Metabolic engineering transformation method for high-yield coenzyme Q10 of rhodobacter sphaeroides

Abstract

The invention provides a metabolic engineering transformation method of high-yield coenzyme Q10 of rhodobacter sphaeroides and application of transformed engineering bacteria. The method comprises the following steps: knocking out geranyl and geranyl pyrophosphate synthase gene crtE participating in a carotenoid synthesis route; performing overexpression on a farnesyl pyrophosphate synthase gene ispA; a histidine kinase coding gene prrB is mutated, and the mutant is introduced. According to the invention, a combined regulation strategy suitable for targeted regulation is found, the metabolic flux synthesized by the coenzyme Q10 is accurately optimized, and the capability of producing the coenzyme Q10 by the rhodobacter sphaeroides is greatly improved.

Description

Technical Field

[0001] The present invention belongs to the field of metabolic engineering; more specifically, the present invention relates to a method for metabolic engineering transformation of Rhodobacter sphaeroides for high-yield production of coenzyme Q10, and the application of the engineered bacteria obtained by transformation. Background Art

[0002] Coenzyme Q10 (Ubiquinone-10) is a lipophilic quinone compound with important biological activities and is widely present in the inner mitochondrial membrane of eukaryotes. As a key component of the electron transport chain, it not only participates in the oxidative phosphorylation process in cellular energy metabolism but also has the antioxidant function of scavenging free radicals. It has a wide range of applications in the fields of medicine, functional foods, and cosmetics. With the rapid development of the health industry, the market demand for its industrial production continues to climb.

[0003] The existing production processes of coenzyme Q10 mainly include chemical synthesis method, biological extraction method, and microbial fermentation method.

[0004] The chemical synthesis method includes total synthesis method and semi-synthesis method. The semi-synthesis method, for example, includes: extracting natural solanesol from plants such as tobacco leaves and potato leaves, generating the isoprenoid side chain of coenzyme Q10 through chemical extension reaction, and then combining it with the benzoquinone ring. The total synthesis method completely synthesizes coenzyme Q10 through chemical reactions without the participation of natural raw materials. Its advantage is that large-scale production can be achieved quickly and the product purity is high; however, its limitations are also relatively obvious, including many by-products, difficult chiral separation, relatively high chemical residue risk, and low naturalness. In addition, industrially, the oxidized coenzyme Q10 is converted into the reduced form by controlling the potential to enhance the biological activity.

[0005] The biological extraction method includes direct extraction from animal and plant tissues. Common raw materials include pig heart, pig liver, soybean oil, palm oil, etc. The biological extraction method has the advantage of being natural and pollution-free and is suitable for the production of high-end products. However, it requires the use of natural raw materials, with high raw material costs and low extraction efficiency, making it difficult to meet large-scale demands.

[0006] Currently, the microbial fermentation method is also used in this field, relying on microbial culture technology. Natural or genetically engineered microorganisms (Schizosaccharomyces pombe, Agrobacterium tumefaciens, Escherichia coli, etc.) are used for fermentation, and coenzyme Q10 is directly synthesized by optimizing the metabolic pathway of the strain. The microbial fermentation medium generally uses glucose, corn starch, molasses, soybean meal, cottonseed meal, etc. as raw materials, and coenzyme Q10 is extracted from the fermentation broth after microbial metabolism. Theoretically, the microbial fermentation method is environmentally friendly and has high yields, suitable for large-scale industrial production; the product has strong naturalness and is easily absorbed by the human body. However, it is necessary to strictly control the fermentation conditions (such as dissolved oxygen concentration, pH value) and optimize the microbial production pathway, which is a bottleneck in this field.

[0007] Due to the advantages of comprehensive cost, environmental friendliness, and product naturalness, microbial fermentation is pursued in industrial production. Therefore, there is an urgent need to develop and optimize the microbial production process of coenzyme Q10 in this field.

[0008] Rhodobacter sphaeroides has the ability to synthesize endogenous coenzyme Q10, which is higher than that of conventional microorganisms. However, the complex metabolic network regulation and branched pathways within it limit the further increase in production. Summary of the Invention

[0009] The purpose of the present invention is to provide a method for metabolic engineering transformation of Rhodobacter sphaeroides with high-yield coenzyme Q10, as well as the application of the transformed engineered bacteria.

[0010] In the first aspect of the present invention, a method for transforming Rhodobacter sphaeroides to improve its coenzyme Q10 production is provided, including: (a) introducing the exogenous farnesyl pyrophosphate synthase gene ispA; (b) downregulating the endogenous geranylgeranyl pyrophosphate synthase gene crtE.

[0011] In one or more embodiments, the method further includes: (c) introducing a mutant of the exogenous histidine kinase-encoding gene prrB; wherein, corresponding to the wild-type sequence of the histidine kinase-encoding gene prrB, the mutant contains the nucleic acid fragment GCGGCGGCAGCCGCG (SEQ ID NO: 14); preferably, this nucleic acid fragment is inserted between the 222nd and 223rd bases of the nucleotide sequence of prrB.

[0012] In another aspect of the present invention, an engineered Rhodobacter sphaeroides bacterium is provided, which is transformed from Rhodobacter sphaeroides, and this engineered bacterium has the following characteristics: (a) containing the exogenous farnesyl pyrophosphate synthase gene ispA; (b) its endogenous geranylgeranyl pyrophosphate synthase gene crtE is downregulated.

[0013] In one or more embodiments, the engineered Rhodobacter sphaeroides bacterium further has the following characteristics: (c) containing a mutant of the exogenous histidine kinase-encoding gene prrB; wherein, corresponding to the wild-type sequence of the histidine kinase-encoding gene prrB, the mutant contains the nucleic acid fragment GCGGCGGCAGCCGCG; preferably, this nucleic acid fragment is inserted between the 222nd and 223rd bases of the nucleotide sequence of the histidine kinase-encoding gene prrB.

[0014] In one or more embodiments, in (a), the expression cassette of the farnesyl pyrophosphate synthase gene ispA includes (5'-3') operably linked: an expression driving element, and the farnesyl pyrophosphate synthase gene ispA.

[0015] In one or more embodiments, in the expression cassette of the farnesyl pyrophosphate synthase gene ispA, the expression driving element includes (but is not limited to): P rsp_7571 , P rsp_6124 , tac, and lac promoters.

[0016] In one or more embodiments, in the expression cassette of the farnesyl pyrophosphate synthase gene ispA, a terminator is further included downstream of ispA.

[0017] In one or more embodiments, the farnesyl pyrophosphate synthase gene ispA has the nucleotide sequence shown in GenBank: ABA80319.1 or its degenerate sequence, and also includes a gene having a nucleotide sequence encoding an ispA homologous protein (such as a protein having a sequence identity of more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% with the amino acid sequence of ispA) or its degenerate sequence.

[0018] In one or more embodiments, in (b), the down-regulation is carried out by a method including (but not limited to) gene knockout / silencing or gene interference.

[0019] In one or more embodiments, gene knockout / silencing is carried out by homologous recombination or gene editing (such as CRISPR / Cas) to perform the down-regulation or down-regulation.

[0020] In one or more embodiments, a homologous arm sequence for knocking out the geranylgeranyl pyrophosphate synthase gene crtE is prepared. The homologous arm includes a left homologous arm and a right homologous arm. The farnesyl pyrophosphate synthase gene ispA is introduced between the left and right homologous arms. The strain is transformed, and a recombinant strain is screened and obtained, thereby introducing an exogenous farnesyl pyrophosphate synthase gene ispA while down-regulating the endogenous geranylgeranyl pyrophosphate synthase gene crtE.

[0021] In one or more embodiments, in (c), the expression cassette of the histidine kinase-encoding gene prrB mutant includes an operably linked (5'-3'): expression driving element and the histidine kinase-encoding gene prrB mutant.

[0022] In one or more embodiments, in the expression cassette of the histidine kinase-encoding gene prrB mutant, the expression driving element includes (but is not limited to): P rsp_7571 , P rsp_6124 , tac, and lac promoters.

[0023] In one or more embodiments, in the expression cassette of the histidine kinase-encoding gene prrB variant, a terminator is further included downstream of the prrB gene mutant.

[0024] In one or more embodiments, the histidine kinase encoding gene prrB has the nucleotide sequence shown in GenBank: ABA77663.1 or its degenerate sequence, and also includes a gene having a nucleotide sequence encoding a PrrB homolog (such as a protein having a sequence identity of more than 80%, more than 85%, more than 90%, more than 95%, more than 98% or more than 99% with the amino acid sequence of PrrB) or its degenerate sequence.

[0025] In another aspect of the present invention, there is provided the use of the engineered Rhodobacter sphaeroides bacteria described in any one of the foregoing for the production of coenzyme Q10.

[0026] In another aspect of the present invention, there is provided a method for the production of coenzyme Q10 by bioconversion using the engineered Rhodobacter sphaeroides bacteria, the method comprising: (a) providing the engineered Rhodobacter sphaeroides bacteria described in any one of the foregoing; (b) fermenting and culturing the Rhodobacter sphaeroides bacteria of (a) to produce coenzyme Q10.

[0027] Other aspects of the present invention will be apparent to those skilled in the art from the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Plasmid map: pK18ΔcrtE::ispA.

[0029] Figure 2 Plasmid map: pIND4-prrBM.

[0030] Figure 3 Coenzyme Q10 production of Rhodobacter sphaeroides 2.4.1 and the corresponding engineered strains 2.4.1ΔcrtE::ispA, 2.4.1ΔcrtE::ispA::prrB, 2.4.1ΔcrtE::ispA::prrBM.

[0031] Figure 4 Coenzyme Q10 production of Rhodobacter sphaeroides ZX-5 and the corresponding engineered strains ZX-5ΔcrtE::ispA, ZX-5ΔcrtE::ispA::prrB, ZX-5ΔcrtE::ispA::prrBM. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0032] Through in-depth research, the present invention provides a method for metabolic engineering transformation of Rhodobacter sphaeroides with high CoQ10 production. The technical solution includes: knocking out the geranylgeranyl pyrophosphate synthase gene crtE involved in the carotenoid synthesis pathway; overexpressing the farnesyl pyrophosphate synthase gene ispA; mutating the histidine kinase encoding gene prrB and introducing the mutant. One of the main cores of the present invention is to greatly improve the ability of Rhodobacter sphaeroides to produce CoQ10 by targeting the regulation of the expression of specific target genes and performing gene transformation.

[0033] Term

[0034] As used herein, an “(engineered) bacterium” refers to a strain that has been genetically modified by genetic engineering methods to have capabilities and characteristics not possessed by the original strain, thereby having a certain functional use. The present invention constructs an engineered Rhodobacter sphaeroides bacterium, which is genetically modified by genetic engineering methods to enable it to efficiently produce the target product, and the target product in the present invention is CoQ10.

[0035] As used herein, the terms “introduce” or “transform” refer to the transfer of an exogenous polynucleotide into a host cell (Rhodobacter sphaeroides in the present invention). Optionally, the exogenous polynucleotide can be integrated into the host genome.

[0036] As used herein, “exogenous” refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein / gene and a host cell. For example, although the host cell itself may also contain the corresponding gene or produce the corresponding protein, when the synthetic / recombinant established gene / protein is introduced into the host cell by genetic engineering methods, it is “exogenous” with respect to the host cell. The “exogenous” includes “heterologous”. A “heterologous” nucleic acid or protein is usually not present in the host cell itself.

[0037] As used in the present invention, unless otherwise specified, “prrB mutant” and “mutant prrB” can be used interchangeably, and refer to the gene obtained by modifying at the site determined by the present inventors corresponding to prrB before mutation. Preferably, corresponding to prrB before mutation, a nucleic acid fragment GCGGCGGCAGCCGCG is inserted between the 222nd and 223rd bases.

[0038] Transformation of the engineered bacterium

[0039] In the present invention, Rhodobacter sphaeroides is used as the starting strain for the transformation of the engineered bacterium.

[0040] Using Rhodobacter sphaeroides as the starting strain, the genetic modification described in the present invention includes: (a) introducing the exogenous farnesyl pyrophosphate synthase gene ispA; (b) downregulating the endogenous crtE gene. In a more preferred manner, it further includes: (c) introducing an exogenous prrB gene mutant; wherein, corresponding to the wild-type sequence of the prrB gene, the prrB gene mutant contains the nucleic acid fragment GCGGCGGCAGCCGCG; preferably, this nucleic acid fragment is inserted between the 222nd and 223rd bases of the nucleotide sequence of the prrB gene.

[0041] The biosynthetic pathway of coenzyme Q10 can be divided into three core modules: 1) the synthesis of the aromatic ring precursor p-hydroxybenzoic acid, which is completed by the shikimate pathway; 2) the generation of the polyisoprene side chain, which is completed by the methylerythritol phosphate pathway; 3) the coupling of the aromatic ring and the side chain and methylation modification, which is completed by the ubiquinone pathway.

[0042] crtE is a gene in the carotenoid synthesis pathway and is not a member of the biosynthetic pathway of coenzyme Q10. The synthesis pathways of carotenoids and coenzyme Q10 are also different. However, the inventors of the present invention unexpectedly found that targeting the downregulation of the carotenoid synthesis pathway gene crtE and recombinant expression of ispA contribute to increasing the yield of coenzyme Q10 in Rhodobacter sphaeroides.

[0043] The inventors of the present invention found that the single knockout of the crtE gene does not affect the yield of coenzyme Q10, and the single enhancement of the ispA gene does not affect the yield of coenzyme Q10. Only the combination of the two can achieve a substantial increase in yield, which is a unique combination regulation strategy different from the conventional one.

[0044] The downregulation of a gene includes "deletion / loss" or "inactivation" or "inhibition", meaning that the enzyme or protein encoded by the gene or coding region is not produced, or is produced in an inactive form in the host cell, or is produced in the host cell at a content lower than that found in the wild-type form of the host cell under the same or similar growth conditions. This can be achieved by one or more of the following methods, including homologous recombination, RNA interference-based techniques, ZFNs and TALENs, the CRISPR / Cas system, etc.

[0045] In the present invention, various methods can be used to downregulate the crtE.

[0046] As a preferred embodiment of the present invention, a homologous recombination method can be used to specifically target the crtE gene to cause defective expression or lack of expression. The Cre and loxp methods can also be applied to selectively knock out related genes in the cell genome, reduce expression or inactivate them. More preferably, a homologous arm sequence for knocking out crtE is prepared. The homologous arm includes a left homologous arm and a right homologous arm. The farnesyl pyrophosphate synthase gene ispA is introduced between the left and right homologous arms, and the transformed strain is screened and the recombinant strain is obtained, so as to introduce the exogenous farnesyl pyrophosphate synthase gene ispA while down-regulating the endogenous crtE.

[0047] As an alternative embodiment of the present invention, the CRISPR / Cas (such as Cas9) system can be used for targeted gene editing to knock out the crtE gene in the targeted region. Common knockout methods include: co-transfecting the sgRNA or nucleic acid capable of forming the sgRNA, Cas mRNA or nucleic acid capable of forming the Cas mRNA into the targeted region or targeted cells. After determining the target site, known methods can be used to introduce the sgRNA and Cas into the cell.

[0048] As an alternative, RNAi can be applied to the down-regulation or removal (such as interfering RNA molecules such as siRNA, shRNA, miRNA, etc.). Those skilled in the art can understand that according to the information of the crtE gene provided in the present invention, such interfering RNA molecules can be prepared. The interfering RNA can be delivered into the cell by using an appropriate transfection reagent, or can also be delivered into the cell by using a variety of techniques known in the art.

[0049] For the Rhodobacter sphaeroides strain of the present invention, the exogenous farnesyl pyrophosphate synthase gene ispA is introduced. "Increase", "introduce" or "knock-in" of a gene or coding region means producing the enzyme or protein encoded by the gene or coding region in the host cell, or producing it in the host cell at a content higher than that found in the wild-type form of the host cell under the same or similar growth conditions. When it needs to be introduced into the genome, it can be achieved by one or more of the following methods, for example: recombinant expression using an expression vector, CRISPR / Cas (such as Cas9) gene editing technology.

[0050] In a preferred embodiment, through optimized design, an ispA expression cassette is introduced into Rhodobacter sphaeroides, strengthening the expression of ispA. The expression cassette includes (5'-3') operably linked: an expression driving element (promoter), and ispA.

[0051] In a preferred embodiment, P is inserted into the Rhodobacter sphaeroides genome rsp_7571The ispA gene driven by a promoter. It should be understood that other promoters with driving functions in this scenario are also applicable.

[0052] PrrB, as the histidine kinase sensing element of the PrrAB two-component regulatory system, plays a role in the oxygen sensing and metabolic regulation of Rhodobacter sphaeroides. The PrrAB system dynamically regulates the expression of genes related to photosynthesis, pigment synthesis, and the electron transport chain by sensing changes in the environmental oxygen concentration. Among them, PrrB transmits the signal to the response regulator PrrA through autophosphorylation, thereby activating or inhibiting downstream target genes.

[0053] However, in the application scenario of the present invention, recombinant expression of PrrB to increase the production of coenzyme Q10 is unachievable and has a negative effect. In view of this, the inventors' specific modification of PrrB has changed the situation where PrrB is not helpful for increasing the production of coenzyme Q10 and affects its production to a certain extent. The modified prrBM inserted with a specific fragment shows an unexpectedly increased production effect, and this modification has great application value for increasing the production of coenzyme Q10.

[0054] In a preferred manner, through optimized design, an exogenous prrB gene mutant is introduced into Rhodobacter sphaeroides. The expression cassette includes an operably linked (5'-3'): expression driving element (promoter), and the prrB gene mutant.

[0055] The prrB gene mutant contains the nucleic acid fragment GCGGCGGCAGCCGCG; preferably, this nucleic acid fragment is inserted between the 222nd and 223rd bases of the nucleotide sequence of the prrB gene.

[0056] In a preferred manner, a plasmid expressing the prrB mutant gene driven by the lac promoter is introduced into Rhodobacter sphaeroides. It should be understood that other promoters with driving functions in this scenario are also applicable.

[0057] When it is necessary to introduce the ispA or prrB gene mutant into the Rhodobacter sphaeroides strain, a functional fragment or a homologous gene with retained function of the ispA or prrB gene mutant can also be applied in the present invention. As used in the present invention, the "fragment" refers to a gene fragment whose encoded protein basically retains the same biological function as the full-length protein. The "homologous gene with retained function" is, for example, a gene having a sequence identity of more than 80%, preferably more than 85%, more preferably more than 90%, further more preferably more than 95%, such as more than 98%, more than 99% with the wild-type gene, and the protein encoded by it retains the same biological activity as the full-length protein.

[0058] The present invention also relates to constructs (such as expression vectors) containing the polynucleotides of the present invention, and host cells genetically engineered with the constructs (such as expression vectors) of the present invention.

[0059] In the present invention, through in-depth research and experiments, target genes suitable for targeted regulation were found, and the metabolic flux of coenzyme Q10 synthesis was precisely optimized. The transformation of the present invention can ensure the stable supply of components related to the extension of the coenzyme Q10 side chain.

[0060] Currently, the metabolic engineering transformation of coenzyme Q10 mainly focuses on the overexpression of rate-limiting enzymes in the methylerythritol phosphate pathway. There is no report on synergistically increasing the biosynthesis of coenzyme Q10 by regulating genes involved in the carotenoid synthesis pathway and simultaneously strengthening the global regulatory network mediated by PrrB in Rhodobacter sphaeroides. The present invention realizes the redirection and strengthening of the metabolic flux by constructing a carotenoid synthesis-deficient strain and combining the functional transformation of PrrB.

[0061] The engineered Rhodobacter sphaeroides strain established in the present invention is a Gram-negative photoautotrophic bacterium with great industrial potential. Its unique facultative anaerobic metabolic mode enables it to efficiently utilize various carbon sources under both light and dark conditions. The genome of this strain is completely annotated, the genetic manipulation tools are mature, and it has high-density fermentation tolerance, making it an ideal production tool for coenzyme Q10.

[0062] The present invention can be better understood from the following examples. However, those skilled in the art should understand that the specific methods and results are only for detailed description of the present invention rather than limiting the present invention. For the experimental methods without specific conditions noted in the following examples, they are usually carried out under conventional conditions such as those described in "Molecular Cloning: A Laboratory Manual" edited by J. Sambrook et al., Science Press, or according to the conditions recommended by the manufacturer.

[0063] Example 1: Transformation using Rhodobacter sphaeroides 2.4.1 as the chassis

[0064] I. Construction of the recombinant strain for transformation

[0065] 1. Construction of the crtE knockout and ispA overexpression plasmids

[0066] Using the genome of Rhodobacter sphaeroides 2.4.1 (ATCC 17023) as a template, the upstream and downstream homologous arms of the crtE gene were amplified by PCR, and the P rsp_7571 promoter (an endogenous promoter of Rhodobacter sphaeroides, Synth Syst Biotechnol. 2021; 6(4): 335 - 342) and the ispA coding sequence (GenBank: ABA80319.1) were used. In sequence, the right homologous arm, P rsp_7571The promoter, ispA coding sequence, and left homologous arm were inserted into the suicide plasmid pK18mobsacB to construct the recombinant plasmid pK18ΔcrtE::ispA.

[0067] The PCR amplification primers (all primers used in the above construction) are shown in Table 1.

[0068] Table 1

[0069]

[0070] 2. Knockout of crtE and overexpression of ispA in Rhodobacter sphaeroides 2.4.1

[0071] The plasmid pK18ΔcrtE::ispA was transferred into Escherichia coli S17-1. Then, the plasmid was introduced into Rhodobacter sphaeroides 2.4.1 by conjugation. Single-exchange integrants were screened on plates containing 25 μg / mL kanamycin and 2.5 μg / mL nalidixic acid. Then, the single-exchange strains were inoculated on plates containing 10% sucrose, and double-exchange recombinants were screened by the negative selection pressure of the sacB gene.

[0072] According to the above, after identification, the strain 2.4.1ΔcrtE::ispA with crtE knockout and ispA overexpression in Rhodobacter sphaeroides 2.4.1 was obtained.

[0073] 3. Construction of a plasmid for overexpression of prrB mutant

[0074] Using the genome of Rhodobacter sphaeroides 2.4.1 as a template, the prrB coding sequence (GenBank: ABA77663.1) was amplified by PCR.

[0075] The PCR amplification primers (all primers used in the above construction) are shown in Table 2.

[0076] Table 2

[0077]

[0078] Moreover, by using the prrBM mutant sequence primers, the bases GCGGCGGCAGCCGCG were inserted at the 222-223rd bases by PCR. The mutated prrB gene (prrBM) was cloned downstream of the lac promoter of the expression vector pIND4 to construct the recombinant plasmid pIND4-prrBM.

[0079] prrB mutant sequence (SEQ ID NO:13):

[0080] atgatactcggtcccgacggcattctgaaccgtgacacccgcggcgactgggtgcgactgcgcaccctgatcctcct

[0081] gcgctggatggcggtggcggggcagctcgccgccatcgtcgtgaccgactggtatctgggggtccgcctgccgatg

[0082] gggctctgcttcatggccgtcggcgcctcggtcatcgcgaacgtgatcgcgaccttcgtcttcccgcag GCGGC

[0083] GGCAGCCGC gaaccgccgcctgaccgagttccaggcgctgatgatcctgctcttcgaccttacgcagctgtc

[0084] gttcctgctgttcctgaccggggggctcaccaacccgttcgcgctgctgatcctcgcgcccgtcaccatctcggcgct

[0085] cgcgctcgagctgcgcacgaccgtcattctcggggccatcgcgatcggtctgctgaccttcacggcctatttccacct

[0086] gccgctgatcctcgccgacgggtcgagcctgtccgtcccgcgcatgttcgaattcggcttctggctcgccatcgtcatc

[0087] ggcatcctgttcctcggcctctattcccggcgcgtcgccatcgagatccgttcgatgtcggatgcgcttctggccacgc

[0088] agatggcgctcgaccgcgagcagaagctgacggatctgggtggggtggtggccgcggccgcgcacgagctcggc

[0089] acgccgctggccacgatcaagctggtgagctcggagcttgccgaggagctttccgagcagcccgcgctgcgcgac

[0090] gatgcggagctgatccgcgagcaggccgaccgctgccgcgacatcctccgctcgatgggccgggccgggaagga

[0091] cgatcttcagatgcggcaggcgcccttgggcgaggtgctgcgcgaggccgccgagccccatgtcgggcgcggcaa

[0092] gcgggtcgagttcgacctctaccccagccgcggcggcgacgagcgccagccggtgatcctgcgccgtcccgaggt

[0093] gatccacgggctgcgcaacctcattcagaatgccgtcgatttcgcccgctccacggtctggatcgacggcgaatgga

[0094] cgggagaccggatcgcgatccggattgtggacgatggcgagggctatccgcccgcgatcatcggccgcatcggcg

[0095] atcccttcgtgcggcagcgccgcgccgaggaaagccagtcgcgccggccgggctatgagggcatgggcctcggg

[0096] ctcttcatcgccaagacgcttctggagcggtccggtgccgaactgagctttgccaatgccgccgatccgttcctgcgg

[0097] agccacgagcggcccgaacgctgcggcgccatcgtcgaggtgatctggccggtcgacaggctggtggtggtccgc

[0098] aacgcgcccttgggcgagaacgtcctgatccagacctga

[0099] 4. Overexpression of prrBM in Rhodobacter sphaeroides 2.4.1

[0100] The pIND4-prrBM plasmid was transferred into Escherichia coli S17-1. Then, the plasmid was introduced into Rhodobacter sphaeroides 2.4.1ΔcrtE::ispA established above through conjugation transfer.

[0101] According to the above, after identification, 2.4.1ΔcrtE::ispA::prrBM with overexpressed prrBM in Rhodobacter sphaeroides was obtained.

[0102] Example 2. Fermentation of the recombinant Rhodobacter sphaeroides modified in Example 1 and production of coenzyme Q10

[0103] The solid plate medium is shown in Table 3.

[0104] Table 3

[0105]

[0106] The seed medium is shown in Table 4.

[0107] Table 4

[0108]

[0109] The fermentation medium is shown in Table 5.

[0110] Table 5

[0111]

[0112] The Rhodobacter sphaeroides was subcultured on a solid plate. After 7 days of growth, single colonies were picked and transferred to the seed medium. After 24 hours of culture, the seed liquid was inoculated into the fermentation medium. For the strains that required induced expression, different concentrations (such as 0 mM, 0.1 mM, 0.5 mM, 1.0 mM) of IPTG were added for induction at the time of inoculation. Fermentation was ended after continuous culture for 48 hours.

[0113] The yield of the product was analyzed, and the results are shown in Table 6.

[0114] Table 6

[0115] Strain Coenzyme Q10 production Rhodobacter sphaeroides 2.4.1 41.7 mg / L 2.4.1ΔcrtE::ispA 71.5 mg / L 2.4.1ΔcrtE::ispA::prrB 62.2 mg / L 2.4.1ΔcrtE::ispA::prrBM 98.6 mg / L

[0116] The results showed ( Figure 3 ):

[0117] The yield of coenzyme Q10 of Rhodobacter sphaeroides 2.4.1 was 41.7 mg / L.

[0118] The yield of coenzyme Q10 of the recombinant Rhodobacter sphaeroides 2.4.1ΔcrtE::ispA was 71.5 mg / L.

[0119] The CoQ10 production of recombinant Rhodobacter sphaeroides 2.4.1 ΔcrtE::ispA::prrB (0 mM IPTG) was 62.2 mg / L. This result shows that the wild-type prrB cannot contribute to the production.

[0120] The CoQ10 production of recombinant Rhodobacter sphaeroides 2.4.1 ΔcrtE::ispA::prrBM (0 mM IPTG) was 98.6 mg / L. It can be seen that although the wild-type prrB cannot contribute to the production, the modified prrBM with a specific fragment inserted shows an unexpectedly increased production.

[0121] Therefore, compared with the starting strain Rhodobacter sphaeroides 2.4.1, the CoQ10 production of the finally modified recombinant strain was significantly increased by 136%.

[0122] Example 3. Modification using Rhodobacter sphaeroides ZX-5 as the chassis

[0123] 1. Rhodobacter sphaeroides ZX-5

[0124] Rhodobacter sphaeroides ZX-5 is a wild-type Rhodobacter sphaeroides isolated from wastewater (Int.J.HydrogenEnergy.2008;33(3):963-973)

[0125] 2. Preparation of ZX-5ΔcrtE::ispA

[0126] Refer to the steps 1 and 2 in Example 1, but replace the chassis bacterium, replace Rhodobacter sphaeroides 2.4.1 with Rhodobacter sphaeroides ZX-5, to obtain the strain ZX-5ΔcrtE::ispA with crtE knocked out and ispA overexpressed in Rhodobacter sphaeroides ZX-5.

[0127] 3. Preparation of ZX-5ΔcrtE::ispA::prrBM

[0128] Refer to the steps 3 and 4 in Example 1, but replace the chassis bacterium, replace Rhodobacter sphaeroides 2.4.1ΔcrtE::ispA with Rhodobacter sphaeroides ZX-5ΔcrtE::ispA, to obtain ZX-5ΔcrtE::ispA::prrBM with prrBM overexpressed in Rhodobacter sphaeroides.

[0129] Example 4. Fermentation of the recombinant Rhodobacter sphaeroides modified in Example 3 and production of CoQ10

[0130] For ZX-5 and ZX-5ΔcrtE::ispA::prrBM, fermentation was carried out according to the method in Example 2.

[0131] The results are shown in Table 7.

[0132] Table 7

[0133] Strain Coenzyme Q10 production ZX-5 55.7 mg / L ZX-5ΔcrtE::ispA 105.7 mg / L ZX-5ΔcrtE::ispA::prrB 82.7 mg / L ZX-5ΔcrtE::ispA::prrBM 162.3 mg / L

[0134] The results show that:

[0135] The CoQ10 production of Rhodobacter sphaeroides ZX-5 is: 55.7 mg / L.

[0136] The CoQ10 production of recombinant Rhodobacter sphaeroides ZX-5ΔcrtE::ispA is: 105.7 mg / L.

[0137] The CoQ10 production of recombinant Rhodobacter sphaeroides ZX-5ΔcrtE::ispA::prrB (0.1 mM IPTG) is: 82.7 mg / L. It shows that the wild-type prrB cannot contribute to the production but has a significant negative effect.

[0138] The CoQ10 production of recombinant Rhodobacter sphaeroides ZX-5ΔcrtE::ispA::prrBM (0.1 mM IPTG) is: 162.3 mg / L. This result also shows that the modified prrBM with a specific fragment inserted exhibits an unexpected production-enhancing effect.

[0139] Therefore, compared with the starting strain Rhodobacter sphaeroides ZX-5, the production of the finally modified recombinant strain is greatly increased by 191.4%

[0140] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims. At the same time, all the documents mentioned in the present invention are cited in this application as references, just as if each document is cited separately as a reference.

Claims

1. A method for modifying Rhodobacter sphaeroides to increase its coenzyme Q10 production, comprising: (a) introducing the exogenous farnesyl pyrophosphate synthase gene ispA; (b) Downregulation of the endogenous geranylgeranyl pyrophosphate synthase gene crtE.

2. The method according to claim 1, characterized in that Also includes: (c) introducing an exogenous mutant of the histidine kinase encoding gene prrB; wherein, corresponding to the wild-type sequence of the histidine kinase encoding gene prrB, the mutant comprises a nucleic acid fragment GCGGCGGCAGCCGCG; preferably, the nucleic acid fragment is inserted between bases 222-223 of the nucleotide sequence of prrB.

3. An engineered bacterium of Rhodobacter sphaeroides, which is transformed from Rhodobacter sphaeroides, and has the following characteristics: (a) it contains an exogenous farnesyl pyrophosphate synthase gene ispA; (b) its endogenous geranylgeranyl pyrophosphate synthase gene crtE is downregulated.

4. The Rhodobacter sphaeroides engineered bacterium according to claim 3, characterized in that: The engineered bacteria also has the following characteristics: (c) it contains an exogenous histidine kinase encoding gene prrB mutant; wherein, corresponding to the wild-type sequence of the histidine kinase encoding gene prrB, the mutant contains a nucleic acid fragment GCGGCGGCAGCCGCG; preferably, the nucleic acid fragment is inserted between the 222nd and 223rd bases of the nucleotide sequence of the histidine kinase encoding gene prrB.

5. The method according to claim 1 or 2 or the engineered bacterium of Rhodobacter sphaeroides according to claim 3 or 4, characterized in that: In (a), the expression cassette of the farnesyl pyrophosphate synthase gene ispA includes: an expression driver element and the farnesyl pyrophosphate synthase gene ispA which are operably linked.

6. The method according to claim 1 or 2 or the engineered bacterium of Rhodobacter sphaeroides according to claim 3 or 4, characterized in that: (b), the down-regulation is performed by methods including gene knockout / silencing, or gene interference; Preferably, said down-regulation or down-regulation is performed by gene knockout / silencing by homologous recombination or gene editing.

7. The method according to claim 1 or 2 or the engineered bacterium of Rhodobacter sphaeroides according to claim 3 or 4, characterized in that: A homologous arm sequence for knocking out the geranylgeranyl pyrophosphate synthase gene crtE is prepared, wherein the homologous arm includes a left homologous arm and a right homologous arm, and the farnesyl pyrophosphate synthase gene ispA is introduced between the left and right homologous arms. The strain is transformed, and the recombinant strain is screened and obtained, thereby introducing an exogenous farnesyl pyrophosphate synthase gene ispA while down-regulating the endogenous geranylgeranyl pyrophosphate synthase gene crtE.

8. The method according to claim 2 or the engineered bacterium of Rhodobacter sphaeroides according to claim 4, characterized in that: In (c), the expression cassette of the histidine kinase encoding gene prrB mutant includes: an expression driver element and the histidine kinase encoding gene prrB mutant operably linked.

9. Use of the engineered bacterium Rhodobacter sphaeroides according to any one of claims 3 to 8 for producing coenzyme Q10.

10. A method for producing coenzyme Q10 by biological fermentation using Rhodobacter sphaeroides engineered bacteria, characterized in that: The method comprises: (a) providing an engineered bacterium of Rhodobacter sphaeroides according to any one of claims 3 to 8; (b) The Rhodobacterium sphaeroides of (a) is fermented and cultured to produce coenzyme Q10.

Images