Up-regulation promoter responding to crotonaldehyde, engineering strain containing promoter and application of up-regulation promoter
By constructing a genetically engineered strain RARE(DE3)/pACYCDuet1-P3-vgfp in response to upregulated promoter P3 in crotonaldehyde, the problem of lack of fast, real-time and online detection of crotonaldehyde in the prior art is solved, and real-time detection and environmental monitoring of crotonaldehyde concentration are achieved.
Patent Information
- Application Number
- CN202311723852.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-17
AI Technical Summary
The prior art lacks methods for fast, real-time and online detection of crotonaldehyde, which limits the optimization and environmental monitoring of biosynthetic crotonaldehyde.
By obtaining the upregulated promoter P3 in response to crotonaldehyde, a genetically engineered strain RARE(DE3)/pACYCDuet1-P3-vgfp containing the promoter was constructed. This strain was used as a biosensor of crotonaldehyde to realize real-time detection of crotonaldehyde concentration.
This method can respond linearly to crotonaldehyde concentrations within the range of 0-1.5mM crotonaldehyde concentration, providing a fast, real-time, online detection scheme suitable for screening enzymes or strains that improve crotonaldehyde production and environmental monitoring.
Smart Images

Figure CN120158448A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of genetic engineering and fermentation engineering, and particularly relates to an up-regulated promoter responsive to crotonaldehyde, an engineered strain containing the promoter, and their applications. Background Art
[0002] Crotonaldehyde, also known as 2-butenal, has the chemical formula C4H6O. It is an unstable liquid with a pungent and irritating odor. Crotonaldehyde usually exists in two isomers, namely cis and trans isomers. The differences in their spatial configurations lead to some different chemical and physical properties. Generally, crotonaldehyde refers to the trans isomer, which is an important organic synthesis intermediate.
[0003] Crotonaldehyde is mainly used as an intermediate in chemical synthesis. It can be obtained by oxidizing acrolein or isobutyraldehyde. In organic synthesis, crotonaldehyde can be used to prepare various compounds, such as n-butanol, n-butanal, rubber vulcanization accelerators, alcohol denaturants, and leather softeners. It can also be used as a raw material for the synthesis of fragrances and dyes.
[0004] Crotonaldehyde can be biosynthesized through various pathways. The following are two common biosynthetic pathways: (1) Microbial fermentation: Some microorganisms have the ability to synthesize crotonaldehyde. For example, some bacteria and yeast genera can produce crotonaldehyde by metabolizing pyruvate. These microorganisms can generate crotonaldehyde by converting substrates under suitable fermentation conditions. (2) Plant enzyme-catalyzed reactions: In plants, some specific enzymes can catalyze the production of crotonaldehyde. For example, certain dehydrogenases in plants can catalyze the dehydrogenation reaction of pyruvate or other related metabolites to generate crotonaldehyde.
[0005] These biosynthetic pathways can be optimized and enhanced by means of genetic engineering and metabolic engineering. By selecting highly efficient microbial strains or regulating the expression levels of related enzymes in plants, the yield of crotonaldehyde can be increased. It should be noted that the research on the biosynthesis of crotonaldehyde is still in its infancy and further research and optimization are still needed. At the same time, safety and environmental impacts are also important factors to be considered when conducting biosynthetic research.
[0006] The detection of crotonaldehyde is crucial. There are several common methods for detecting and quantitatively measuring the concentration of crotonaldehyde, such as GC-MS and HPLC, but there is currently no method for rapid, real-time, and on-line detection of crotonaldehyde. Summary of the Invention
[0007] In order to construct a method for rapid, real-time, and on-line detection of crotonaldehyde, the present invention provides an up-regulated promoter responsive to crotonaldehyde, an engineered strain containing the promoter, and its application. By obtaining the up-regulated promoter responsive to crotonaldehyde, a genetically engineered strain containing the up-regulated promoter responsive to crotonaldehyde is constructed. The genetically engineered strain can be used as a biosensor for crotonaldehyde to screen for enzymes or strains that can improve the production of crotonaldehyde, or to detect crotonaldehyde in the environment.
[0008] To achieve the above technical effects, the present invention provides the following technical solutions:
[0009] The first object of the present invention is to provide an up-regulated promoter P3 responsive to crotonaldehyde. The up-regulated promoter P3 is the upstream 300 bp sequence of the gene corresponding to the formaldehyde-responsive transcriptional regulator frmR, and the sequence is as shown in SEQ ID NO.1.
[0010] Further defined, the accession No. of the transcriptional regulator frmR in NCBI is 944986.
[0011] The second object of the present invention is to provide a genetically engineered strain RARE(DE3) / pACYCDuet1-P3-vgfp containing the above up-regulated promoter P3.
[0012] The third object of the present invention is to provide a method for constructing the above genetically engineered strain. The construction method includes the following steps:
[0013] 1) Connect the green fluorescent protein gene vgfp to the pACYCDuet1 vector to obtain the recombinant plasmid pACYCDuet1-vgfp;
[0014] 2) Use the P3 sequence to replace the P T7 and LacO sequences of pACYCDuet1-vgfp to obtain the corresponding recombinant plasmid pACYCDuet1-P3-vgfp;
[0015] 3) Transform the recombinant plasmid into the E. coli RARE(DE3) competent cells to obtain the recombinant engineered strain RARE(DE3) / pACYCDuet1-P3-vgfp.
[0016] In an embodiment of the present invention, the nucleotide sequence of the green fluorescent protein gene vgfp in step 1) is as shown in SEQ ID NO.2.
[0017] In an embodiment of the present invention, in step 1), the green fluorescent protein gene vgfp is connected to the pACYCDuet1 vector through NcoI and BamHI.
[0018] In one embodiment of the present invention, in step 2), the enzymes used for replacing the P and LacO sequences of pACYCDuet1-vgfp with the P3 sequence are SmaI and NcoI. T7 The restriction enzyme sites selected for the P and LacO sequences are SmaI and NcoI.
[0019] In one embodiment of the present invention, in step 3), E. coli RARE(DE3) is Escherichia coli K-12 MG1655 in which the aldehyde-ketone reductase gene and alcohol dehydrogenase gene have been knocked out; the aldehyde-ketone reductase genes are the dkgB gene, yeaE gene, and dkgA gene; the alcohol dehydrogenase genes are the yqhD gene, yahK gene, and yjgB gene.
[0020] The fourth object of the present invention is to provide the use of the above-mentioned genetically engineered strain as a biosensor for crotonaldehyde.
[0021] In one embodiment of the present invention, the use is to screen for enzymes or strains that can improve the production of crotonaldehyde.
[0022] In one embodiment of the present invention, the use is to detect the content of crotonaldehyde in the environment.
[0023] Advantages of the present invention:
[0024] 1) The promoter P3 that responds to crotonaldehyde is obtained.
[0025] 2) When the crotonaldehyde concentration is 0 - 1.5 mM, the strength of the promoter P3 is proportional to the crotonaldehyde concentration, which indicates that the engineered strain RARE(DE3) / pACYCDuet1-P3-vgfp can be used as a biosensor for crotonaldehyde to screen for enzymes or strains that can improve the production of crotonaldehyde, and can also be used to detect crotonaldehyde in the environment. Description of the drawings
[0026] Figure 1 It is a growth curve of the strain E. coli RARE(DE3) under treatment with different concentrations of cinnamaldehyde;
[0027] Figure 2 It is the virulence regression equation of cinnamaldehyde on E. coli RARE(DE3);
[0028] Figure 3 It is the differential genes of E. coli RARE(DE3) treated / untreated with cinnamaldehyde analyzed by RNAseq;
[0029] Figure 4 It is a graph showing the change in fluorescence intensity of the promoter P3 under treatment with different concentrations of crotonaldehyde. Detailed implementation manners
[0030] In order to make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods, and the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels.
[0031] The E. coli RARE(DE3): MG1655(DE3)ΔdkgBΔyeaEΔ(yqhC-dkgA)ΔyahKΔyjgB used in the present invention was purchased from Addgene, USA. This strain is Escherichia coli K-12 MG1655 with the aldehyde-ketone reductase gene and alcohol dehydrogenase gene knocked out; the aldehyde-ketone reductase genes are the dkgB gene, yeaE gene and dkgA gene; the alcohol dehydrogenase genes are the yqhD gene, yahK gene and yjgB gene.
[0032] The plasmid extraction kit used in the present invention was purchased from OMEGA, USA, and the operation steps were carried out according to the product manual.
[0033] The PBS buffer used in the present invention was purchased from Nanjing Novoprotein Scientific Co., Ltd.
[0034] All the culture media in the present invention were prepared with deionized water unless otherwise specified.
[0035] LB medium formula: yeast powder 5 g / L, NaCl 10 g / L, peptone 10 g / L, and chloramphenicol 50 μg / mL was added during inoculation.
[0036] The definitions and abbreviations involved in the present invention are as follows:
[0037] Aromatic or heterocyclic primary amines: AHPAs;
[0038] Carboxylic acid reductase from Neurospora crassa: ncCAR;
[0039] Transaminase from Ochrobactrum anthropi: OATA;
[0040] Isopropyl β-D-thiogalactoside: IPTG;
[0041] Chloramphenicol: Cm;
[0042] Green fluorescent protein gene: vgfp;
[0043] Escherichia coli: E. coli.
[0044] "Overexpression" or "hyper-expression" means that after a specific gene in a cell is regulated by various signals, its expression level in an organism exceeds the original level, which can be achieved by enhancing endogenous expression or introducing exogenous genes.
[0045] Example 1: Screening for up-regulated promoters that may respond to crotonaldehyde
[0046] In previous studies of the present invention, up-regulated promoters that may respond to cinnamaldehyde were screened, and the specific method is as follows:
[0047] The strain E. coli RARE(DE3) was cultured in a shake flask using LB medium at 37°C and 200 rpm. When the OD of the bacterial solution 600nm reached 0.5 - 0.7, cinnamaldehyde with final concentrations of 0 mM, 0.5 mM, 1.0 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, and 4.5 mM were added for treatment respectively. The growth curves of the strain E. coli RARE(DE3) under different concentrations of cinnamaldehyde were detected (see Figure 1 ). According to the growth curves, a virulence regression equation (cinnamaldehyde concentration vs. OD 600nm ) was made (see Figure 2 ).
[0048] According to the virulence regression equation, the sublethal dose of cinnamaldehyde on E. coli RARE(DE3) was calculated (the sublethal dose is a range, generally LD 10 -LD 25 , LD 25 refers to the dosage of the drug when 25% of the individuals are killed).
[0049] Calculation of LD 25 : LD 25 : 4.09×(1 - 25%) = -0.9472x + 4.1284; LD 25 = x = 1 mM.
[0050] Therefore, the sublethal dose of cinnamaldehyde on E. coli RARE(DE3) is 1 mM.
[0051] The strain E. coli RARE(DE3) was cultured in a shake flask using LB medium at 37°C and 200 rpm. When the OD of the bacterial solution 600nm reached 0.5 - 0.7, the strain E. coli RARE(DE3) was treated with 0 mM cinnamaldehyde and 1 mM cinnamaldehyde respectively, and the bacterial cells were collected at 1 h and 2.5 h after treatment. Total RNA was extracted from the two groups of strains collected at 1 h and 2.5 h, and the RNA quality was detected. Differentially expressed genes of the two groups of strains at 1 h and 2.5 h were found through transcriptome analysis (see Figure 3)。The results of transcriptome analysis showed that after 1 h, there were 1,164 differentially expressed genes between cinnamaldehyde-treated and untreated samples, including 597 up-regulated genes and 567 down-regulated genes; after 2.5 h, there were 1,316 differentially expressed genes between cinnamaldehyde-treated and untreated samples, including 663 up-regulated genes and 653 down-regulated genes (Table 1).
[0052] Table 1 Differentially expressed genes between cinnamaldehyde-treated and untreated samples
[0053]
[0054] Subsequently, the up-regulated differentially expressed genes at 1 h and 2.5 h were intersected, and then the up-regulated promoters corresponding to the genes with Log2Fold Change > 5 (FoldChange represents the ratio of RNA expression levels between two samples (groups)) were selected (see Table 2). Among them, the nucleotide sequence of promoter P3 is shown in SEQ ID NO.1.
[0055] Table 2 Up-regulated promoters of genes with Log2Fold Change > 5
[0056]
[0057] SEQ ID NO.1:
[0058] TTCCTTCTGCCGCCCGCTATCCGGGGCGGCCTTCCCTGCCGATTAGCCCCCCCCCCTTTCCTCTTTGTTTTCCGACCACATTCACCGGATAAATTTTATTCTCCAGTGTTATATACTATAGGGGGGTATGCATTGACATATAGAATACCCCCCTATAGTATATTGCATGCAGATGATGAGGTGCGAA
[0059] To verify whether promoter P3 has a corresponding effect on crotonaldehyde, the present invention constructed a genetic engineering strain containing promoter P3. The construction method is shown in Example 2.
[0060] Example 2: Construction of a recombinant engineering strain containing the responsive promoter P3
[0061] The green fluorescent protein gene vgfp was synthesized by BGI, and its nucleotide sequence is shown in SEQ ID NO.2. The gene vgfp was ligated to the pACYCDuet1 vector through NcoI and BamHI to obtain the recombinant plasmid pACYCDuet1-vgfp; the P3 sequence was used to replace the P of pACYCDuet1-vgfp T7and the LacO sequence, with restriction enzyme sites SmaI and NcoI, to obtain the corresponding recombinant plasmid pACYCDuet1-P3-vgfp. The nucleotide sequence of this recombinant plasmid is shown in SEQ ID NO.3; the recombinant plasmid was transformed into RARE(DE3) competent cells to obtain the strain RARE(DE3) / pACYCDuet1-P3-vgfp.
[0062] SEQ ID NO.2:
[0063]
[0064] SEQ ID NO.3:
[0065]
[0066] TTATTGTAATGTTAATGTGGGTTTTGAATATTGGGGTCAGGGCACCCAGGTTACCGTT
[0067] AGTCATCATtaaGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGCG
[0068] GCCGCATAATGCTTAAGTCGAACAGAAAGTAATCGTATTGTACACGGCCGCATAATC
[0069] GAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCATCTTAG
[0070] TATATTAGTTAAGTATAAGAAGGAGATATACATATGGCAGATCTCAATTGGATATCGGC
[0071] CGGCCACGCGATCGCTGACGTCGGTACCCTCGAGTCTGGTAAAGAAACCGCTGCTG
[0072] CGAAATTTGAACGCCAGCACATGGACTCGTCTACTAGCGCAGCTTAATTAACCTAGG
[0073] CTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCT
[0074] TGAGGGGTTTTTTGCTGAAACCTCAGGCATTTGAGAAGCACACGGTCACACTGCTT
[0075] CCGGTAGTCAATAAACCGGTAAACCAGCAATAGACATAAGCGGCTATTTAACGACCC
[0076] TGCCCTGAACCGACGACCGGGTCGAATTTGCTTTCGAATTTCTGCCATTCATCCGCTT
[0077] ATTATCACTTATTCAGGCGTAGCACCAGGCGTTTAAGGGCACCAATAACTGCCTTAA
[0078] AAAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTC
[0079] TGCCGACATGGAAGCCATCACAGACGGCATGATGAACCTGAATCGCCAGCGGCATC
[0080] AGCACCTTGTCGCCTTGCGTATAATATTTGCCCATAGTGAAAACGGGGGCGAAGAAG
[0081] TTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCT
[0082] GAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCG
[0083] TAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATT
[0084] CACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGG
[0085] TGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAACTCCGGAT
[0086] GAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTAT
[0087] TTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGT
[0088] ACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATA
[0089] TCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAA
[0090] TCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTG
[0091] GAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTC
[0092] CCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACA
[0093] GGTATTTATTCGGCGCAAAGTGCGTCGGGTGATGCTGCCAACTTACTGATTTAGTGTA
[0094] TGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTT
[0095] CAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTAG
[0096] CGGAGTGTATACTGGCTTACTATGTTGGCACTGATGAGGGTGTCAGTGAAGTGCTTC
[0097] ATGTGGCAGGAGAAAAAAGGCTGCACCGGTGCGTCAGCAGAATATGTGATACAGGA
[0098] TATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGC
[0099] GGAAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTA
[0100] ACAGGGAAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTG
[0101] ACAAGCATCACGAAATCTGACGCTCAAATCAGTGGTGGCGAAACCCGACAGGACTA
[0102] TAAAGATACCAGGCGTTTCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCT
[0103] TTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGA
[0104] CACTCAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCC
[0105] GTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGAA
[0106] AGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGGAGTTAG
[0107] TCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGC
[0108] GCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAGTTGGTAGCTCAGAGAACCTTCGA
[0109] AAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGAC
[0110] CAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGT
[0111] GCAATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCCATACGATATAAGTTGTAA
[0112] TTCTCATGTTAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTC
[0113] TCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTG
[0114] CGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAAT
[0115] GAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTT
[0116] TCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAG
[0117] AGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTG
[0118] ATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTA
[0119] CCGAGATGTCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCC
[0120] AGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGC
[0121] ATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCT
[0122] ATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGC
[0123] GCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGC
[0124] GACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTT
[0125] GATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTG
[0126] Example 3: Verification of the response of the P3 promoter to crotonaldehyde
[0127] In this invention, vgfp was used as the reporter gene, and whether P3 responds to crotonaldehyde was detected by fluorescence intensity. The specific method is as follows:
[0128] (1) Activation: The genetically engineered strain RARE(DE3) / pACYCDuet1-P3-vgfp obtained in Example 2 was inoculated into LB medium (containing 34 μg / mL Cm), and activated overnight at 37°C with 220 rpm;
[0129] (2) Inoculation: 0.2 mL of the activated seed liquid was inoculated into 20 mL of LB medium (34 μg / mL Cm), and cultured in a shaking flask at 37°C with 220 rpm until the OD 600nm grew to 0.5 - 0.7;
[0130] (3) Induction: 0.2 mM, 0.5 mM, 0.75 mM, 1 mM, 1.5 mM, and 2 mM crotonaldehyde were added respectively for induction (experimental group), and crotonaldehyde was not added to the control group. The induction temperature was 37°C and the induction time was 2.5 h;
[0131] (4) Sampling: Samples were taken after induction, washed once with PBS, and diluted to OD 600nm to 1.
[0132] (5) Fluorescence detection:: The fluorescence intensity of the samples was detected using a microplate reader, and the excitation light / emission light = 480 / 525 nm.
[0133] The results showed that P3 responds to crotonaldehyde, the response range is 0 - 1.5 mM, the linear relationship is good and the detection limit is low.
[0134] In summary, P3 can respond to crotonaldehyde; when crotonaldehyde is between 0 - 1.5 mM, the intensity of P3 is proportional to the concentration of crotonaldehyde, indicating that P3 is suitable as a promoter for responding to crotonaldehyde, that is, the strain RARE(DE3) / pACYCDuet1-P3-vgfp is suitable as a biosensor for responding to crotonaldehyde.
[0135] All the data listed in this example are the average values of multiple repeated experiments.
[0136] Although the present invention has been disclosed above in its preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. An up-regulated promoter P3 responsive to crotonaldehyde, characterized in that The up-regulated promoter P3 is the upstream 300 bp sequence of the gene corresponding to the formaldehyde-responsive transcriptional regulator frmR, and the sequence is as shown in SEQ ID NO.
1.
2. A genetically engineered strain RARE(DE3) / pACYCDuet1-P3-vgfp containing the up-regulated promoter P3 described in claim 1.
3. A method for constructing the genetically engineered strain described in claim 2, characterized in that The construction method includes the following steps: 1) Connect the green fluorescent protein gene vgfp to the pACYCDuet1 vector to obtain the recombinant plasmid pACYCDuet1-vgfp; 2) Replace the P and LacO sequences of pACYCDuet1-vgfp with the P3 sequence to obtain the corresponding recombinant plasmid pACYCDuet1-P3-vgfp; T7 3) Transform the recombinant plasmid into the E. coli RARE(DE3) competent cells to obtain the recombinant engineering strain RARE(DE3) / pACYCDuet1-P3-vgfp.
4. According to the construction method described in claim 3, characterized in that The nucleotide sequence of the green fluorescent protein gene vgfp in step 1) is as shown in SEQ ID NO.
2.
5. According to the construction method described in claim 3, characterized in that Step 1) is to connect the green fluorescent protein gene vgfp to the pACYCDuet1 vector through NcoI and BamHI.
6. According to the construction method described in claim 3, characterized in that Step 2) The restriction enzyme sites selected for replacing the P of pACYCDuet1-vgfp with the P3 sequence T7 and the LacO sequence are SmaI and NcoI.
7. According to the construction method described in claim 3, characterized in that The E. coli RARE(DE3) in step 3) is Escherichia coli K-12 MG1655 with the aldehyde-ketone reductase gene and alcohol dehydrogenase gene knocked out; the aldehyde-ketone reductase genes are the dkgB gene, yeaE gene and dkgA gene; the alcohol dehydrogenase genes are the yqhD gene, yahK gene and yjgB gene.
8. Application of the genetically engineered strain described in claim 2 as a biosensor for crotonaldehyde.
9. According to the application described in claim 8, characterized in that The application is to screen for enzymes or strains that can improve the production of crotonaldehyde.
10. According to the application described in claim 8, characterized in that The application is to detect the crotonaldehyde content in the environment.