Novel tsRNA high-sensitivity detection kit based on CRISPR / Cas13a-Cas14a

Abstract

The invention discloses a novel tsRNA high-sensitivity detection kit based on CRISPR (clustered regularly interspaced short palindromic repeats) / Cas13a-Cas14a, and belongs to the field of tumor marker detection. The tsRNA (tRNA-derived small RNA) is a diagnostic marker which is found recently and has great potential. In order to realize the clinical transformation of tsRNA as soon as possible, the tsRNA detection kit is developed on the basis of nuclease P1 combined with CRISPR / Cas13a-Cas14a linkage dual systems, and comprehensive, ultra-sensitive, high-specificity, low-cost and rapid tsRNA detection is realized through multiple signal amplification. Compared with the traditional technology, the sensitivity of the method is improved by 105-107 times, 1% of tsRNA in the mixture can be detected, and the method has more advantages in clinical application. Therefore, a new scheme is provided for application of the tsRNA in clinical diagnosis of diseases, and meanwhile, a reliable technology is provided for mechanism research of the tsRNA in occurrence and development of the diseases.

Description

Technical Field

[0001] The present invention belongs to the field of tumor marker detection, and particularly relates to a primer composition, a detection kit and a detection method for detecting tsRNA by using a CRISPR / Cas13a and CRISPR / Cas14a system and a nuclease P1. Background Art

[0002] tRNA-derived small RNA (tsRNA), as a class of emerging non-coding small RNAs, is mainly generated by the precise cleavage of tRNA under stress conditions or by specific enzymes (such as ANG, Dicer). Research shows that tsRNA regulates gene expression through a multi-dimensional regulatory network and is widely involved in the pathological processes of cancer, neurodegenerative diseases, metabolic diseases and cardiovascular diseases. At the post-transcriptional level, some tsRNAs directly regulate gene expression by binding to the 3′UTR region of mRNA. For example, tRF-3017A promotes the migration and invasion of gastric cancer cells by silencing the tumor suppressor gene NELL2. At the epigenetic level, certain tRFs (such as tRF3-Thr-AGT) can target the DNA methyltransferase DNMT3B and affect the global DNA methylation pattern. At the protein interaction level, tsRNA can directly intervene in the signal pathway by binding to proteins. For example, tRF3E can promote p53 translation by competitively binding with NCL, thereby inhibiting the proliferation of cancer cells. In addition, tsRNA can also activate natural immune pathways such as TLR / RLR and participate in the antiviral immune response. For example, TRF-3 AlaUGC can induce an immune response in helper T cells 1 (Th1) and cytotoxic T lymphocytes (CTL) by stimulating TLR3. These findings prove that tsRNA is a key node in the cancer regulatory network and provides a new perspective for precision medicine. TsRNA shows great potential as a diagnostic marker due to its advantages such as wide distribution, stable structure, long half-life and tissue specificity. Research shows that tsRNA-36803 is used for the detection of pancreatic cancer, and the detection sensitivity can reach 85%. Combining with the traditional marker CA19-9 can significantly increase the early diagnosis rate to 92%. In summary, tsRNA plays an important role in many cancers and is a potential marker for early cancer diagnosis, which can indicate the occurrence of diseases and evaluate the prognosis, and has important potential for clinical diagnosis applications. There is an urgent need to develop a rapid, sensitive, accurate and low-cost tsRNA detection method to help the basic research of tsRNA turn to clinical applications.

[0003] Currently, the main methods for tsRNA detection include small RNA sequencing, RT-PCR, and Northern Blot. Although these methods meet the scientific research needs to a certain extent, their many limitations seriously hinder the application and popularization of tsRNA in clinical diagnosis. First of all, these methods require a large amount of samples (usually starting samples need 600 ng to 2 μg), which not only increases the complexity and workload of sample processing, but also places high requirements on sample quality. Secondly, these methods are complex to operate and have a long detection cycle (ranging from 8 h to 30 days), making it difficult to meet the need for rapid detection in clinical diagnosis. Finally, these methods rely on expensive instruments and skilled operators, and the cost of single detection is relatively high (ranging from 500 yuan to 3000 yuan), which further limits their wide application in the clinical environment. Therefore, there is an urgent need to develop highly specific, ultrasensitive, rapid, and accurate methods to realize the clinical application of tsRNA.

[0004] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated protein (Cas) is not only an important means of gene editing, but also occupies an important position in the field of biosensors due to its high specificity and powerful signal amplification ability. Especially the CRISPR / Cas13a system, under the action of guide RNA (crRNA / gRNA), the CRISPR / Cas13a system specifically recognizes and cleaves target RNA, and at the same time trans-cleaves a large number of surrounding RNA probes in a 17s -1 way to achieve signal amplification, which is an important RNA detection method without reverse transcription. The system can output signals within 30 minutes under constant temperature conditions and does not rely on large instruments, making it the preferred technology for sensitive and rapid RNA detection. As an emerging DNA diagnostic technology, CRISPR / Cas14a can specifically recognize DNA based on gRNA, and also has the characteristics of powerful trans-cleavage of DNA probes, simple operation, and rapidity.

[0005] There is no tsRNA detection technology using CRISPR / Cas13a and CRISPR / Cas14a technologies at home and abroad. Therefore, establishing a tsRNA detection method combining nuclease P1 with the CRISPR / Cas13a-Cas14a dual system can provide a reliable technology for the study of tsRNA mechanisms, and at the same time provide technical support for disease diagnosis and prediction. Summary of the Invention

[0006] In view of the defects of existing tsRNA detection technologies, such as cumbersome operation, time-consuming, limited sensitivity, and large sample requirements, the present invention will develop a tsRNA detection method based on the combination of nuclease P1 and the CRISPR / Cas13a-Cas14a dual system, construct a simple, rapid, and accurate tsRNA detection method, and use a multiple signal method to improve sensitivity and achieve low sample volume detection.

[0007] To achieve the above object, the technical solution adopted by the present invention is: a nucleotide composition for highly sensitive detection of tsRNA, comprising 3 DNA sequences and 3 RNA sequences. The 3 DNA sequences include: a tsRNA-Ala-AGC-3end probe, whose nucleotide sequence is as shown in SEQ ID No.1; a DNA target, whose nucleotide sequence is as shown in SEQ ID No.2; a DNA reporter, whose nucleotide sequence is as shown in SEQ ID No.3. The 3 RNA sequences include: an RNA reporter, a crRNA, and a gRNA, whose nucleotide sequences are as shown in SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6 respectively.

[0008] tsRNA-Ala-AGC-3end probe (SEQ ID No.1):

[0009] Cy5-TGGAGAATGTGGGCATCGATCCCACTACCTC-BHQ3.

[0010] DNA target (SEQ ID No.2):

[0011] 5`-TTTTTCATAGTTACATTCTCCCAGTTGATCTGCTTTTTT-3`.

[0012] DNA reporter (SEQ ID No.3): FAM-TTTTTTTTTTTT-BHQ1.

[0013] RNA reporter (SEQ ID No.4): FAM-UAUAUA-BHQ1

[0014] crRNA (SEQ ID No.5):

[0015] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCACUACCU CUUGCAUGCUAAGCAAGCGC.

[0016] gRNA (SEQ ID No.6):

[0017] GUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGAAAGAAUGAAGGAAUGCAACUCAACUGGGAGAAUGUAACU。

[0018] Specifically, when designing the sequence, the targeting position of the crRNA is designed at the middle position of the tRNA.

[0019] Furthermore, the composition is applicable to the CRISPR / Cas13a-Cas14a linked dual system, and the gRNA in the Cas14a system serves as the trans-cleavage substrate for the Cas13a system.

[0020] The present invention also provides a tsRNA hypersensitive detection kit, which includes the above nucleotide composition.

[0021] Furthermore, the above kit also includes nuclease P1, reagents for the CRISPR / Cas13a detection system, and reagents for the CRISPR / Cas14a detection system.

[0022] Specifically, three systems can be constructed using the above kit:

[0023] (1) Nuclease P1 system: 1 μL of 10× NEB buffer 1.1, 1 μL of 5 μM tsRNA-Ala-AGC-3end probe, 2 μL of ddH 2 O, 1 μL of 200 U nuclease P1, and 5 μL of the sample to be tested. After mixing, react at 37 °C for 7 min, and collect the fluorescence signal of Cy5;

[0024] (2) CRISPR / Cas13a system: Add the above system (1) to a reaction system containing 2 μL of 1-2.5 μM Cas13a, 2 μL of 0.1-1.5 μM crRNA, 1 μL of 10-30 μM gRNA, 2 μL of 10× Reaction Buffer, and 3 μL of ddH 2 O, mix well and incubate at 37 °C for 30 min;

[0025] (3) CRISPR / Cas14a system: In the system described in (2) above, add 1 μL of 0.5 - 1.5 μM Cas14a, 1 μL of 1 μM DNA target, 2 μL of 15 - 25 μM DNA reporter, 2 μL of 10× Reaction Buffer and 4 μL of ddH 2 O, mix well and incubate at 37 °C for 1 h, and collect FAM fluorescence signals.

[0026] The results of the above kit are determined as follows: Collect the Cy5 signal of the nuclease P1 system and the FAM signal of the CRISPR / Cas13a - Cas14a system, and comprehensively consider the signal of the nuclease P1 system (P / control P 0 ) and the ratio of the CRISPR / Cas dual - system signal (C / control C 0 ) to judge the tsRNA abundance: P / P 0 <1 and C / C 0 >1, then it is tsRNA; P / P 0 <1 and C / C 0 <1, then it is tRNA; P / P0 > 1 means there is no tsRNA and tRNA.

[0027] The application of the composition described in the present invention in the preparation of tsRNA detection articles based on the linkage dual - system of nuclease P1 combined with CRISPR / Cas13a - Cas14a.

[0028] The technical principle of the present invention:

[0029] To achieve comprehensive, sensitive, accurate and rapid in vitro detection, the present invention constructs a tsRNA detection method based on the combination of nuclease P1 and CRISPR / Cas13a - Cas14a dual - system. First, design specific DNA probes (modified with Cy5 and BHQ2 at both ends) according to the tsRNA sequence. tsRNAs with different lengths and the parental tRNA can form double - strand complexes with it. As Figure 1 (A), use nuclease P1 that only digests single - strand nucleic acids to digest other nucleic acids and the remaining single - strand DNA probes in total RNA, realizing tsRNA enrichment and the first signal supply. Then, we ingeniously design the crRNA targeting position in the middle of tRNA, as Figure 1 (B), which can comprehensively retain all tsRNAs with different lengths and can distinguish them from the parental tRNA, realizing comprehensive and accurate detection of tsRNA. We organically combine the two systems to construct a CRISPR / Cas13a - Cas14a linkage dual - system: The gRNA in the Cas14a system serves as the trans - cleavage substrate of the Cas13a system, as Figure 1(C), The tRNA activates the Cas13a system, which trans-cleaves the gRNA, resulting in the inoperability of the Cas14a system and no signal generation; while the tsRNA cannot activate Cas13a, and the remaining gRNA recognizes the DNA target with the Cas14a protein and trans-cleaves the DNA probe (modified with FAM and BHQ1 at both ends), outputting a significant fluorescence signal. Based on the exponential trans-cleavage ability of the two systems, signal amplification is achieved twice, effectively improving the method sensitivity, and a non-amplified ultrasensitive tsRNA detection is successfully constructed. Combining the signals of the nuclease P1 system (P / control P 0 ) and the CRISPR / Cas dual-system signals (C / control C 0 ), the ratio can be used to judge the tsRNA abundance: P / P 0 <1 and C / C 0 >1 indicates tsRNA; P / P 0 <1 and C / C 0 <1 indicates tRNA; P / P0>1 indicates no tsRNA and tRNA.

[0030] The present invention has the following advantages: (1) High specificity, capable of accurately identifying tsRNAs with different lengths from various RNAs, achieving full coverage detection of tsRNAs, and effectively overcoming the problems of missed detection and false detection of existing methods; (2) Strong anti-interference ability, capable of accurately identifying low-abundance tsRNAs among a large number of maternal tRNAs; (3) Significantly improved sensitivity, with the nuclease P1, CRISPR / Cas13a, and Cas14a systems forming three signal amplifications, enabling non-amplified ultrasensitive detection; (4) Fast reaction, capable of outputting dual signals within 1.5 h, ensuring the accuracy of the method; (5) Simple operation, isothermal reaction, does not rely on large instruments, low cost, suitable for clinical environments; (6) Programmability: By changing the sequences of the crRNA and DNA probe, the method can be used for other tsRNA detections. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the detection of tsRNA by the nuclease P1 combined with the CRISPR / Cas13a-Cas14a dual system;

[0032] Figure 2 Constructing the nuclease P1 system; (A) Principle of the nuclease P1 system; (B) and (D) Exploring the target recognition ability of the nuclease P1 through fluorescence signals and PAGE electrophoresis; (C) Exploring the influence degree of the nuclease P1 system on the CRISPR / Cas13a system;

[0033] Figure 3Optimization results of CRISPR / Cas13a-Cas14a conditions; (A), (B), and (C) are the optimizations of Cas13a, crRNA, and gRNA concentrations respectively; (D), (E), and (F) are the optimizations of Cas14a reaction time, Cas14a concentration, and DNA reporter concentration respectively;

[0034] Figure 4 (A) Schematic diagram of the single Cas13a system based on crRNA-tsRNA and the method of nuclease P1 binding to the CRISPR / Cas13a-Cas14a system based on crRNA-tRNA; (B) and (C) Results of the single Cas13a system detecting different ratios of mixtures of tsRNA and tRNA and different concentrations of tsRNA; (D), (E), and (F) Exploration of the specificity, anti-interference ability, and sensitivity of the nuclease P1 binding CRISPR / Cas13a-Cas14a method;

[0035] Figure 5 Performance comparison of multiple methods; (A) Schematic diagram of the detection method of the single CRISPR / Cas13a system and exploration of its sensitivity; (B) Schematic diagram of the detection method of the CRISPR / Cas13a-Cas14a system and exploration of its sensitivity; (C) and (D) Schematic diagrams of the traditional detection methods of sequencing and Northern Blot and exploration of their sensitivity. Specific implementation mode

[0036] Example 1: The probe binds to nuclease P1 to achieve tsRNA enrichment, provides a new signal source, and is compatible with the CRISPR / Cas13a system without loss, providing a new guarantee for the whole detection.

[0037] Experiments were carried out according to the following reaction system. Nuclease P1 reaction system: 1 μL of 10× NEB buffer 1.1, 1 μL of 5 μM tsRNA-Ala-AGC-3end probe, 2 μL of ddH 2 O, 1 μL of 200 U nuclease P1, and 5 μL of the sample to be tested. After mixing, react at 37 °C for 7 min, and collect the fluorescence signal of Cy5. The samples to be tested include 100 nM tsRNA and tRNA.

[0038] To explore the influence of the nuclease P1 system on the CRISPR / Cas13a system, the CRISPR / Cas13a system used was: the reaction solution obtained from the nuclease P1 reaction system, 2 μL of 1 μM Cas13a, 2 μL of 1 μM crRNA, 1 μL of 10 μM RNAreporter, 2 μL of 10× Reaction Buffer, and 3 μL of ddH 2In the reaction system of O, mix well and incubate at 37 °C for 30 min.

[0039] Previous studies have found that the probe combined with nuclease P1 can enrich nucleic acids complementary to the probe. As Figure 2 (A), the probe binds to the complementary tsRNA and tRNA in total RNA, and nuclease P1 digests single-stranded nucleic acids including other RNAs in total RNA and the probe. If there is no tsRNA or tRNA in the RNA sample, all probes are digested, generating an obvious fluorescence signal; while if tsRNA and tRNA are lowly expressed, a relatively significant signal is generated, and when highly expressed, the fluorescence signal is significantly reduced. The nuclease P1 system provides a new signal source for the whole detection and an additional guarantee for the result determination of the whole method. The retained tsRNA and tRNA participate in the subsequent CRISPR / Cas13a-Cas14a system. First, explore the function of nuclease P1. As Figure 2 (B), when there is no target tsRNA, a significant signal appears in the nuclease P1 system, while when there is a target, the signal decreases, indicating that the target forms an RNA-DNA hybrid strand with the probe, promoting a decrease in the concentration of single-stranded probes in the system and a reduction in the substrate of nuclease P1, thus resulting in a signal decrease. Therefore, it shows that nuclease P1 is specific for the cleavage of single-stranded nucleic acids, and this property has been confirmed in the polyacrylamide gel electrophoresis results ( Figure 2 D). Next, we explored the influence of the nuclease P1 system on the CRISPR / Cas13a system. Figure 2 (C) shows that in the absence of the probe, nuclease P1 digests a large amount of tsRNA, resulting in a decrease in the signal of the Cas13a system; while when all components of the nuclease P1 system are present, the signal of the Cas13a system is basically the same as that of the tsRNA without nuclease P1 treatment, indicating that the nuclease P1 system is compatible with the Cas13a system and there is basically no loss of tsRNA, and even tsRNA can be enriched in total RNA.

[0040] Example 2: Optimize the CRISPR / Cas13a-Cas14a reaction conditions to obtain a low-cost and highly efficient detection method.

[0041] CRISPR / Cas13a system: 2 μL of 1 μM Cas13a, 2 μL of 1 μM crRNA, 1 μL of 10 μM gRNA, 2 μL of 10×Reaction Buffer, and 3 μL of ddH 2In the reaction system of O, mix well and incubate at 37 °C for 30 min; CRISPR / Cas14a system: In the above system, add 1 μL of 0.5 μM Cas14a, 1 μL of 1 μM DNA target, 2 μL of 10 μM DNA reporter, 2 μL of 10×Reaction Buffer and 4 μL of ddH 2 O, mix well and incubate at 37 °C for 1 h, and collect FAM fluorescence signals. Dilute Cas13a, crRNA, Cas14a, gRNA, and DNA reporter by a factor of 10, and optimize the reaction conditions using the method of controlling variables.

[0042] It was explored and found that when the concentrations of Cas13a and crRNA were 1.5 μM and 1 μM respectively, as Figure 3 shown, the efficiency of CRISPR / Cas13a reached the maximum; when the concentrations of gRNA, Cas14a, and DNA reporter in the Cas14a system were 20 μM, 0.5 μM, and 20 μM respectively, the highest signal could be obtained, and the CRISPR / Cas14a system had a significant signal at 30 min, and there was no trend of signal increase after 1.5 h. Therefore, the optimal reaction time was 1.5 h.

[0043] Example 3: Nuclease P1 combined with CRISPR / Cas13a-Cas14a has high sensitivity, strong specificity, and anti-interference ability.

[0044] Sensitivity experiment: Dilute tsRNA by a factor of 10, and use the previously constructed method to detect tsRNA at different concentrations to test the actual detection limit of the method.

[0045] Specificity experiment: Use the previously constructed method to detect tsRNA-Ala-15bp, tsRNA-Ala-33bp, tsRNA-Ala-5' end, tRNA-Ala, miRNA, and tsRNA-Leu with different lengths.

[0046] Anti-interference experiment: Mix 100 nM tsRNA and tRNA at 80%, 60%, 50%, 25%, 10%, 5%, and 1%, and use the previously constructed method to detect samples with different ratios and collect signals.

[0047] As Figure 4 (A), previously we constructed a single Cas13a system based on crRNA-tsRNA and a nuclease P1 combined with CRISPR / Cas13a-Cas14a system based on crRNA-tRNA, and used the two methods to detect tsRNA at different concentrations, Figure 4(C) shows that the lowest detectable concentration of single Cas13a for tsRNA is 5 nM; while the nuclease P1 combined with the CRISPR / Cas13a-Cas14a system can detect tsRNA as low as 10 fM, as shown in Figure 4 (F), with a 5×10 5 -fold increase in sensitivity and two signal outputs. In addition, the system can distinguish different types of RNA, as shown in Figure 4 (D), and the method can also fully cover tsRNAs of different lengths. In the detection of samples with different proportions of tsRNA and tRNA mixed, Figure 4 (B) shows that the single CRISPR / Cas13a system can detect tsRNA as low as 5%, while the nuclease P1 combined with the CRISPR / Cas13a-Cas14a system can detect tsRNA as low as 1%, as shown in Figure 4 (E), which is sufficient to show that the nuclease P1 combined with the CRISPR / Cas13a-Cas14a system has more practical application value.

[0048] Example 4: Comparing the nuclease P1 combined with CRISPR / Cas13a-Cas14a with the single CRISPR / Cas13a and traditional methods, it is found that it has practical application advantages in terms of time consumption, sensitivity, sample requirement, etc.

[0049] Single CRISPR / Cas13a system: In a reaction system of 2 μL of 1 μM Cas13a, 2 μL of 1 μM crRNA, 2 μL of 10 μM RNA reporter, 2 μL of 10× Reaction Buffer, 2 μL of the sample to be tested and 10 μL of ddH 2 O, mix well and incubate at 37 °C for 30 min.

[0050] Northern Blot and RT-PCR were used to detect tsRNAs at different concentrations according to traditional techniques, observe the actual detection limits of the two methods, and compare them with the methods constructed in the early stage.

[0051] As shown in Figure 5 (A), the single Cas13a system detects tsRNAs at different concentrations. As the concentration decreases, the fluorescence intensity continuously decreases, and a significant signal is emitted at 2 - 7 min. The lowest detectable concentration is 1 nM tsRNA; while Figure 5 (B) shows that the CRISPR / Cas13a-Cas14a linked dual system can detect tsRNA as low as 10 fM, and the reaction can be completed within 1 h. The fluorescence intensity decreases with the increase of concentration. Traditional detection methods such as sequencing take 30 days to obtain results and require more than 300 ng of RNA to carry out the reaction; as shown in Figure 5(C), The RT-PCR combined with agarose gel electrophoresis method takes 300 minutes to complete and requires at least 100 pM (1 pg) to obtain obvious results; Northern Blot is completed within 2 days. As Figure 5 (D), at least 10 nM (10 pg) of RNA is required to participate in the reaction. The traditional methods are time-consuming, cumbersome to operate and require a large sample volume; the CRISPR / Cas13a-Cas14a method constructed in this project has a sensitivity increase of 10 5 -10 7 times, the time is shortened to 1.5 h, and the sample demand is small, laying a foundation for intelligent non-invasive detection.

Claims

1. A novel tsRNA sequence combination for highly sensitive detection of CRISPR / Cas13a-Cas14a, characterized in that: The invention comprises three DNA sequences and two RNA sequences, wherein the three DNA sequences comprise: a tsRNA-Ala-AGC-3end probe, whose nucleotide sequence is shown in SEQ ID No.1; a DNA target, whose nucleotide sequence is shown in SEQ ID No.2; and a DNA reporter, whose nucleotide sequence is shown in SEQ ID No.3; and the three RNA sequences comprise: an RNA reporter, a crRNA and a gRNA, whose nucleotide sequences are shown in SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, respectively.

2. The sequence combination of the novel tsRNA highly sensitive detection of CRISPR / Cas13a-Cas14a according to claim 1, characterized in that: The crRNA targeting position is designed at the middle position of tRNA.

3. The sequence combination of the novel tsRNA highly sensitive detection for CRISPR / Cas13a-Cas14a according to claim 1 or 2, characterized in that: The composition is suitable for the CRISPR / Cas13a-Cas14a linkage dual system, and the gRNA in the Cas14a system serves as a trans-cleavage substrate for the Cas13a system.

4. A novel tsRNA high-sensitivity detection kit based on CRISPR / Cas13a-Cas14a, characterized in that: Comprising the sequence combination according to any one of claims 1 to 3.

5. According to claim 4, the novel tsRNA high-sensitivity detection kit based on CRISPR / Cas13a-Cas14a is characterized in that: It also includes nuclease P1, reagents for CRISPR / Cas13a detection system and reagents for CRISPR / Cas14a detection system.

6. The novel tsRNA highly sensitive detection kit based on CRISPR / Cas13a-Cas14a according to claim 4 or 5, characterized in that: Build three systems: (1) Nuclease P1 system: 1 μL 10×NEB buffer 1.1, 1 μL 5 μM tsRNA-Ala-AGC-3end probe, 2 μL ddH2O, 1 μL 200U nuclease P1 and 5 μL sample to be tested, mix well, react at 37°C for 7 min, and collect the fluorescence signal of Cy5; (2) CRISPR / Cas13a system: Add the above (1) system to a reaction system containing 2 μL 1-2.5 μM Cas13a, 2 μL 0.1-1.5 μM crRNA, 1 μL 10-30 μM gRNA, 2 μL 10× Reaction Buffer and 3 μL ddH2O, mix well and incubate at 37°C for 30 min; (3) CRISPR / Cas14a system: In the above (2) system, add 1 μL 0.5-1.5 μM Cas14a, 1 μL 1 μM DNA target, 2 μL 15-20 μM DNA reporter, 2 μL 10× Reaction Buffer and 4 μL ddH2O, mix well, incubate at 37°C for 1 h, and collect FAM fluorescence signal.

7. The novel tsRNA highly sensitive detection kit based on CRISPR / Cas13a-Cas14a according to claim 6, characterized in that: The results of the kit were determined as follows: the Cy5 signal of the nuclease P1 system and the FAM signal of the CRISPR / Cas13a-Cas14a system were collected, and the ratio of the signal of the nuclease P1 system (P / control P0) and the signal of the CRISPR / Cas dual system (C / control C0) was combined to determine the abundance of tsRNA: if P / P0<1 and C / C0>1, it is tsRNA; if P / P0<1 and C / C0<1, it is tRNA; if P / P0>1, there is no tsRNA and tRNA.

8. Use of the sequence combination according to any one of claims 1 to 3 in the preparation of tsRNA detection supplies based on nuclease P1 combined with CRISPR / Cas13a-Cas14a linkage dual system.

Images