SNP (Single Nucleotide Polymorphism) molecular marker related to pig semen quality trait gene KIF26B, primer pair and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig semen quality trait gene KIF26B, a primer pair and application of the SNP molecular marker and the primer pair, and relates to the technical field of pig molecular markers. The quality traits of the boar semen are semen volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm motility traits; the molecular marker is located on the upstream of a pig KIF26B gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and g.193Tgt exists at the 193bp position of the sequence; and C base mutation. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding pigs by using the molecular marker. The SNP molecular marker in the pig KIF26B gene is found to be related to the semen volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm activity characters of pigs for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pigs, early screening of the quality characters of the semen of the pigs is realized, and the screening method is simple and rapid.

Description

Technical Field

[0001] The present invention relates to the technical field of porcine molecular markers, and particularly relates to an SNP molecular marker, a primer pair and their applications related to the gene KIF26B for porcine semen quality traits. Background Art

[0002] China is the largest pig production and consumption country in the world and has become a major participant in the world pork market. The artificial insemination technology plays an important role in the development of modern pig farming industry and is an important technical means to improve the quality of pork products, promote breed improvement and large-scale pig breeding. The quality of boar semen directly affects the success rate of artificial insemination and the reproductive ability of boars, which is the key to the successful implementation of porcine artificial insemination and plays a crucial role in the pig farming industry, directly affecting the economic benefits of pig farms. Semen quality traits are medium to low heritability traits, and traditional breeding methods are difficult to effectively improve boar semen quality. Understanding the genetic structure and detecting candidate genes and molecular markers related to semen quality traits helps to improve genetic selection and accelerate the genetic progress. At present, there are still insufficient key genes that can be utilized and the mechanism of their influence on semen quality traits can be elucidated. Therefore, finding key molecular genetic markers that control porcine semen quality traits and using them in molecular marker-assisted breeding is of great significance for improving porcine semen quality traits and increasing economic benefits.

[0003] The protein encoded by kinesin family member 26B (KIF26B) is an intracellular motor protein that is thought to transport organelles along microtubules. This protein is essential for kidney development. It may play an important role in the tight adhesion between mesenchymal cells near the ureteric bud through interaction with the MYH10 gene. The relevant research results show that after KIF26B is knocked down in T24 cells, the proliferation, invasion and migration abilities of the cells can be reduced.

[0004] Research shows that Kif26b can cause interstitial fibrosis by mediating the migration and myofibroblast differentiation of Myh9 in a renal fibrosis model. There is also research showing that KIF26B can promote cell proliferation and migration through the FGF2 / ERK signaling pathway in breast cancer.

[0005] However, there has been no report on whether the KIF26B gene can improve the semen quality of boars and this molecular mechanism. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies in the above-mentioned prior art, and provides an SNP molecular marker, a primer pair and their applications related to the gene KIF26B for porcine semen quality traits. The present invention discovers an SNP upstream of the porcine KIF26B gene that is associated with porcine semen quality traits and can be used as a molecular marker for screening porcine semen quality traits and pig breeding.

[0007] In a first aspect, the present invention provides an SNP molecular marker related to the porcine semen quality trait gene KIF26B, where the semen quality trait is semen volume, sperm density, effective sperm density, forward motility, sperm malformation rate, and sperm motility trait; the molecular marker is located upstream of the porcine KIF26B gene, and its nucleotide sequence is as shown in SEQ ID NO.1 in the sequence listing. There is a G193-A193 base mutation at the 193bp position of this sequence.

[0008] Furthermore, the T or C base polymorphism site at the 193bp position in SEQ ID NO.1 shows three genotypes: TT, TC, or CC, where the C allele is the dominant allele.

[0009] In a second aspect, the present invention provides the application of the SNP molecular marker as described in the first aspect in the screening of porcine semen quality traits and / or pig breeding.

[0010] In a third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, where the primer pair includes: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3.

[0011] In a fourth aspect, the present invention provides the application of the primer pair as described in the third aspect in the screening of porcine semen quality traits and / or pig breeding.

[0012] In a fifth aspect, the present invention provides a kit for rapid pig breeding using the SNP molecular marker as described in the first aspect, which contains the primer pair as described in the third aspect.

[0013] In a sixth aspect, the present invention provides a method for screening porcine semen quality traits and / or pig breeding, including the following steps:

[0014] S1. Extract the genomic DNA of pigs;

[0015] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification with the primer pair as described in claim 4 to obtain the molecular marker as described in claim 1 and purify it;

[0016] S3. Perform sequencing analysis on the molecular marker purified in step S2, retain the individuals carrying the C allele at the 193bp position of this sequence, and eliminate the individuals carrying the T allele.

[0017] Furthermore, in step S1, extract the genomic DNA from the ear edge tissue of the pigs to be tested.

[0018] Further, in step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCRmix, 1 μL of each of the above upstream and downstream primers, and ddH2O is added to make up the total volume to 50 μL; the PCR running program is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; preservation at 4°C.

[0019] Compared with the prior art, the beneficial effects of the present invention include: the present invention first discovers that a SNP molecular marker in the porcine KIF26B gene is related to porcine semen quality traits, specifically semen volume, sperm density, effective sperm density, straight-line motility, sperm motility, malformation rate, and effective sperm number traits. Therefore, this molecular marker can be used for screening porcine semen quality traits and breeding, that is, it provides a new use of a SNP molecular marker in the porcine KIF26B gene for marker-assisted breeding of porcine semen quality traits, realizing early screening of porcine semen quality traits, and the screening method is simple and fast. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the agarose gel electrophoresis detection map of the PCR product in Example 1 of the present invention. Among them, lane M is DL1000Marker, and lanes 1-3 are the amplified fragments in pigs, and the fragment size is 193 bp;

[0021] Figure 2 It is the sequencing map of the g.193T>C locus in Example 1 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0022] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] Example 1 Obtaining of SNP Detection Fragment of Porcine KIF26B Gene and Establishment of Polymorphism Locus Detection Method

[0024] 1. Extraction of Porcine Genomic DNA

[0025] The experimental pig breed in this application is Large White pigs, and the samples are from Aonong Group. The extraction of porcine genomic DNA uses the animal tissue genomic DNA extraction kit (PureLink) produced by Invitrogen Corporation TMUsing the Pro 96 Genomic DNA Purification Kit (K182104A), extract the porcine genomic DNA according to the kit instructions. Detect the concentration and quality of the extracted DNA and store it at -20 °C for later use.

[0026] 2. Obtaining the SNP genetic marker detection fragment of the porcine KIF26B gene

[0027] (1) PCR amplification

[0028] Based on the SNP genetic marker detection sequence in the genomic sequence of the porcine KIF26B gene, design a pair of primers to amplify the fragment of the polymorphic site.

[0029] Among them, the nucleotide sequence of the SNP genetic marker detection sequence is:

[0030] TCCCCTTTCCTTGTGTTTCGTCCACCTTGTGTTGTATACCACATTCTCCTTCATCTGTGTTCTTACACTCCCTCCCTGTTTTGTTCTCCTTCTTGTTTTTCCCCGACCTCTTGATTTCTTACTCTTTCACCTCCGACACCCACCACTTCTGTTTACCATGTTTTTTCTTTACTGTTGCCACTTCTACCTTCCC, as shown in SEQ ID NO.1.

[0031] The designed primers are as follows:

[0032] Forward primer: 5'TCCCCTTTCCTTGTGTTTCGT 3', as shown in SEQ ID NO.2.

[0033] Reverse primer: 5'GCCTTCCTTCTTGTCCCTTCTC 3', as shown in SEQ ID NO.3.

[0034] Extract the genomic DNA from the ear edge tissue of the pigs to be tested as a template, and use the above-designed primers for PCR amplification. The PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL of each of the above upstream and downstream primers, and add ddH 2 O to make up the total volume to 50 μL.

[0035] The running program of PCR is: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 10 min; preservation at 4 °C. The PCR products are detected by 1.5% agarose gel electrophoresis, and the detection results are as attachedFigure 1 As shown, where lane M is DL1000 Marker, and lanes 1 - 3 are the amplified fragments in pigs, and the size of the amplified fragment is 193 bp.

[0036] (2) Purification of PCR products

[0037] The above PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. For the specific steps, please refer to the kit instruction manual.

[0038] 3. Detection of molecular markers using the direct sequencing method of PCR products

[0039] The above - obtained purified PCR products were directly sent to Beijing AuGCT Co., Ltd. for sequencing. According to the sequencing results, the genotypes of this locus in the test population were determined. Analysis was performed using DNA Star software, and the results are as shown in the appendix Figure 2 As shown, it was found that there was an allelic gene mutation of G193–A193 at the 193rd bp in the sequence shown in SEQ ID NO.1, that is, g.193T>C. The above mutation caused the polymorphism of the KIF26B gene.

[0040] Example 2 Detection of the polymorphism distribution of molecular markers in pigs

[0041] In this example, the polymorphism distribution pattern of the g.193T>C locus of the porcine KIF26B gene was detected in 195 pigs with the trait of the number of piglets born in the first parity. The detection results are shown in Table 1.

[0042] Table 1 Polymorphism distribution pattern of the g.193T>C locus of the KIF26B gene

[0043]

[0044] It can be seen from the results in Table 1 that at the g.193T>C locus of the KIF26B gene in pigs, there are three genotypes: TT, TC, and CC. Among them, there are more individuals with the TT genotype, and the frequency of the T allele is 72.8%.

[0045] Example 3 Association analysis between molecular markers and porcine semen quality traits

[0046] To determine whether the g.193T>C locus of the porcine KIF26B gene is associated with differences in porcine semen quality traits, polymorphism detection was performed using the method established in Example 1, and the correlation between different genotypes of this polymorphic locus and semen volume, sperm density, effective sperm density, forward motility, sperm malformation rate, and sperm motility traits was analyzed. The GLM procedure of SAS statistical software (SAS Institute Inc, Version 9.1) was used for variance analysis of different SNP genotype combinations and significant tests. The model used was:

[0047] Y ij = μ + G i + F j + e ijk ;

[0048] Y ij is the trait phenotypic value, μ is the mean value, G i is the genotype effect (including gene additive effect and dominant effect); F j is the comprehensive effect of the pig farm; e ijk is the residual effect.

[0049] Association analysis between different genotypes and semen quality traits was performed in pigs. The statistical analysis results are shown in Table 2:

[0050] Table 2 Association analysis of the g.193T>C locus of the KIF26B gene with porcine semen quality traits

[0051]

[0052]

[0053] Note: The trait mean composition in the table is mean ± standard deviation. Different A and B indicate significant differences (P<0.05), * indicates significant differences (P<0.05), and ** indicates extremely significant differences (P<0.01)

[0054] Regarding the relationship between semen quality traits, the GLM procedure of SAS software was used to perform association analysis on the detection population. The results are shown in Table 2. In this population, individuals with the CC genotype at the g.193T>C locus of the KIF26B gene had higher sperm density, effective sperm density, straight-line motility, motility, and lower semen volume and sperm malformation rate compared to individuals with the TC and TT genotypes. Moreover, the traits of effective sperm density, effective sperm number, sperm motility, and malformation rate were all significant (P<0.05); the additive effects of effective sperm density and sperm motility traits reached a significant level (P<0.05), and the additive effect of the sperm malformation rate trait was extremely significant (P<0.01). Individuals with the TT genotype had a higher semen volume than the other two genotypes, but it was not significant.

[0055] Application of SNP molecular marker of KIF26B gene in screening of porcine semen quality traits and / or porcine breeding

[0056] The SNP molecular marker g.193T>C locus on the intron of KIF26B gene is significantly correlated with porcine semen quality traits, and the traits of sperm density, effective sperm number, sperm motility and malformation rate are all significant (P<0.05); the additive effects of effective sperm density and sperm motility traits reach a significant level (P<0.05), and the additive effect of sperm malformation rate trait is extremely significant (P<0.01). Therefore, in the process of breeding pigs, CC-type or TC-type individuals with good semen quality performance can be assisted in selection through this SNP molecular marker. Individuals carrying this advantageous allele should be retained in breeding, and TT-type individuals should be eliminated, which is beneficial to improving the production performance of the population.

[0057] The specific embodiments of the present invention described above do not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and deformations made according to the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the pig semen quality trait gene KIF26B, characterized in that: The pig semen quality traits are semen volume, sperm density, effective sperm density, forward motility, sperm deformity rate and sperm motility; the molecular marker is located upstream of the pig KIF26B gene, and its nucleotide sequence is shown in the sequence table SEQ ID NO.

1. There is a T193-C193 base mutation at the 193bp of the sequence.

2. The SNP molecular marker associated with the pig semen quality trait gene KIF26B according to claim 1, characterized in that: The T or C base polymorphic site at the 193rd bp in the sequence SEQ ID NO.1 exhibits three genotypes: TT, TC or CC, among which the C allele is the dominant allele.

3. Use of the SNP molecular marker as described in any one of claims 1 or 2 in pig semen quality trait screening and / or pig breeding.

4. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pair includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. Use of the primer pair as claimed in claim 4 in screening of pig semen quality traits and / or pig breeding.

6. A kit for rapid breeding using the SNP molecular marker as claimed in claim 1, characterized in that: Comprising the primer pair as claimed in claim 4.

7. A method for screening pig semen quality traits and / or pig breeding, characterized in that: The following steps are involved: S1. Extract pig genomic DNA; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying it; S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the C allele at the 193 bp of the sequence, and eliminate the individuals carrying the T allele.

8. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

9. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL of each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; The PCR operation program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

Images