Screening method and application of reference genes in fluorogenic quantitative PCR (Polymerase Chain Reaction) analysis of peach-necked longhorn beetles

Abstract

The invention provides a reference gene screening method for fluorogenic quantitative PCR (Polymerase Chain Reaction) analysis of peach-necked longhorn beetles and application of the reference gene screening method. The specific scheme is as follows: RPL13 and RPL10 are selected as reference gene combinations in different development stages, and alpha-tubulin and SOD are selected as reference gene combinations in different tissues. The nucleotide sequences are respectively ID 1, ID 2, ID 3 and ID 4. In addition, the invention also provides different primer sequences used when the stably expressed reference gene is used for qRT-PCR (quantitative reverse transcription-polymerase chain reaction) analysis. The method comprises the following steps: selecting 10 candidate genes, applying a qRT-PCR (quantitative reverse transcription-polymerase chain reaction) technology, combining GeNorm, BestKeeper, a delta Ct method, NormFinder and RefFinder software for analysis, and screening out a reference gene combination which is stably expressed under different experimental conditions. The screening system provides important technical support for the gene function research of the peach-necked longhorn beetles, and provides a scientific basis for the research of the peach-necked longhorn beetles by utilizing molecular biology.

Description

Technical Field

[0001] The present invention relates to the field of insect molecular biology, and particularly to a method for screening and application of reference genes in fluorescence quantitative PCR analysis of Aromia bungii Faldemann. Background Art

[0002] Aromia bungii Faldemann, commonly known as the iron cannon bug or the red-necked old cow, belongs to the genus Aromia of the Cerambycidae family in the Coleoptera order, and is a stem-boring pest with a wide range of feeding habits, widely distributed throughout China. This pest mainly damages economic tree species such as peach, apple, Chinese flowering crabapple, cherry, apricot, and mulberry, and also infests landscaping tree species such as willow, elm, and goldenrain tree. Its larvae bore into the phloem, xylem, and cambium of the tree trunk, causing the bark to wither and rot, and the trunk to become hollow, seriously affecting the growth of the tree, leading to weakened tree vigor, and even possibly causing the death of the tree, bringing huge economic losses to fruit farmers. Due to the hidden damage location of Aromia bungii Faldemann and the difficulty of control, the effect of traditional chemical control methods is limited, resulting in an increasing level of damage. In recent years, with the progress of science and technology, the combination of chemical ecology methods and molecular biology means for controlling Aromia bungii Faldemann has become a research hotspot.

[0003] In molecular biology research, quantitative real-time polymerase chain reaction (qRT-PCR) has become one of the most commonly used technical means due to its high sensitivity, strong specificity, good repeatability, accurate quantification, etc. qRT-PCR is widely used in fields such as gene expression analysis and transgenic detection. When measuring the relative expression level of genes, in order to eliminate the deviation between different samples (such as the influence of factors such as RNA extraction quality and reverse transcription efficiency), usually one or more stably expressed reference genes need to be introduced. An ideal reference gene should be stably expressed under different tissue types, growth stages, and stress conditions, so as to ensure the accurate measurement of the expression level of the target gene.

[0004] In insect research, commonly used reference genes include polyubiquitin enzyme gene (UBQ), glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), tubulin gene (tubulin), and β-actin gene (β-actin), etc. However, recent studies have shown that under different growth stages, tissue types, or experimental conditions, the expression of these housekeeping genes may fluctuate greatly, thus affecting the accuracy of experimental results. Especially under different stress conditions, not all reference genes can be stably expressed in different tissues. Therefore, it is crucial to select appropriate reference genes, which is the key to ensuring the reliability of qRT-PCR experimental results. Screening the most suitable reference genes for specific experimental materials and experimental conditions is an important prerequisite for improving the accuracy of gene expression analysis.

[0005] For the study of gene expression in Aromia bungii, the screening and validation of reference genes are fundamental tasks. By using methods such as GeNorm, BestKeeper, ΔCt method, and NormFinder to evaluate the stability of candidate genes, the most suitable reference genes can be screened out, providing a scientific basis for subsequent gene function research and the formulation of prevention and control strategies. Only by ensuring the stable expression of reference genes under different conditions can reliable guarantee be provided for the accurate analysis of the expression level of target genes, and thus data support be provided for the precise prevention and control of Aromia bungii. Therefore, the screening and validation of reference genes are not only the basis of molecular biology research on Aromia bungii but also the key steps in carrying out its gene expression analysis, revealing its biological characteristics, and formulating prevention and control strategies. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for screening reference genes in fluorescence quantitative PCR analysis of Aromia bungii, and the method for screening reference genes can obtain a combination of reference genes with stable expression and accurately correct the expression of target genes.

[0007] To achieve the above purpose, the present invention provides a method for screening reference genes in fluorescence quantitative PCR analysis of Aromia bungii. The specific experimental scheme is as follows:

[0008] 1. Screen 10 candidate reference genes with high and stable expression from transcriptome data, and design qRT-PCR primers for these genes (Table 1). After the design is completed, evaluate the performance of the primers through standard curve and melting curve analysis. Specifically, the primers selected are required to have an amplification efficiency between 90% and 110%, the correlation coefficient R 2 is greater than 0.99, and the melting curve shows a single amplification peak to ensure that the specificity and amplification efficiency of the primers meet the experimental requirements. After optimization and validation, 10 stable reference genes are finally screened out, and the primer sequences, amplified product lengths, amplification efficiencies, and correlation coefficients of each reference gene are recorded. Table 1 shows the primer sequences, product lengths, primer amplification efficiencies, and correlation coefficients.

[0009] Table 1

[0010]

[0011]

[0012] 2. Samples of Aromia bungii and its different tissues were collected, and total RNA was extracted in an RNase-free environment to ensure the integrity and quality of the RNA. Subsequently, the extracted RNA was converted into cDNA using a reverse transcription kit for subsequent experiments. The qRT-PCR technique was used to measure the expression levels of candidate reference genes in different samples. Based on the cycle threshold (Ct value) of each candidate reference gene in each treatment sample, methods such as GeNorm, BestKeeper, ΔCt method, and NormFinder were combined to evaluate the stability of the genes. Finally, a comprehensive analysis of all candidate reference genes was performed using the RefFinder online tool to obtain the stability ranking of each gene. To further optimize the data normalization process, the GeNorm software was used to perform a pairwise variability analysis of the candidate reference genes under different experimental conditions to determine the optimal number of reference genes for normalizing the qRT-PCR target gene data. This systematic screening and evaluation method provides reliable technical support for subsequent gene expression research.

[0013] According to the above steps, the optimal combination of reference genes stably expressed by Aromia bungii under different conditions is determined as follows: RPL13 and RPL10 are selected at different developmental stages, and α-tubulin and SOD are selected in different tissues.

[0014] Among them, the primer sequences of RPL13 are: forward: GCAACCACCTATCAGAACT, reverse: TTCAGCAGCATCCTTAATTC;

[0015] The primer sequences of RPL10 are: forward: AGACCAGCAAGATGTTACC, reverse: AGCGGACACTCATAATAGG;

[0016] The primer sequences of α-tubulin are: forward: AATCGGCTAATGGTCTACAG, reverse: ACCTCCAAGATGAACTCCT;

[0017] The primer sequences of SOD are: forward: CATAGCATCATCGGTCGTA, reverse: CAATAACTCCACAAGCCAAC.

[0018] The present invention has the following beneficial effects:

[0019] (1) The reference gene screening method provided by the present invention provides an effective selection reference for screening stably expressed reference genes of Aromia bungii at different developmental stages and in different tissues, and can significantly improve the accuracy and reliability of gene expression research.

[0020] (2) The present invention has screened and determined for the first time the most stable combination of reference genes in different developmental stages, different tissues of Aromia bungii, laying a solid foundation for the subsequent in-depth exploration of functional genes of Aromia bungii and promoting the development of its molecular biology research.

[0021] (3) The method for screening the combination of reference genes of the present invention provides a reference for the selection of reference genes of Aromia bungii under other conditions, and also provides a certain reference for the screening of reference genes of other insects; BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Expression levels of candidate reference genes in different developmental stages and different tissues of Aromia bungii.

[0023] Figure 2 Using ReFinder to evaluate the stability of candidate reference genes in different developmental stages and different tissues of Aromia bungii.

[0024] Figure 3 Optimal number of reference genes required for Aromia bungii under different conditions. DETAILED DESCRIPTION OF THE INVENTION

[0025] The following will describe in detail the specific embodiments of the present invention with reference to the accompanying drawings, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments.

[0026] Example 1 Screening of the most stable reference genes of Aromia bungii under different conditions

[0027] 1. Tissue collection: For qRT-PCR analysis of samples of different developmental stages and tissues of Aromia bungii, it is first necessary to collect samples of different developmental stages (eggs, larvae, pupae, adults) and different tissues (such as head, thorax, abdomen, legs, wings, antennae, etc.). During collection, ensure that at least 3-5 individuals are collected at each developmental stage, and use a precision scalpel to dissect the target tissue in an RNase-free environment, and immediately place the tissue sample in an RNA preservation solution for storage, and freeze it to -80 °C.

[0028] 2. RNA extraction and cDNA template preparation: Samples should be processed as early as possible to extract total RNA and avoid RNA degradation. Use an appropriate RNA extraction kit (TRIzol up, TransGen Biotech, Beijing) to extract RNA, and use methods such as NanoDrop to measure the concentration and purity of RNA to ensure that the RNA quality meets the requirements of subsequent reverse transcription and qPCR analysis. The extracted RNA is converted into cDNA using a reverse transcription kit (All-in-One First-Strand cDNA Synthesis SuperMix for qPCR, TransGen Biotech, Beijing). All operations are carried out in an RNase-free environment. After reverse transcription, the cDNA samples are stored at -20°C.

[0029] 3. According to the internal reference gene sequence information from the previous transcriptome sequencing data, 10 candidate internal reference genes were selected for the experiment. qRT-PCR primers for these 10 internal reference genes were designed using Primer Premier 6.0 software, and their sequences were submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The 9 selected candidate internal reference genes include 18S rRNA, RPL10, RPL13, Actin, SDHA, EF-1α, GAPDH, α-tubulin, SOD, and FTZ-F1 (Table 1). Information such as primer sequences, primer lengths, amplification efficiencies, and correlation coefficients is shown in Table 1. The performance of the primers was verified by qRT-PCR experiments. The results showed that the melting curves of all candidate internal reference genes were single peaks, indicating good primer specificity. Further tests showed that the amplification efficiencies of all primers were between 96% and 107%, and the correlation coefficient R 2 was greater than 0.99, indicating that these primers were reasonably designed and met the requirements of qRT-PCR analysis.

[0030] 4. qRT-PCR analysis: The qRT-PCR reaction system uses the TransStart Tip Green qPCR SuperMix (+Dye I / +Dye II) kit. The reaction system contains 1 μL of cDNA template, 0.5 μL of forward / reverse primers, 10 μL of 2× reaction mixture, and 8 μL of sterile water. The amplification program is: pre-denaturation at 94°C for 30 seconds, denaturation at 94°C for 5 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 10 seconds, for a total of 40 cycles. After amplification, melting curve analysis is performed to verify primer specificity. Software such as GeNorm, BestKeeper, ΔCt method, and NormFinder are used to evaluate the stability of internal reference genes, and the Ct values are exported.

[0031] 5. Stability analysis of candidate reference genes: In samples at different developmental stages, the results of the ΔCt method and NormFinder analysis showed that the expressions of α-tubulin, SOD, and RPL13 were relatively stable; the results of BestKeeper analysis showed that the expressions of FTZ-F1, RPL13, and α-tubulin were relatively stable; the results of GeNorm analysis showed that the expressions of RPL13, RPL10, and α-tubulin were relatively stable; RefFinder comprehensively compared all candidate reference genes and found the stability: RPL13 > RPL10 > GAPDH > α-tubulin > SOD > FTZ-F1 > SDHA > 18S > Actin > EF-1. The results are shown in Table 2, Figure 2 .

[0032] In samples from different tissues, the results of the ΔCt method analysis showed that the expressions of RPL13, GAPDH, and RPL10 were relatively stable; the results of BestKeeper analysis showed that the expressions of α-tubulin, SOD, and RPL13 were relatively stable; the results of NormFinder analysis showed that the expressions of GAPDH, RPL13, and RPL10 were relatively stable; the results of GeNorm analysis showed that the expressions of RPL13, RPL10, and SOD were relatively stable; RefFinder comprehensively compared all candidate reference genes and found the stability: α-tubulin > SOD > RPL13 > RPL10 > EF-1 > 18S > Actin > SDHA > FTZ-F1 > GAPDH. The results are shown in Table 2, Figure 2 .

[0033] Finally, the GeNorm software was used to perform a pairwise variability analysis of the candidate reference genes under each experimental condition. The results showed that the V2 / 3 values of all experimental treatment groups were lower than 0.15 (see Figure 3 ), which indicates that the optimal number of reference genes for normalizing qRT-PCR target gene data is 2 under different developmental stages and different tissues. Therefore, the optimal combination of reference genes stably expressed by Aromia bungii under different conditions was determined as follows: RPL13 and RPL10 were selected at different developmental stages, and α-tubulin and SOD were selected in different tissues.

[0034] Table 2

[0035]

Claims

1. An internal reference gene for fluorescent quantitative PCR analysis of pink-necked longhorn beetle, characterized in that it is selected at different developmental stages. RPL13 and RPL10 As a reference gene combination, select α-tubulin and SOD as an internal reference gene combination.

2. The internal reference gene for fluorescent quantitative PCR analysis of the red-necked longhorn beetle according to claim 1, wherein: Said RPL13 The primer sequences are: forward: GCAACCACCTATCAGAACT, reverse: TTCAGCAGCATCCTTAATTC, RPL10 The primer sequences are: forward: AGACCAGCAAGATGTTACC, reverse: AGCGGACACTCATAATAGG, α-tubulin The primer sequences are: forward: AATCGGCTAATGGTCTACAG, reverse: ACCTCCAAGATGAACTCCT, SOD The primer sequences are: forward: CATAGCATCATCGGTCGTA, reverse: CAATAACTCCACAAGCCAAC.

Images