Application of medicine for inhibiting ZIP1 gene expression in inhibition of pancreatic cancer lymph node metastasis

Abstract

The invention relates to application of a medicine for inhibiting ZIP1 gene expression in inhibiting pancreatic cancer lymph node metastasis. Pancreatic cancer cells can secrete S100A4, act on lymphatic endothelial cells (LEC) and up-regulate expression of ZIP1 molecules, glycolysis on the LEC is further up-regulated, lactic acid is generated, the lactic acid destroys expression of tight junction protein Claudin5 between the LEC, pancreatic cancer cells are promoted to enter lymphatic vessels and generate lymphatic metastasis, ZIP1 is used as a target spot, siRNA is constructed, or CRISPR / Cas9 technology is used, and the pancreatic cancer cells can be used for treating lymphatic metastasis. The expression of the lymphatic vessel ZIP1 gene is reduced, and the lymphatic metastasis of pancreatic cancer is blocked.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of a drug for inhibiting ZIP1 gene expression in inhibiting pancreatic cancer lymph node metastasis. Background Art

[0002] Pancreatic cancer is a malignant tumor that originates in the pancreas. Currently, treatment options are limited, the prognosis is poor, and recurrence and metastasis are common. Lymph node metastasis is common in patients with recurrent or metastatic pancreatic cancer and is significantly associated with a poor clinical prognosis. Blocking pancreatic cancer lymph node metastasis is crucial for pancreatic cancer treatment. Summary of the Invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a drug for inhibiting ZIP1 gene expression for use in inhibiting pancreatic cancer lymph node metastasis.

[0004] The technical solutions of the present invention are as follows:

[0005] Use of a drug for inhibiting ZIP1 gene expression in inhibiting pancreatic cancer lymph node metastasis, wherein the drug inhibits pancreatic cancer lymph node metastasis by targeting the ZIP1 gene.

[0006] Furthermore, the drug is specifically an siRNA for inhibiting ZIP1 gene expression, and the siRNA sequence is as follows:

[0007] si-1,"GGCUUACAAGGAGCAGUCATT";

[0008] si-2,"CUGAGCCUAGUAAGCUGUUTT";

[0009] si-3,"CUGGCACCUUUCUCUAUAUTT";

[0010] si-4, "GCCUGCUCUUCAUCCAAAUTT".

[0011] Furthermore, the drug is specifically a CRISPR / Cas9 vector expressing sgRNA, and the sgRNAs targeting sequence is as follows:

[0012] ZIP1-sgRNA-1-Forward, 5′-ACAGCCACCATGGGGCCCTG-3′;

[0013] ZIP1-sgRNA-1-Reverse, 5′-CAGGGGCCCCATGGTGTGT-3′;

[0014] ZIP1-sgRNA-2-Forward, 5′-CTGAGTTCGCGCGCGCTGG-3′;

[0015] ZIP1-sgRNA-2-Reverse, 5′-CCAGCCGGGAACTCCAG-3′.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. The present invention discovered that pancreatic cancer cells secrete S100A4, which acts on lymphatic endothelial cells (LECs) to upregulate the expression of the ZIP1 molecule, thereby upregulating glycolysis on LECs and producing lactic acid. Lactic acid then disrupts the expression of the tight junction protein Claudin5 between LECs, promoting the entry of pancreatic cancer cells into lymphatic vessels and lymphatic metastasis. By targeting ZIP1, siRNA is constructed, or CRISPR / Cas9 technology is used to reduce the expression of the ZIP1 gene in lymphatic vessels, thereby blocking pancreatic cancer lymphatic metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a graph showing the results of the present invention showing reduced lymph node metastasis of pancreatic cancer in mice with systemic ZIP1 knockout;

[0019] Figure 2 This is a graph showing the results of reduced pancreatic cancer lymph node metastasis in the ZIP1 lymphatic endothelial-specific knockout mice of the present invention;

[0020] Figure 3 This is a graph showing the results of the present invention showing that the lymphatic vessels of ZIP1 knockout mice are more tightly connected, restricting lymphatic drainage;

[0021] Figure 4 This is a result diagram showing that sgRNA targets ZIP1 to upregulate tight junction proteins on lymphatic endothelial cells in the present invention;

[0022] Figure 5 This is a graph showing the results of the present invention in which sgRNA targets ZIP1 to reduce the permeability of lymphatic endothelial cells;

[0023] Figure 6 This is a diagram showing the results of the present invention showing that sgRNA targeting ZIP1 hinders tumor cells from passing through lymphatic endothelial cells;

[0024] Figure 7 This is a graph showing the results of the present invention in which siRNA targeting ZIP1 restored the expression of tight junction proteins on lymphatic endothelial cells;

[0025] Figure 8 This is a graph showing the results of the present invention in which siRNA targeting ZIP1 reduces the expression of ZIP1 gene in lymphatic endothelial cells;

[0026] Figure 9 This is a graph showing the results of the present invention in which siRNA targeting ZIP1 reduces the permeability of lymphatic endothelial cells;

[0027] Figure 10 This is a diagram showing the results of the present invention in which siRNA targeting ZIP1 hinders tumor cells from passing through lymphatic endothelial cells. DETAILED DESCRIPTION

[0028] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0029] like Figure 1-10 As shown, the use of drugs for inhibiting ZIP1 gene expression in inhibiting pancreatic cancer lymph node metastasis;

[0030] 1. Experimental Materials and Methods

[0031] 1. Experimental Animals

[0032] Zip1- / - mice with C57BL / 6 background were purchased from Cyagen (KOCMP-30791-Slc39a1-B6N; Suzhou, China).

[0033] Zip1 in the C57BL / 6 background was purchased from Cyagen (CKOCMP-30791-Slc39a1-B6J; Suzhou, China). flox / flox To generate LEC-specific conditional Zip1 knockout mice (Zip1 ΔLYVE1 , Zip1 flox / - ;Prox1 Cre+ , Zip1 flox / flox ;Prox1 Cre+ ) mice.

[0034] The following primers confirmed tissue-specific gene deletion of Zip1 at the mRNA level:

[0035] F1: 5'-TAGGGGTCACTTACATGAACACGA-3′

[0036] R1: 5'-CACATCCCATCCTCTGTGACACACATC-3'.

[0037] Cyagen Biosciences provides mice expressing Cre recombinase under the control of the Lyve1 promoter (Lyve1-Cre) and the Prox1 promoter (Prox1-Cre) on a C57BL / 6 background.

[0038] Zip1 flox / flox Mice were crossed with Lyvel-Cre or Prox1-Cre mice to obtain LEC-specific Zip1 ΔLyvel , Zipl flox / - ;Prox1 Cre+ , Zip1 flox / flox ;Prox1 Cre+ mouse.

[0039] All mice were housed at the SPF Animal Experiment Center of Zhengzhou University at an average temperature of 21°C and 50% humidity with a 12-hour light / dark cycle. Male mice were examined in this study because male animals have less phenotypic variation.

[0040] 2. Cell lines

[0041] The SVEC4-10 cell line was provided by Professor Zhu Mingzhao of the Chinese Academy of Sciences. The LEC cell line SVEC4-10 with low expression of ZIP1 was constructed using CRISPR / Cas9 technology. kd and its control cell line SVEC4-10 ctrl .

[0042] Human lymphatic endothelial cells (hLECs) were purchased from iCell Bioscience and cultured in a primary endothelial cell culture system (Pri Med-iCell-002) consisting of ECM, 5% fetal bovine serum, and supplements containing 10 ng / ml Rh VEGF, 5 ng / ml Rh EGF, 5 ng / ml Rh-FGF, and 15 ng / ml Rh IGF-1.

[0043] The KPC-Luc cell line was derived from a spontaneous mouse pancreatic cancer, LSL-Kras. G12DD / + ;LSL-Trp53 R172H / + ; Pdx-1-Cre (KPC), provided by Dr. Liu Xiaomeng from Fudan University.

[0044] Mouse pancreatic cancer cells Pan02 and KPC-Luc, and human pancreatic cancer PANC-1 were grown in DMEM supplemented with 10% FBS and 100 IU / ml penicillin-streptomycin. Cells were incubated at 37°C in an atmosphere of 5% carbon dioxide and 95% air. A stable Pan02-GFP-Luc cell line was constructed by transfecting Pan02 cells with a GFP-Luc lentiviral vector (Genechem, Shanghai, China). S100A4-KO Pan02-GFP-Luc cells were generated using the CRISPR / Cas9 system.

[0045] 3. CRISPR / Cas9 knockdown of ZIP1

[0046] Using single-guide CRISPR-Cas9 (Cas9 / sgRNA)-mediated gene deletion, a Zip1 knockdown SVEC4-10kd cell line was generated.

[0047] Select two sgRNAs targeting sequences as follows:

[0048] ZIP1-sgRNA-1-Forward, 5′-ACAGCCACCATGGGGCCCTG-3′;

[0049] ZIP1-sgRNA-1-Reverse, 5′-CAGGGGCCCCATGGTGTGT-3′;

[0050] ZIP1-sgRNA-2-Forward, 5′-CTGAGTTCGCGCGCGCTGG-3′;

[0051] ZIP1-sgRNA-2-Reverse, 5′-CCAGCCGGGAACTCCAG-3′.

[0052] The sgRNA cloning vector was pSpCas9-2A-Puro (PX459). PX459 plasmids with or without sgRNAs were co-transfected with packaging plasmids into 293T cells. Viruses were harvested 72 hours later and used to infect SVEC4-10 cells for 36 hours. Limiting dilutions of the cells were plated into 96-well plates to obtain single-cell clones. Monoclonal clones were selected and screened using immunoblotting. Cells that successfully knocked down Zip1 in SVEC4-10 cells (SVEC4-10 kd) were used for experiments.

[0053] 4. Knockdown of ZIP1 by interfering siRNA

[0054] Small interfering RNA (siRNA) oligonucleotides targeting mouse Zip1 (encoded by the s1c39a1 gene) were synthesized (Gene Biosynthesis), with the following sequence:

[0055] S1c39a1-RNAi(130249-1) “CCAATCTGTTCTAGAGGGCAT”;

[0056] S1c39a1-RNAi(130250-1) "CTTAGCCTTGCACTCAGTATT",

[0057] S1c39a1-RNAi(130251-1) "GCTTCGAAGGTCAGGTGCTAA".

[0058] Small interfering RNA (siRNA) oligonucleotides targeting ZIP1 (encoded by the SLC39A1 gene) (Jima Biosynthesis) had the following sequence:

[0059] si-1,"GGCUUACAAGGAGCAGUCATT";

[0060] si-2,"CUGAGCCUAGUAAGCUGUUTT";

[0061] si-3,"CUGGCACCUUUCUCUAUAUTT";

[0062] si-4, "GCCUGCUCUUCAUCCAAAUTT".

[0063] Use transfection reagent (101000046, Polyplus, Shanghai, China) was transfected into SVEC4-10 cells or SVEC4-10kd cells to obtain gene knockdown cells.

[0064] 5. Lymph Node Metastasis Model

[0065] To study pancreatic cancer lymph node metastasis, a mouse popliteal lymph node metastasis model was established. Briefly, 1×10 6 GFP-Luc labeled Pan02 or KPC-Luc cells were inoculated into the footpads of 6-8 week old male mice (5-6 mice per group, repeated at least three times). Tumor volume was monitored every 2 days. Tumor volume (V) was expressed in mm 3 The evaluation is done in units of: V = 0.5 × (L × W 2 ), where L is the long diameter of the tumor and W is the short diameter of the tumor. Mice were sacrificed at the end of the experiment (around day 30 after tumor implantation). Orthotopic tumors in the footpad were removed for immunohistochemical staining. Popliteal lymph nodes and lungs were harvested and bioluminescence quantified using the IVIS Spectrum Imaging System (PerkinElmer). Popliteal lymph nodes were fixed with 4% paraformaldehyde for paraffin sectioning and hematoxylin-eosin (HE) staining.

[0066] 6. Lymphatic Drainage

[0067] The right ear was injected with 1 μL of FITC-dextran (2 mg / mL, 70 kD), and the left ear was injected with PBS as a control. 30 minutes later, cervical lymph nodes were collected from the sacrificed mice and then examined for fluorescence using an IVIS Spectrum Imaging System (PerkinElmer).

[0068] 7. Immunofluorescence staining

[0069] Cryosections of tumor tissue (6 μm) were prepared for immunofluorescence (IF) staining using the following antibodies: LYVE1 (1:200, MAB2125-100, R&D), PROX1 (1:200, AF2727, R&D), Claudin-5 (1:200, 34-1600, Invitrogen), VE-Cadherin (1:200, AF1002, R&D), and ZO-1 (1:200, 40-2200, Invitrogen). Immunohistochemistry (IHC) staining was performed on paraffin-embedded sections.

[0070] 8. Trans-lymphatic endothelial migration

[0071] Gently detach SVEC4-10 cells grown in the culture dish using trypsin. ctrl and SVEC4-10 kd cells, and 1×10 5 cells (SVEC4-10, SVEC4-10 ctrl and SVEC4-10 kd ) Transwell chamber (NESTinsert, 724301). After one day of culture, LECs formed a complete cell monolayer. For cell migration, 3×10 5 Pan02 cells stained with a fluorescent dye (CMFDA, 40721ES60, YEASEN) were added to the endothelial cell monolayer in a 500 μL volume. Culture medium containing a high serum concentration (20%) was added to the lower chamber of the Transwell chamber. After 24 hours, images were taken using a confocal microscope to count the number of cells that had migrated to the lower surface.

[0072] 9. Seahorse Cell Metabolism Assay

[0073] A Seahorse XF96 cell energy metabolism analyzer (Seahorse Bioscience, MA, USA) was used to measure the extracellular acidification rate (ECAR). SVEC4-10 (6000 cells / well) were seeded onto a Seahorse XF96 cell culture plate and incubated overnight. The next day, the culture medium was removed and the cells were washed twice with XF basal medium containing 2mL 200mM L-glutamine. The plate was then incubated in a non-CO2 incubator at 37°C for 1 hour. 10mM glucose, 1μM oligomycin, and 50mM 2-deoxyglucose (2-DG) were automatically injected into each well in sequence, followed by 3 measurement cycles. ECAR was standardized according to Hoechst (Beyotime) staining. The test was repeated 5-6 times, and each experiment was repeated three times independently. In order to measure mitochondrial respiration, blockers were added sequentially through the port of the Seahorse Flux-Pak cartridge. Oxygen consumption rate was measured using Seahorse XF96 analysis.

[0074] 10. Zn 2+ Ingestion

[0075] In order to detect Zn 2+ The absorption of 1×10 4 SVEC4-10 ctrl or SVEC4-10 kd Cells were seeded into individual wells of a 96-well black plate and incubated overnight. One hour after loading with 2 μM FluoZin3, 30 μM ZnCl2 was added to HBSS. 60 seconds after addition, FluoZin3 fluorescence was read every 30 seconds for the specified time to assess changes in intracellular free Zn2+. All values ​​were subtracted from the blank values ​​to assess intracellular Zn2+. 2+ The cell fluorescence time point (F) at the beginning was used as F0, and the intracellular Zn 2+ The change in F is calculated as ΔF / F0, where ΔF=F-F0. The origin is forced to zero and the measurement start time is 60 seconds.

[0076] 11. Assessment of the tightness of lymphatic endothelial cell monolayer

[0077] The intercellular tightness of LEC monolayer was assessed by measuring the electrical impedance of the LEC monolayer using the xCELLigence System RTCA-MP instrument (ACEA Biosciences Co., Ltd., San Diego, CA). In short, 40,000 cells were seeded into 96-cell E-plates (ACEA Biosciences Co., Ltd.) and monitored using the RTCA-MP instrument. Each group contained at least three replicates. Once the cell index value reached a peak, indicating that LECs had formed a monolayer, a stimulant was added to the culture. The cell index value before the addition of the stimulant was used as a reference point. Impedance was analyzed as a normalized cell index and expressed as relative cell impedance. All experiments were repeated at least three times.

[0078] 12. Lymphatic endothelial cell monolayer permeability test

[0079] 1×10 5 cell lines (SVEC4-10 ctrl and SVEC4-10 kd ) or 2×10 5 Primary cells (mLECs) were seeded on the upper surface of the upper chamber of a Transwell chamber. After one day of culture, LECs formed a complete monolayer. 100 μL of DMEM containing 70 kDFITC dextran (2 mg / mL, Sigma-Aldrich, Bomem, Belgium) was injected into the upper chamber of the Transwall chamber, and 500 μL of DMEM was injected into the lower chamber of the Transwall chamber. After 30 minutes in a 37°C incubator, the culture medium in the lower chamber of the Transwell chamber was mixed, and 100 μL of culture medium was added to a 96-well plate (repeated three times for each sample). Fluorescence (Ex: 488 nm, Em: 530 nm) was measured using a SpectraMAX i3X (Molecular Devices, CA, USA).

[0080] 13. Glucose analogue uptake experiment

[0081] 2-[N-(7-nitrobenzene-2-oxa-1,3-dihydroxy-4-yl)amino]-2-deoxyglucose (2-NBDG) is a glucose analog. ctrl / SVEC4-10 kdCells were seeded in 24-well plates. After overnight, the culture medium was discarded and the cells were washed with PBS (pH 7.4). Low-glucose culture medium supplemented with 2-NBDG (100 μM, N13195, Life Technologies) was subsequently added and incubated at 37 ° C for 45 minutes. Next, the cells were washed with PBS and trypsin was added, the cells were harvested, centrifuged at 1500 rpm for 5 minutes at 4 ° C, washed twice with ice PBS, and kept on ice. A control sample lacking 2-NBDG was used to set a blank in the flow cytometer and set the 2-NBDG detection parameters.

[0082] 14. Western blotting

[0083] Cells were lysed with RIPA lysis buffer (Solarbio, China), and lysates were collected. Proteins were separated by 10% SDS-PAGE and transferred to nitrocellulose (NC) membranes. The membranes were incubated with primary antibodies and probed with HRP-conjugated secondary antibodies (ABclonal). The following primary antibodies were used: ZIP1 (1:1000, ALO-AZT-001; Alomone, Israel), claudin-5 (1:1000, 34-1600, Invitrogen, USA), VE-Cadherin (1:1000, 13368, Abcam, UK), ZO-1314335, OriGene, USA), and β-actin (1:1000, AC026, ABclonal, CN).

[0084] 15. Statistics

[0085] Statistical analysis was performed using GraphPad Prism 8.3.0. Statistical significance between two groups was determined using an unpaired Student's t-test (two-sided). Multiple groups were compared using one-way analysis of variance, and curves were compared using two-way analysis of variance. Data are presented as mean ± standard error of the mean (SEM). Sample sizes are indicated where appropriate. Asterisks (*) indicate statistical significance (*p < 0.05; **p < 0.01; ***p < 0.001).

[0086] 2. Results

[0087] 1. ZIP1 systemic knockout mice show reduced lymph node metastasis of pancreatic cancer

[0088] A mouse pancreatic cancer lymph node metastasis model was constructed (AB). Mouse pancreatic cancer Pan02-GFP-Luc cells were inoculated into the footpads of mice (ZIp1+ / +, ZIP1- / -). After 35 days, the ipsilateral and contralateral popliteal lymph nodes of the mice were taken to detect lymph node metastasis. The results showed that tumor metastasis could be detected in the ipsilateral popliteal lymph nodes of most control mice (ZIP1+ / +) (5 / 6), while the lymph node metastasis of knockout mice (ZIP1- / -) was significantly reduced (3 / 6) (CE). The results showed that the lymph node metastasis of pancreatic cancer in ZIP1 systemic knockout mice was reduced (such as Figure 1 shown).

[0089] The following is Figure 1 Contents of the corresponding part

[0090] (AB) Schematic diagram of animal experiments on popliteal lymph node metastasis in pancreatic cancer mice. Pan02-GFP-Luc cells were inoculated into Zip1 + / + Mouse, Zip1 - / - After 35 days, the mice were sacrificed and examined for tumor metastasis.

[0091] (C) Small animal imaging bioluminescence detection of Zip1 + / + Mouse, Zip1 - / - Metastasis of the popliteal lymph nodes on the ipsilateral side of the footpad tumor in mice (n=6 per group).

[0092] (D) Quantification of the bioluminescence intensity of the above LN transfer.

[0093] (E) Quantification of pancreatic cancer lymph node metastasis (LNM) in three independent animal experiments (n=18 per group).

[0094] 2. ZIP1 lymphatic endothelial-specific knockout mice show reduced pancreatic cancer lymph node metastasis

[0095] Construction of ZIP1-deficient mice (ZIP1f / f; Lyve-Cre, Zip1 ΔLyvel Pan02-GFP-Luc cells were inoculated to detect popliteal lymph node metastasis. The results showed that compared with the control (ZIP1f / f), lymphatic endothelial-specific knockout of ZIP1 (Zip1 ΔLyvel ) Reduce tumor lymph node metastasis ( Figure 2 ).

[0096] from Figure 2 It can be seen that the lymphatic endothelial cell-specific ZIP1 deficiency in mice with pancreatic cancer LN metastasis is reduced. Figure 2 The content of the corresponding part.

[0097] (A) Bioluminescence detection of control Zip1 by small animal imaging flox / flox Mouse and lymphatic endothelial cell-specific ZIP1 deletion ZIP1 ΔLyvel Lymph node metastasis of mouse footpad tumor to the ipsilateral popliteal fossa tumor.

[0098] (B) Quantification of the above-mentioned lymph node metastasis bioluminescence intensity (n=5 mice per group).

[0099] (C) Quantification of bioluminescence intensity of lymph node metastasis (LNM) in two independent animal experiments (n=12 per group).

[0100] 3. Lymphatic tight junctions in ZIP1 knockout mice are tighter, limiting lymphatic drainage

[0101] Pan02-GFP-Luc tumor tissues of mouse pancreatic cancer (ZZip1 + / + Mouse, Zip1 - / - In ZIP1-deficient mice, fluorescent staining for LYVE1 (for lymphatic vessels) and Claudin-5 (for tight junctions) was performed. The results revealed low Claudin-5 expression in the lymphatic endothelium, but increased Claudin-5 expression in these cells after ZIP1 knockout (AB). This suggests that ZIP1 knockout upregulates tight junction expression in the lymphatic endothelium.

[0102] Next, fluorescent microspheres FITC-Dextran 70kD were used to simulate lymphatic drainage of tumor cells to lymph nodes. + / + Mouse, Zip1 - / - FITC-Dextran 70kD was injected into the right ear of mice to detect changes in lymphatic drainage function. + / + Mouse, Zip1 - / - The mice showed a decrease in the number of fluorescent beads draining into their lymph nodes, suggesting that ZIP1 knockout restricts lymphatic drainage.

[0103] from Figure 3 It can be seen that Zip1 - / - The intercellular connections of lymphatic vessels in mouse tumors are enhanced, as shown below. Figure 3 The content of the corresponding part.

[0104] (A) Representative images showing Zip1 + / + and Zip1 - / - Immunostaining of LYVE1 and claudin-5 in mouse Pan02-GFP-Luc tumor sections. Scale bar, 150 μm.

[0105] (B) Quantification of claudin-5 fluorescence intensity on LYVE1+ lymphatic vessels (n = 20 fields per group).

[0106] (C) Representative images showing drainage to cervical lymph nodes after FITC-dextran injection into the ears of the indicated mice.

[0107] (D) Quantification of FITC-dextran fluorescence in cervical lymph nodes (Zip1 + / + n=6; Zip1 - / - n=8).

[0108] 4. sgRNA targeting ZIP1 upregulates tight junction proteins on lymphatic endothelial cells

[0109] SVEC4-10 cells were infected with CRISPR / Cas9 and cells with low expression of ZIP1 were screened (SVEC4-10 kd Compared with the control cells, Claudin-5 expression was upregulated (e.g. Figure 4 shown).

[0110] 5. sgRNA targeting ZIP1 reduces the permeability of lymphatic endothelial cells

[0111] Compared with control cells (SVEC4-10 ctrl ), ZIP1 low expression cells (SVEC4-10 kd ) decreased permeability to FITC-Dextran 70kD (e.g. Figure 5 shown).

[0112] 6. sgRNA targeting ZIP1 hinders tumor cells from passing through lymphatic endothelial cells

[0113] Knockdown of ZIP1 in SVEC4-10 cells using CRISPR / Cas9 reduced the ability of pancreatic cancer cells Pan02 to cross the SVEC4-10 monolayer. This suggests that targeting ZIP1 in the lymphatic endothelium using sgRNA may block pancreatic cancer lymphatic metastasis (e.g., Figure 6 shown).

[0114] 7. siRNA targeting ZIP1 restores the expression of tight junction proteins on lymphatic endothelial cells

[0115] After synthesizing siRNA targeting ZIP1 and knocking down ZIP1 in SVCF4-10 cells, Claudin-5 expression was upregulated (e.g. Figure 7 shown).

[0116] 8. siRNA targeting ZIP1 reduces ZIP1 gene expression in lymphatic endothelial cells

[0117] siRNA targeting human ZIP1 (si-1, 2, 3, 4) and control NC oligonucleotides were constructed and transfected into human primary lymphatic endothelial cells hLEC. After 24 hours, the expression of ZIP1 was detected by PCR. It can be seen that si-1, 3, 4 can effectively knock down the expression of ZIP1 in hLEC (such as Figure 8 shown).

[0118] 9. siRNA targeting ZIP1 reduces the permeability of lymphatic endothelial cells

[0119] siRNA targeting ZIP1 was synthesized to knock down ZIP1 on human primary lymphatic endothelial cells hLEC, reducing the permeability of hLEC monolayer to fluorescent microspheres FITC-Dextran 70kD (e.g. Figure 9 shown).

[0120] 10. siRNA targeting ZIP1 blocks tumor cells from passing through lymphatic endothelial cells

[0121] Knockdown of ZIP1 on human primary lymphatic endothelial cells (hLEC) using siRNA reduced the translocation of human pancreatic cancer PANC-through the hLEC monolayer. This suggests that targeting ZIP1 in the lymphatic endothelium using siRNA may block pancreatic cancer lymphatic metastasis (e.g., Figure 10 shown).

[0122] In this embodiment, the corresponding drug may also be a small molecule inhibitor or a blocking antibody that inhibits ZIP1 gene expression.

[0123] Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of a drug for inhibiting ZIP1 gene expression in inhibiting pancreatic cancer lymph node metastasis, characterized in that: The drug targets the ZIP1 gene to inhibit pancreatic cancer lymph node metastasis.

2. Use of the drug for inhibiting ZIP1 gene expression according to claim 1 in inhibiting pancreatic cancer lymph node metastasis, characterized in that: The drug is specifically siRNA for inhibiting the expression of ZIP1 gene, and the sequence of the siRNA is as follows: si-1,"GGCUUACAAGGAGCAGUCATT"; si-2,"CUGAGCCUAGUAAGCUGUUTT"; si-3,"CUGGCACCUUUCUCUAUAUTT"; si-4."GCCUGCUCUUCAUCCAAAUTT".

3. Use of the drug for inhibiting ZIP1 gene expression according to claim 1 in inhibiting pancreatic cancer lymph node metastasis, characterized in that: The drug is specifically a CRISPR / Cas9 vector expressing sgRNA, and the sgRNAs targeting sequence is as follows: ZIP1-sgRNA-1-Forward, 5′-ACAGCCACCATGGGGCCCTG-3′; ZIP1-sgRNA-1-Reverse, 5′-CAGGGGCCCCATGGTGTGT-3′; ZIP1-sgRNA-2-Forward, 5′-CTGAGTTCGCGCCGCTGG-3′; ZIP1-sgRNA-2-Reverse, 5′-CCAGCCGGGAACTCCAG-3′.

Images