Specific LAMP primers for *Bark beetle* and their applications

Abstract

This invention relates to the field of molecular biology, and particularly to LAMP primers specific to *Bark beetle* and their applications. This invention designs LAMP detection primers using the mitochondrial COI gene as the target gene for LAMP detection in *Bark beetle*. These primers exhibit high specificity and detection efficiency. Based on this, this invention provides a LAMP detection method suitable for field conditions, which offers advantages such as ease of operation, high specificity, rapid response, simple detection equipment, and visualized detection results.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to LAMP primers specific to the bark beetle and their applications. Background Technology

[0002] Long-grown bark beetle ( Hylurgus ligniperda It belongs to the order Coleoptera, family Curculionidae, subfamily Scolytinae, tribe Tomicini, genus Tomictonia. Hylurgus Latreille, native to southern Europe and the Mediterranean coast, primarily infests the genus *Pinus* (*Pinus*). Pinus (spp.) This plant feeds on the phloem of trees and bores tunnels into the base of the trunk and roots. The forest bark beetle has a strong ability to spread naturally and can be dispersed along with timber transport.

[0003] Traditional morphological identification requires quarantine personnel to possess a certain level of professional knowledge and experience, and it is difficult to distinguish insect eggs and larvae solely based on morphological identification. Therefore, molecular identification methods developed based on genetic sequences can reliably identify different insect developmental stages and incomplete insect bodies.

[0004] Loop-mediated isothermal amplification (LAMP) utilizes four specific primers and a DNA polymerase with strand displacement activity (BstDNA polymerase) to rapidly amplify the target fragment in approximately one hour under isothermal conditions. By adding a pH indicator or fluorescent dye, such as phenol red, hydroxynaphthol blue (HNB), or calcein, to the reaction system, the color change of the reaction system allows for visual identification of whether the sample is the target insect. Therefore, LAMP reactions offer advantages such as sensitivity, speed, simple equipment requirements, and visualized results, making them suitable for rapid molecular identification of target insects under field conditions.

[0005] Currently, there is no existing technology for detecting bark beetles using the LAMP reaction. Summary of the Invention

[0006] To fill the gap in existing technologies, this invention designs four specific primers targeting the mitochondrial COI gene of *Bark Borer chinensis* to achieve rapid molecular identification of *Bark Borer chinensis* under field conditions using the LAMP reaction. Based on this, the following technical solution is proposed.

[0007] First, this invention provides LAMP primers specific to the bark beetle, the nucleotide sequences of which are shown in SEQ ID No. 1 to SEQ ID No. 4. Specifically:

[0008] F3:CTGGAATAAAATCTGATCGCCTTACTCTCT, as shown in SEQ ID NO.1;

[0009] B3:GTAGTCCAATAGTTATTATTGCATAGATTATTCCT, as shown in SEQ ID NO.2;

[0010] FIP:CGGTCTGTTAATAGTATAGTAATGGCTCCTGCCTCATGAGCAGTAAAAATTACTGCCATC, as shown in SEQ ID NO.3;

[0011] BIP: CAACCTTTTTTGACCCTGCAGGTGGTGACCAAAGAATCAAAATAAGTGT, as shown in SEQ ID NO.4.

[0012] In our initial experiments, we tried other primer sequences, but tests revealed that they failed to achieve the desired specificity, resulting in non-specific amplification. After extensive screening and validation, we finally found that the primer sequences described above had high specificity, high sensitivity, and high amplification efficiency.

[0013] Furthermore, this invention provides the application of the *Bartholin's bark beetle*-specific LAMP primers in the preparation of a kit.

[0014] Furthermore, the present invention provides a kit for detecting the bark beetle, which contains the bark beetle-specific LAMP primers described above.

[0015] Preferably, the kit further includes a fluorescent dye and / or an acid-base indicator.

[0016] Preferably, the kit comprises the following components: the *Bartholin's bark beetle*-specific LAMP primers, DNA template, WarmStart® LAMP 2X Master Mix, and water.

[0017] Furthermore, this invention provides the application of the aforementioned reagent kit in the visual detection of the bark beetle.

[0018] Furthermore, the present invention provides a method for detecting *Bark Borer*, comprising: using the DNA of the sample to be tested as a template, and amplifying it using *Bark Borer*-specific LAMP primers shown in SEQ ID No. 1 to SEQ ID No. 4.

[0019] Preferably, the amplification reaction conditions are amplification at 60℃~64℃ for more than 50 minutes.

[0020] Preferably, the amplification reaction conditions are amplification at 63℃~63.5℃ for more than 50 minutes.

[0021] Preferably, the amplification reaction is terminated at 81°C.

[0022] Preferably, the amplification results are interpreted using colorimetric methods or gel electrophoresis.

[0023] Preferably, the colorimetric method is as follows: if the system color is yellow, it is determined to be positive; if the system color is red, it is determined to be negative.

[0024] Preferably, the gel electrophoresis method is as follows: if there are specific ladder-like bands, it is judged as positive.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] This invention designs LAMP detection primers using the mitochondrial COI gene as the target gene for LAMP detection of *Bark Borer chinensis*. The LAMP primers exhibit high specificity and detection efficiency. Based on this, this invention provides a LAMP detection method suitable for field conditions, which offers advantages such as ease of operation, high specificity, rapid response, simple detection equipment, and visualized detection results. Attached Figure Description

[0027] Figure 1 The results are the LAMP reaction specificity detection results using the *Bartholin's thorn*-specific LAMP primers from Example 1; (A) is the colorimetric detection result, red indicates negative, yellow indicates positive; (B) is the electrophoresis result, with step-like bands indicating a positive result; Note: M: Marker; HL: *Bartholin's thorn*, Hylurgus ligniperda TP: *Microceras lanceolata*, Tomicus piniperda ;TM: *Microcera transverseis*, Tomicus minor TY: Yunnan tip beetle, Tomicus yunnanensis DV: Red Turpentine Beetle, Dendroctonus valence NTC: Blank control.

[0028] Figure 2 The results show the optimized reaction temperature of real-time fluorescence LAMP; (A) shows the real-time fluorescence amplification curves under different temperatures (60-64℃); (B) shows the melting curve.

[0029] Figure 3(A) is the result of LAMP reaction sensitivity detection; (B) is the result of colorimetric detection; (C) is the result of electrophoresis; Note: M: Marker; 1: 4 ng / μL; 2: 400 pg / μL; 3: 40 pg / μL; 4: 4 pg / μL; 5: 400 fg / μL; 6: 40 fg / μL; 7: 4 fg / μL; 8: 0.4 fg / μL; NTC: Blank control.

[0030] Figure 4 The results are LAMP detection results for different life stages of *Bark Beetle*; (A) is the colorimetric detection result; (B) is the electrophoresis result; Note: Adult: adult; Larva: larva; Pupa: pupa; Egg: egg; M: marker; NTC: blank control.

[0031] Figure 5 The results are the LAMP reaction specificity detection results using comparative LAMP primers specific to *Bark Borer*; (A) is the colorimetric detection result, red indicates negative, yellow indicates positive; (B) is the electrophoresis result, with step-like bands indicating a positive result; Note: M: Marker; HL: *Bark Borer*. Hylurgus ligniperda TP: *Microceras lanceolata*, Tomicus piniperda ;TM: *Microcera transverseis*, Tomicus minor TY: Yunnan tip beetle, Tomicus yunnanensis DV: Red Turpentine Beetle, Dendroctonus valence NTC: Blank control. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0033] Example 1

[0034] This embodiment provides LAMP primers specific to *Bark Borer chinensis*, the nucleotide sequences of which are shown in SEQ ID No. 1 to SEQ ID No. 4. These primers were designed based on the conserved gene sequences of *Bark Borer chinensis* in GenBank, using MEGA11 to select specific regions of the COI gene. Inner primers: FIP and BIP; outer primers: F3 and B3.

[0035] Based on the above primers, a further detection method for *Bark Borer chinensis* is provided, with the following steps:

[0036] 1. Genomic DNA Extraction from Samples. Genomic DNA was extracted from *Bark Borer chinensis* and its closely related species using an animal tissue DNA extraction kit (Beijing Jinsha Biotechnology Co., Ltd.). The procedure was performed according to the kit's instruction manual. All experimental samples were identified as species through morphological and molecular identification.

[0037] 2. LAMP Reaction System Setup. To minimize false positives in the LAMP reaction, this experiment used the mature, stable, and commercially available WarmStart® LAMP Kit (New England Biolabs). The kit contains fluorescent dyes or acid-base indicators, allowing for real-time fluorescence detection or endpoint visualization of the LAMP reaction. The kit is also compatible with various detection methods, including turbidity detection and gel electrophoresis. This example utilizes a combination of colorimetric and gel electrophoresis methods to interpret the amplification results. The LAMP reaction system in this experiment was set at 25 μL, specifically as follows: 12.5 μL of 2×WarmStart®LAMP 2X Master Mix, 4 μL each of inner primers (FIP and BIP), 0.5 μL each of outer primers (F3 and B3), 1 μL of DNA template, and 2.5 μL of ddH2O. The amplification program was 60℃ for 50 min, followed by inactivation at 85℃ for 5 min to terminate the reaction. Colorimetric methods involve visually observing the color change of the reaction system; a yellow color indicates a positive result, while a red color indicates a negative result. Gel electrophoresis is also used: a positive result is determined by observing specific step-like bands on a 1.2% agarose gel at 125V for 20 minutes and observing these bands on a gel imaging system.

[0038] 3. Primer specificity test. LAMP assays were performed using DNA from *Barkhorium longifolium*, *Barkhorium simonii*, *Barkhorium simonii*, *Barkhorium yunnanense*, and *Barkhorium rubrum* as templates. The experiment was repeated three times, with a blank control (NTC) in each group. ddH₂O was used as a template to eliminate false positives. The reaction results are shown below. Figure 1 As shown, only *Bark Borer* was amplified, indicating that the primers can specifically amplify *Bark Borer*, demonstrating good specificity.

[0039] 4. Optimize the reaction. Following step 2, add 0.5 μL of fluorescent dye (New England Biolabs) and adjust the ddH2O to 2.0 μL. Place the mixed system in a Bio-Rad CFX96 Real-Time PCR instrument, set the temperature range to 60–64 °C, with 8 temperature gradients, and amplify for 1 hour, collecting fluorescence signals every 1 minute. Then, increase the temperature from 65 °C to 95 °C at 0.5 °C / 10 s intervals to create a melting curve. (See figure for details.) Figure 2 As shown, 63.2℃ is the optimal reaction temperature, and the melting temperature is 81℃.

[0040] 5. LAMP Reaction Sensitivity Detection. The total DNA concentration of *Betula chinensis* was determined using a Nano Drop 8000 ultraviolet spectrophotometer. The DNA was serially diluted 10-fold with ddH2O. LAMP amplification was performed using the system described in step 2 and the optimal reaction temperature from step 4. The experiment was repeated three times, with each reaction including a non-template control (NTC) to eliminate false positives. The total DNA concentration of *Betula chinensis* was 4 ng / μL. Figure 3 As shown, the DNA concentrations for primers 1-8 were 4 ng / μL, 400 pg / μL, 40 pg / μL, 4 pg / μL, 400 fg / μL, 40 fg / μL, 4 fg / μL, and 0.4 fg / μL, respectively. NTC served as a blank control, and ddH2O was used as a template. Based on the observed color changes and gel electrophoresis bands, the detection limit of this primer set for LAMP reaction was 4 fg / μL.

[0041] Example 2

[0042] This embodiment provides a method for detecting the forest bark beetle under field conditions, the steps of which are as follows:

[0043] S1. Rapid extraction of genomic DNA from different insect life stages of *Bark Borer*. Take a 1.5 mL centrifuge tube and add a 1:1 ratio of 25 mM NaOH and TE buffer (10–30 μL; adjust the amount of NaOH and TE buffer according to sample size). Place the centrifuge tube on a metal bath heating block at 95°C for 10 min, then incubate on ice for >1 min.

[0044] S2, LAMP rapid detection. The reaction system followed step 2 of Example 1. The DNA template used was Bark beetle DNA rapidly extracted in step S1 for different insect stages. A blank control (NTC) with ddH2O as the template was set up for each reaction to exclude false positives. The experiment was repeated 3 times. The reaction was carried out at 63℃ for 50 min and then inactivated at 81℃ for 5 min.

[0045] S3. After the reaction, the results were observed using a colorimetric method. The samples were then brought back to the laboratory for verification using gel electrophoresis. Under field conditions, the color change of the reaction system was observed using a colorimetric method. A yellow reaction solution indicated positive amplification, and the detected sample was *Bark Borer chinensis*; a red reaction solution indicated a negative result, and the detected sample was not *Bark Borer chinensis*. Results are as follows: Figure 4 As shown, all different stages of the bark beetle exhibited positive amplification, indicating that the detection method of the present invention can effectively detect different stages of the bark beetle.

[0046] Comparative Example

[0047] This comparative example provides LAMP primers specific to *Bark beetle*, the nucleotide sequences of which are shown in SEQ ID No. 5 to SEQ ID No. 8.

[0048] F3-2: AATATAAACCCCCCTGGAAT (SEQ ID No.5)

[0049] B3-2: GAATATAAACTTCTGGGTGACC (SEQ ID No. 6)

[0050] FIP-2: GGATAAAAGGAGTAAGATGGCAGTATCTGATCGCCTTACTCTC (SEQ ID No. 7)

[0051] BIP-2: ATACAACCTTTTTTGACCCTGCAGAATCAAAATAAGTGTTGGTACAG (SEQ ID No. 8)

[0052] The specificity of the above primers was detected using the primer specificity detection method described in Example 1, and the reaction results are as follows: Figure 5 As shown, the results revealed that this set of primers could amplify not only *Leymus chinensis* but also *Leymus chinensis*, indicating that the primers were not highly specific.

[0053] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. LAMP primers specific to the bark beetle, characterized in that, Its nucleotide sequences are shown in SEQ ID No. 1 to SEQ ID No. 4, wherein the F3 primer is shown in SEQ ID No. 1, the B3 primer is shown in SEQ ID No. 2, the FIP primer is shown in SEQ ID No. 3, and the BIP primer is shown in SEQ ID No.

4.

2. The use of the *Bartholinaeus longifolius*-specific LAMP primers as described in claim 1 in the preparation of the kit.

3. A reagent kit for detecting the bark beetle, characterized in that, It contains the *Bark Borer*-specific LAMP primers as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit also includes fluorescent dyes and / or acid-base indicators.

5. The reagent kit according to claim 3, characterized in that, The kit comprises the following components: the *Bartholinae*-specific LAMP primers as described in claim 1, a DNA template, WarmStart® LAMP 2X Master Mix, and water.

6. The application of the kit according to any one of claims 3 to 5 in the visual detection of bark beetles.

7. A method for detecting the bark beetle, characterized in that, include: Using the DNA of the sample to be tested as a template, amplification was performed using the *Bark Beetle*-specific LAMP primers shown in SEQ ID No. 1 to SEQ ID No. 4; wherein, the F3 primer is shown in SEQ ID No. 1, the B3 primer is shown in SEQ ID No. 2, the FIP primer is shown in SEQ ID No. 3, and the BIP primer is shown in SEQ ID No. 4; The amplification reaction conditions are 60℃~64℃ for at least 50 minutes; The amplification reaction system is as follows: 12.5 μL of 2×WarmStart® LAMP 2X Master Mix, 4 μL of FIP primer, 4 μL of BIP primer, 0.5 μL of F3 primer, 0.5 μL of B3 primer, 1 μL of DNA template, and 2.5 μL of ddH2O.

8. The detection method according to claim 7, characterized in that, The amplification results were interpreted using colorimetric or gel electrophoresis methods.

9. The detection method according to claim 8, characterized in that, The colorimetric method for interpretation is as follows: if the system color is yellow, it is considered positive; if the system color is red, it is considered negative. The interpretation method using gel electrophoresis is as follows: if there are specific ladder-like bands, it is considered positive.

Images