmness, and significantly increased the color difference and soluble solid content of tomato fruits, indicating that overexpression of the PpSAMS gene significantly promoted tomato fruit ripening and softening.

[0170] Example 2. Obtaining of PpSAMS transgenic apple callus and its cell wall metabolism analysis

[0171] I. Obtaining and identification of PpSAMS transgenic apple callus

[0172] The pBI121-CaMV 35S::2HA-PpSAMS-eGFP overexpression vector was constructed by homologous recombination method. The specific steps are as follows:

[0173] 1. Primer design for PpSAMS gene cloning

[0174] According to the PpSAMS gene sequence and the pBI121-CaMV 35S::2HA-eGFP vector, gene-specific primers were designed. The primer sequences are as follows (the underlines represent the linker sequences required for vector construction):

[0175] hrPpSAMS-BamHI-F: 5’- gttccagactacgctggatcc ATGGAGACCTTCTTGTTCACCTCT-3’;

[0176] hrPpSAMS-StuI-F: 5’- ctcgcccttgctcacaggcct AGCTTGGACCTTGTCCCATTT-3’.

[0177] 2. Amplification of the full-length CDS region of the PpSAMS gene

[0178] Using the vector pLB-PpSAMS constructed in Example 1 as a template, PCR amplification was performed with the primers in step 1 to obtain the PpSAMS gene fragment (containing homologous arms, BamHI and StuI restriction sites).

[0179] 3. Construction of the PpSAMS gene overexpression vector pBI121-CaMV 35S::2HA-PpSAMS-eGFP

[0180] The pBI121-CaMV 35S::2HA-eGFP vector was double-digested with restriction endonucleases BamHI and StuI to obtain the vector digestion product. The vector digestion product and the PpSAMS gene fragment obtained in step 2 were incubated at 37 °C for 30 min, and using The Universal CloneMix kit (#24305) was used for homologous recombination to obtain a recombinant vector. The recombinant vector was identified by PCR and double digestion and then sequenced. The plasmid with correct sequencing was designated as pBI121-CaMV35S::2HA-PpSAMS-eGFP.

[0181] The sequencing results showed that the recombinant plasmid pBI121-CaMV 35S::2HA-PpSAMS-eGFP was obtained by replacing the DNA molecule between the two restriction enzyme sites (BamHI and StuI) of the pBI121-CaMV35S::2HA-eGFP vector with the CDS sequence of the PpSAMS gene (i.e., the DNA molecule shown in Sequence 1, excluding the stop codon), while keeping the other sequences of the pBI121-CaMV 35S::2HA-eGFP vector unchanged ( Figure 4 ).

[0182] 4. Construction of recombinant Agrobacterium

[0183] The overexpression vector of the PpSAMS gene (pBI121-CaMV 35S::2HA-PpSAMS-eGFP) was transformed into the Agrobacterium tumefaciens strain LBA4404 by the freeze-thaw method, and a positive transformed Agrobacterium strain was obtained by PCR identification.

[0184] 5. Obtaining and identification of PpSAMS overexpressing apple calli

[0185] The wild-type 'Orin' apple calli were transfected by the Agrobacterium-mediated method. The cell lines that could grow on the MS resistance screening medium containing 300 mg·L -1 carbenicillin and 30 mg·L -1 kanamycin were selected. The PpSAMS positive transformed cell lines were identified by Western blotting. The specific steps were referred to the method in the literature "Wang X., Xu L., Liu X., Xin L., Wu S., Chen X.. Development of potent promoters that drive the efficient expression of genes in apple protoplasts[J]. Horticulture Research, 2021, 8(1): 211.". The apple callus cell line transfected with the positive transformed Agrobacterium strain of the control vector (pBI121-CaMV 35S::2HA-eGFP, without the CDS sequence of the PpSAMS gene) was used as the control group (CT).

[0186] The results were asFigure 5 The results showed that the specific protein bands displayed by cell lines 4#, 5# and 9# represented proteins with molecular weights consistent with the theoretical values, that is, apple callus overexpressing 2HA-PpSAMS-eGFP fusion protein was obtained.

[0187] 2. Analysis of cell wall metabolism in PpSAMS-overexpressing apple callus

[0188] 1. Analysis of cell wall component content and modification-related enzyme activities in PpSAMS overexpressed apple callus

[0189] The contents of water-soluble pectin, ionic pectin, covalently bound pectin, hemicellulose and cellulose in the cell wall components of PpSAMS-overexpressed apple callus, as well as the enzymatic activities of pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase, xyloglucan endotransglycosylase and polygalacturonase were detected.

[0190] The content of water-soluble pectin, ionic pectin, covalently bound pectin, hemicellulose and cellulose was determined as follows: cell wall material was extracted from PpSAMS overexpressed apple callus tissue using the 'ethanol-acetone method' (for specific steps, refer to the method in the literature "Wei Jianmei, Ma Fengwang, Guan Junfeng, Yuan Junwei, Zhu Xiangqiu. Cell wall metabolism and its regulation during the ripening and softening of Beijing white pear fruit [J]. Chinese Agricultural Science, 2009, 42(08): 2987-2996"). Then, the 'sodium acetate-CDTA-Na 2 CO 3Method: Pectin, hemicellulose and cellulose are gradually separated from the cell wall material (for specific steps, please refer to the method in the literature "Wei Jianmei, Ma Fengwang, Guan Junfeng, Yuan Junwei, Zhu Xiangqiu. Cell wall metabolism and its regulation during the ripening and softening of Beijing white pear fruit [J]. Chinese Agricultural Science, 2009, 42(08): 2987-2996"). The separated pectin (water-soluble pectin, ionic pectin, covalently bound pectin content) was determined by carbazole colorimetry (for specific steps, refer to the method in the literature “Zhao Y., Zhu X., Hou Y., Wang X., Li X.. Effects of nitric oxide fumigation treatment on retarding cell wall degradation and delaying softening of winter jujube (Ziziphus jujuba Mill. cv. Dongzao) fruit during storage [J]. Postharvest Biology Technology, 2019, 156: 110954.”), and the separated cellulose (supernatant) / cellulose (sediment) content (supernatant was used for hemicellulose content determination, and precipitate was used for cellulose content determination) was determined by anthrone colorimetry (for specific steps, refer to the literature “Zhao Y., Zhu X., Hou Y., Wang X., Li X.. Effects of nitric oxide fumigation treatment on retarding cell wall degradation and delaying softening of winter jujube (Ziziphus jujuba Mill.cv.Dongzao) fruit during storage [J]. Postharvest BiologyTechnology, 2019,156:110954." method).

[0191] The determination method of pectin methylesterase (PME) comprises the following steps: (1) taking 0.5 mL of the supernatant, adding 2 mL of 1% pectin and two drops of phenolphthalein indicator, and using 0.01 mol·L -1 NaOH was titrated to a light red color (pH = 7.4); (2) the mixture was kept at 37°C for 30 min, during which time 0.01 mol·L -1 NaOH keeps it light red, and the volume of NaOH used is recorded. The amount of enzyme that consumes 1 μmol of NaOH per hour is counted as one PME activity unit.

[0192] The method for determining polygalacturonase (PG) activity includes the following steps: (1) Add 500 μL of PG reaction solution (0.1% (w / v) polygalacturonic acid, 40 mmol·L -1 sodium acetate, pH = 5.2) to 100 μL of the enzyme extract, mix well, and incubate at 37 °C for 2 h. (2) Next, quickly add 1.5 mL of 3,5-dinitrosalicylic acid reagent, heat in boiling water for 5 min, and quickly cool to room temperature. (3) After cooling, make up the volume to 25 mL, mix well, and measure the absorbance value of the solution at 540 nm. The amount of enzyme that produces 1 μmol of galacturonic acid per hour is counted as one PG activity unit.

[0193] The method for determining carboxymethylcellulase (CMC) activity includes the following steps: (1) Add 500 μL of CXC reaction solution (0.25% (w / v) carboxymethyl cellulose, 40 mmol·L -1 sodium acetate, pH = 5.2) to 100 μL of the enzyme extract, mix well, and incubate at 37 °C for 2 h. (2) Add 2 mL of 100 mmol·L -1 Na 2 B 4 O 7 (pH = 9.0) to terminate the reaction. (3) Then add 2 mL or 100 μL of 1% (w / v) α-aminoacetamide, boil in boiling water for 5 min, cool to room temperature, and colorimetrically determine at 276 nm.

[0194] The methods for determining β-galactosidase (β-Gal) and α-arabinosidase (α-AFase) include the following steps: (1) Mix 100 μL of the enzyme extract with 1 mL of 0.1 mol·L -1 sodium acetate (pH 5.0) and 0.2 mL of 10 mg·L -1 appropriate substrate (β-Gal uses p-nitrophenyl galactoside as the substrate, and α-AFase uses p-nitrophenyl arabinoside as the substrate), and incubate at 30 °C for 1 h. (2) Take 0.25 mL of equal amounts of the reactants, mix with an equal volume of 1 mol·L -1 ammonium hydroxide to terminate the reaction, and measure the absorbance at a wavelength of 400 nm. The amount of enzyme that produces 1 μmol of p-nitrophenol per hour is counted as 1 β-Gal / α-AFase activity unit.

[0195] The determination method of xyloglucan endotransglucosylase (XET) includes the following steps:

[0196] (1) Mix 500 μL of enzyme extract with 1 mL of 0.1 mol·L -1 sodium acetate (pH 5.0) and 0.2 mL of 0.1% (w / v) xylan, and incubate at 37 °C for 1 h. (2) Add 1.5 mL of 3,5-dinitrosalicylic acid reagent, heat in boiling water for five minutes, then quickly cool to room temperature, dilute to the 25 mL mark with distilled water, mix well, and measure the absorbance at a wavelength of 540 nm. One unit of XET enzyme activity is defined as the amount of enzyme that decomposes 1 μmol of xylose per gram of fresh sample per minute at 37 °C.

[0197] The results are as Figure 6 and Figure 7 shown. The results show that compared with the control group, the contents of water-soluble pectin, ionic pectin, covalently bound pectin, and hemicellulose in the cell wall components of PpSAMS-overexpressing apple callus are significantly increased, and the cellulose content is significantly decreased, indicating that PpSAMS overexpression promotes the depolymerization of pectin and the hydrolysis of cellulose ( Figure 6 ). The activities of pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase, and xyloglucan endotransglucosylase in the cell wall of PpSAMS-overexpressing apple callus are significantly up-regulated ( Figure 7 ), indicating that PpSAMS overexpression significantly increases the activities of enzymes related to cell wall modification and hydrolysis.

[0198] 2. Analysis of the expression levels of fruit ripening-related genes in PpSAMS-overexpressing apple callus

[0199] Total RNA was extracted using the Trizol method (ComWin Biotech, CW0581M), and then cDNA was obtained by reverse transcription using a reverse transcription kit (Tiangen, KR118). Real-time fluorescence quantitative PCR amplification was performed on a fluorescence quantitative PCR instrument CFX96 (Bio-Rad, USA) using the SYBR Green qPCR SuperMix (TransGen Biotech, AQ601) to detect the expression levels of cell wall metabolism-related genes. Quantitative analysis was performed using the 2 method, and Mdactin (XM_008393049.3) was used as the internal reference gene. Samples transformed with pBI121-CaMV 35S::2HA-eGFP (denoted as CT) were used as controls, and each sample was subjected to 3 biological replicates. After normalization with the Mdactin gene, through the 2 -ΔΔCT method, and with the sample transformed with pBI121-CaMV 35S::2HA-eGFP (denoted as CT) as the control, each sample was subjected to 3 biological replicates. After normalization with the Mdactin gene, through the 2 -△△CTThe relative expression levels of target genes were calculated by the 2−ΔΔCt method and were presented as the fold change of PpSAMS−OE samples relative to CT samples. The specific primer sequences for detecting fruit ripening−related genes are shown in Table 1.

[0200] Table 1. Primers used for quantitative real−time PCR

[0201]

[0202]

[0203] The results are as Figure 8 shown. Compared with the control group, the expression levels of MdACS1, MdACO1, MdERF5, and MdIAA1 genes in PpSAMS−overexpressing apple calli were significantly upregulated, while the expression levels of MdNCED2, MdGA2ox, and MdAIPT genes were decreased, indicating that the expression levels of fruit ripening−related genes involved in apple ethylene synthesis and signal transduction were significantly regulated by the PpSAMS gene.

[0204] Example 3. Obtaining of PpSAMS−transformed peach fruits and analysis of their fruit storage quality

[0205] I. Obtaining of transiently overexpressing PpSAMS peach fruits and analysis of their fruit storage quality

[0206] 1. Obtaining of PpSAMS−overexpressing peach fruits

[0207] Physiologically mature ‘Laishanmi’ peach fruits were transiently infected by the Agrobacterium−mediated method, and the specific method was the same as that in step 4 of Example 1. Peach fruits transfected with the recombinant vector containing the PpSAMS gene (pBI121−CaMV 35S::PpSAMS−GUS) were used as the experimental group, denoted as PpSAMS−OE, and peach fruits transfected with the control vector without the PpSAMS gene (pBI121−CaMV 35S::GUS) were used as the control group, denoted as CT.

[0208] 2. Analysis of the storage quality of PpSAMS−overexpressing peach fruits

[0209] After injection, the peach fruits were placed in incubators at 20 - 25 °C (room temperature) and 0 - 4 °C (low temperature) respectively in the dark for room temperature storage and low temperature storage; the changes in fruit quality were observed and recorded regularly (for room temperature storage, the relevant physical and chemical indexes were observed, recorded and detected on the 0th, 3rd, 5th and 7th days after treatment; for low temperature storage, the relevant physical and chemical indexes were observed, recorded and detected once a week for 5 weeks in total). The relevant physical and chemical indexes included color difference, hardness, soluble solids, electrolyte leakage rate and weight loss rate. The determination methods of each physical and chemical index referred to the method in the literature "Wang C, Huang D, Tian W, Zhu S. Nitric oxide alleviates mitochondrial oxidative damage and maintains mitochondrial functions in peach fruit during cold storage[J]. Scientia Horticulturae. 2021, 287:110249.".

[0210] The analysis results of the storage quality of peach fruits under room temperature conditions are as Figure 9 shown: After 3 days of room temperature storage, compared with the control group, there was little difference in the appearance of PpSAMS overexpressing peach fruits, but the fruit hardness decreased significantly, and the color difference, soluble solids and electrolyte leakage rate increased significantly; after 5 days of room temperature storage, compared with the control group, the PpSAMS overexpressing peach fruits had a higher maturity, and more serious mildew appeared on the appearance, and the electrolyte leakage rate and weight loss rate of the fruits increased significantly.

[0211] The analysis results of the storage quality of peach fruits under low temperature conditions are as Figure 10 shown: After 2 weeks of low temperature storage, compared with the control group, the PpSAMS overexpressing peach fruits had a more serious mildew on the outside, the soluble solids level increased significantly, the fruit hardness began to decrease significantly from the 3rd week, and the color difference, soluble solids, electrolyte leakage rate and weight loss rate increased significantly.

[0212] The above research shows that the overexpression of PpSAMS promotes the ripening and softening of peach fruits stored at room temperature / low temperature, and reduces the storage quality of peach fruits under room temperature / low temperature conditions.

[0213] II. Obtaining of peach fruits with virus-mediated PpSAMS silencing and analysis of their fruit storage quality

[0214] 1. Obtaining of peach fruits with virus-mediated PpSAMS silencing

[0215] (1) Using the pLB-PpSAMS recombinant cloning vector in Example 1 as a template, and based on the PpSAMS gene CDS sequence and the pTRV2 vector, the following specific primers were designed to amplify the conserved sequence of the PpSAMS gene CDS region (including homologous arms, BamHI and SmaI restriction sites):

[0216] vigsPpSAMS-BamHI-F: 5’-agaaggcctccatggggatccCAAGGGTGCCATGGTTCCA-3’;

[0217] vigsPpSAMS-SmaI-R: 5’-tgtcttcgggacatgcccgggTGGCCACAATGCTCTTGGC-3’.

[0218] (2) The pTRV2 vector was double-digested with restriction endonucleases BamHI and SmaI to obtain the vector digestion product.

[0219] (3) The vector digestion product obtained in step (2) and the PpSAMS gene conserved sequence obtained in step (1) were incubated at 37 °C for 30 min, and homologous recombination was carried out using the Universal CloneMix kit (Tolo Harbour, #24305) to obtain the recombinant vector. The recombinant vector was identified by PCR and double digestion and submitted for sequencing. The plasmid with correct sequencing was designated as pTRV2-PpSAMS.

[0220] The sequencing results showed that: the recombinant plasmid pTRV2-PpSAMS was obtained by replacing the DNA molecule between the BamHI and SmaI restriction sites of the pTRV2 vector with the DNA molecule shown at positions 537-886 of Sequence 1, and keeping the other sequences of the pTRV2 vector unchanged ( Figure 11 ).

[0221] (4) The pTRV1 vector and the pTRV2-PpSAMS recombinant vector were respectively transformed into Agrobacterium tumefaciens LBA4404 by the freeze-thaw method. After PCR identification, the positive Agrobacterium strains LBA4404 / pTRV1 and LBA4404 / pTRV2-PpSAMS were obtained respectively. The positive transformed Agrobacterium strains were respectively cultured in 2 mL of LB liquid medium (the solvent of the LB liquid medium is water, and the solutes and their concentrations are: yeast extract 5 g·L -1 , tryptone 10 g·L -1 , sodium chloride 10 g·L -1 , rifampicin 50 mg·L -1 , kanamycin 50 mg·L -1 ), at 28 °C, 220 r·min-1 Oscillate and culture for 24 h; Pipette 200 μL of the bacterial liquid into 10 mL of induced LB liquid medium containing the corresponding antibiotic (the solvent of the induced LB liquid medium containing the corresponding antibiotic is water, and the solutes and their concentrations are respectively: yeast extract 5 g·L -1 , tryptone 10 g·L -1 , sodium chloride 10 g·L -1 , rifampicin 50 mg·L -1 , kanamycin 50 mg·L -1 , 2-(N-morpholino)ethanesulfonic acid 10 mmol·L -1 , acetosyringone 200 μmol·L -1 ), oscillate and culture at 28 °C for 12 h; Centrifuge at 5000 rpm for 10 min, discard the supernatant; Add 10 mL of resuspension solution (the solvent of the resuspension solution is water, and the solutes and their concentrations are respectively: magnesium chloride 10 mmol·L -1 , 2-(N-morpholino)ethanesulfonic acid 10 mmol·L -1 , acetosyringone 200 μmol·L -1 ), fully suspend and adjust the OD of the bacterial liquid 600 to 0.8, and mix the two bacterial liquids at a volume ratio of 1:1 (V / V). After standing in the dark at 28 °C for 3 h, inject and infect the 'Laishanmi' peach fruits with the mixed bacterial liquid, and the specific method is the same as step four in Example 1. pTRV1::pTRV2 represents the peach fruits transfected with Agrobacterium tumefaciens co-transformed with the pTRV2 and pTRV1 vectors without the conserved sequence of the PpSAMS gene, which is the control group; pTRV1::pTRV2-PpSAMS represents the peach fruits transfected with Agrobacterium tumefaciens co-transformed with the pTRV2 vector containing the conserved sequence of the PpSAMS gene and the pTRV1 vector, which is the experimental group.

[0222] 2. Analysis of the storage quality of PpSAMS-silenced peach fruits

[0223] After injection, the peach fruits are placed in the dark in incubators at 20 - 25 °C (room temperature) and 0 - 4 °C (low temperature) for room temperature storage and low temperature storage respectively, and the relevant physical and chemical indexes are detected; Regularly observe and record the changes in fruit quality (for room temperature storage, observe and record on the 0th day, 3rd day, 5th day, and 7th day after treatment; for low temperature storage, observe and record once a week and detect the relevant physical and chemical indexes, and observe for a total of 5 weeks).

[0224] The results of the analysis of the storage quality of peach fruits under room temperature conditions are as Figure 12Shown as follows: PpSAMS silencing significantly inhibited the ripening and mildew levels of peach fruits during storage at room temperature. After 3 days of storage at room temperature, compared with the control group, there was little difference in the appearance of PpSAMS-silenced peach fruits, but the fruit firmness increased significantly, and the color difference, electrolyte leakage rate, and weight loss rate decreased significantly. After 5 days of storage at room temperature, compared with the control group, PpSAMS silencing significantly inhibited the ripening and mildew levels of peach fruits, and the color difference, soluble solids, electrolyte leakage rate, and weight loss rate decreased significantly.

[0225] The analysis results of the storage quality of peach fruits under low-temperature conditions are as Figure 13 Shown as follows: Compared with the control group, PpSAMS silencing significantly inhibited the ripening and mildew levels of peach fruits during low-temperature storage. After the second week of low-temperature storage, compared with the control group, the soluble solids content of PpSAMS-silenced peach fruits decreased significantly. After the third week of low-temperature storage, the firmness increased significantly, the electrolyte leakage rate decreased significantly, and the soluble solids content was still significantly lower than the control level. After the fourth week of low-temperature storage, the firmness was still significantly higher than the control level, and the color difference, soluble solids content, and weight loss rate were still significantly lower than the control level.

[0226] The above research results confirmed that PpSAMS gene silencing significantly inhibited the ripening and softening of peach fruits during storage at room temperature / low temperature, and improved the storage quality of peach fruits under room temperature / low temperature conditions.

[0227] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made using conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. Use of PpSAMS protein or a substance for regulating the content and / or activity of the PpSAMS protein in any of the following A1)-A10): A1) regulating the ripening or softening of plant fruits; A2) Regulating the storage quality of plant fruits; A3) Regulates plant cell wall metabolism; A4) Breeding plants with altered fruit ripening or softening or storage quality or cell wall metabolism; A5) Plant breeding; A6) preparing products for regulating ripening or softening of plant fruits; A7) preparing products for regulating the storage quality of plant fruits; A8) preparing products for regulating plant cell wall metabolism; A9) preparing products of plants with altered fruit ripening or softening or storage quality or cell wall metabolism; A10) preparing plant breeding products; The PpSAMS protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

2. Use of the biological material related to the PpSAMS protein in claim 1 in any of the following A1)-A10): A1) regulating the ripening or softening of plant fruits; A2) Regulating the storage quality of plant fruits; A3) Regulates plant cell wall metabolism; A4) Breeding plants with altered fruit ripening or softening or storage quality or cell wall metabolism; A5) Plant breeding; A6) preparing products for regulating ripening or softening of plant fruits; A7) preparing products for regulating the storage quality of plant fruits; A8) preparing products for regulating plant cell wall metabolism; A9) preparing products of plants with altered fruit ripening or softening or storage quality or cell wall metabolism; A10) preparing plant breeding products; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the PpSAMS protein of claim 1; E2) a nucleic acid molecule that inhibits the expression of the gene encoding the PpSAMS protein of claim 1 or silences or knocks out the gene encoding the PpSAMS protein of claim 1; E3) an expression cassette containing the nucleic acid molecule described in E1) or E2); E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3); E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4).

3. The use according to claim 2, characterized in that: E1) The nucleic acid molecule is any one of the following: F1) The DNA molecule shown in Sequence 1; F2) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in F1) and encodes the PpSAMS protein.

4. The use according to any one of claims 1 to 3, characterized in that: The regulation of plant fruit ripening or softening or the regulation of plant fruit storage quality is embodied in any one of the following M1)-M7): M1) Regulates the color change of plant fruits; M2) regulates the firmness of plant fruits; M3) Regulates the color difference of plant fruits; M4) Regulate the soluble solid content of plant fruits; M5) regulates electrolyte leakage rate of plant fruits; M6) regulating the weight loss rate of plant fruits; M7) regulates the expression of genes related to plant fruit ripening.

5. The use according to any one of claims 1 to 4, characterized in that: The regulation of plant cell wall metabolism is embodied in any one of the following N1)-N4): N1) regulates the pectin content in the cell walls of plant fruits; N2) regulates the cellulose content in the cell walls of plant fruits; N3) regulates the hemicellulose content in the cell walls of plant fruits; N4) regulates the activity of cell wall-modifying enzymes in the cell walls of plant fruits.

6. The use according to claim 5, characterized in that: The fruit ripening-related genes include MdACS1, MdACO1, MdERF5, MdIAA1, MdNCED2, MdGA2ox and / or MdAIPT; Or, the pectin includes water-soluble pectin, ionic pectin and / or covalently bound pectin; Alternatively, the cell wall modification-related enzymes include pectin methylesterase, cellulase, β-galactosidase, α-arabinofuranosidase and / or xyloglucan endotransglycosylase.

7. A method for inhibiting the ripening of plant fruits or improving the storage quality of plant fruits or inhibiting the metabolism of plant cell walls, comprising the following steps: reducing the content and / or activity of PpSAMS protein in the target plant; The PpSAMS protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

8. The method according to claim 7, characterized in that: The method for reducing the content and / or activity of the PpSAMS protein in the target plant is to introduce a substance that silences the gene encoding the PpSAMS protein into the target plant.

9. A method for promoting plant fruit ripening or reducing plant fruit storage quality or promoting plant cell wall metabolism, comprising the following steps: increasing the content and / or activity of PpSAMS protein in the target plant; The PpSAMS protein is any one of the following B1)-B4): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

10. The method according to claim 9, characterized in that: The method for increasing the content and / or activity of the PpSAMS protein in the target plant is to overexpress the PpSAMS protein in the target plant.

Images