GmG3PDH8 gene and application thereof in regulating soybean resistance to soybean mosaic virus
By isolating and identifying the GmG3PDH8 gene, constructing an overexpression vector and performing genetic transformation, soybean plants with excellent disease resistance were cultivated, solving the problem of insufficient resistance to soybean mosaic virus and improving soybean yield and quality.
Patent Information
- Application Number
- CN202510474001.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-04-16
AI Technical Summary
Current technology lacks effective methods for breeding soybean varieties resistant to soybean mosaic virus, leading to a decline in soybean yield and quality.
The GmG3PDH8 gene was isolated and identified. The resistance of soybean plants was regulated by gene overexpression and silencing. An overexpression vector was constructed and genetic transformation was carried out using Agrobacterium-mediated transformation to cultivate soybean plants with excellent disease resistance.
This significantly reduces the accumulation of soybean mosaic virus and greatly improves soybean resistance to soybean mosaic virus, providing a new solution for cultivating high-quality disease-resistant soybeans and laying the foundation for the sustainable development of the soybean industry.
Smart Images
Figure CN120192977B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, in particular to GmG 3 PDH 8 gene and its application in regulating soybean resistance to soybean mosaic virus. BACKGROUND
[0002] Soybean mosaic virus disease is a kind of important soybean virus disease caused by soybean mosaic virus (i.e. SMV) and widely occurs in the world. The typical symptoms are plant dwarfing, yellow-green interlaced mosaic and shriveling of leaves, leaf edge under rolling or leaf distortion, hard and brittle texture, leaf vein browning, and sometimes many blister-like protrusions along the two sides of the leaf vein. Soybean mosaic virus not only causes yield reduction of soybean, but also reduces the quality of soybean seeds, and the soybean seed coat mottling caused by soybean mosaic virus leads to brown spot grains, which reduces the price of commodity beans.
[0003] Therefore, the research on soybean resistance to soybean mosaic virus helps to determine the SMV disease resistance gene and clarify the soybean resistance to SMV regulation network, effectively improve the actual yield and quality of soybean, provide a feasible solution for cultivating soybean plants resistant to soybean mosaic virus, and lay a good foundation for the sustainable development of soybean industry.
[0004] However, there is no good prevention and treatment method for soybean mosaic virus disease at present, and cultivating disease-resistant varieties is the most economical and effective method. However, how to cultivate soybean varieties resistant to soybean mosaic virus is a problem to be solved at present.
[0005] Therefore, the prior art needs to be further improved. SUMMARY
[0006] In view of the above problems, the present application provides a kind of GmG3PDH8 Gene and the application of the gene in regulating soybean resistance to soybean mosaic virus, the gene positively regulates soybean resistance to soybean mosaic virus, and the cultivated GmG3PDH8 overexpression soybean plants have stable and excellent soybean mosaic virus resistance.
[0007] To solve the above problems, the present application provides the following technical solutions:
[0008] In the first aspect, the present application provides a kind of GmG3PDH8 Gene, the gene sequence is as shown in SEQ ID NO.1.
[0009] The present application separates a new gene of GmG3PDH Gene family from soybean by homologous cloning method GmG3PDH8 The sequence of the gene is as shown in SEQ ID NO.1. Expression pattern analysis shows that GmG3PDH8 It is mainly expressed in seeds, and fluorescence quantitative PCR detection finds that the gene is induced to express more after virus infection.
[0010] In order to clarify the function of GmG3PDH8 in the process of soybean mosaic virus (SMV) infection, the silencing soybean plants and overexpression plants of the gene are constructed, and the experimental results show that the soybean silencing plants accumulate more soybean mosaic virus than the control plants; and the soybean plants overexpressing GmG3PDH8 carry a large amount of soybean mosaic virus, which shows excellent soybean mosaic virus resistance.
[0011] Therefore, the gene is an SMV disease resistance gene, and positively regulates the SMV disease resistance performance of soybean plants. The gene provides a new feasible solution for the cultivation of high-quality disease-resistant soybeans.
[0012] In a second aspect, the present application also provides a protein encoded by the above-mentioned GmG3PDH8 gene.
[0013] The corresponding protein sequence can be obtained by analyzing the nucleotide sequence as shown in SEQ ID NO. 1, and the protein sequence thereof is combined into a recombinant vector to construct an overexpression vector for the research of the GmG3PDH8 gene or the construction of overexpression plants, etc. GmG3PDH8
[0014] In a third aspect, the present application also provides a recombinant vector or a recombinant bacterium of the above-mentioned GmG3PDH8 gene.
[0015] The above-mentioned recombinant vector is pMDC83; and the recombinant bacterium is Escherichia coli DH5α and Agrobacterium EHA105.
[0016] In a fourth aspect, the present application also provides the above-mentioned GmG3PDH8 gene, and a recombinant vector or a recombinant bacterium containing the GmG3PDH8 gene for use in regulating the SMV resistance of soybean.
[0017] Through the analysis of the silencing plants and overexpression plants of the GmG3PDH8 gene, GmG3PDH8 the gene is positively regulated to the SMV disease resistance performance of soybean plants. On the one hand, the expression amount of the GmG3PDH8 gene can be reduced by gene knockout, gene silencing, etc., so as to down-regulate the SMV resistance of soybean plants, and the obtained transgenic plants have higher SMV infectivity and can be used as experimental materials for research. On the other hand, the expression amount of the GmG3PDH8 gene in plants can be increased by gene overexpression, so as to improve the SMV resistance of soybean plants, which is a method for cultivating high-quality disease-resistant soybean germplasm.
[0018] In a fifth aspect, the present application also provides the above-mentioned GmG3PDH8 gene, and a recombinant vector or a recombinant bacterium containing the GmG3PDH8 Application of gene recombination vectors, transgenic cells, or recombinant bacteria in the cultivation of soybean plants resistant to soybean mosaic virus.
[0019] Experiments have shown that, GmG3PDH8 Soybean plants overexpressing the gene exhibited excellent resistance to SMV. In susceptible plants inoculated with the SC3 strain, symptoms of soybean mosaic virus were almost undetectable, or significantly reduced. Western blot analysis also showed that the amount of SMV accumulated in the overexpressing soybean plants was far less than that in the control.
[0020] Sixthly, this application provides a method for cultivating soybean plants resistant to soybean mosaic virus, the method comprising: constructing... GmG3PDH8 8. Overexpression of soybean plants was carried out to obtain soybean plants resistant to soybean mosaic virus.
[0021] Optionally, the cultivation method specifically includes: constructing GmG3PDH8 Recombinant expression vector, to which the GmG3PDH8 The recombinant expression vector was inoculated onto soybean cotyledon nodes.
[0022] Optionally, the overexpression vector is pMDC83; the transformation method is: through a multiple cloning site... GmG3PDH8 The gene was ligated into the expression vector pMDC83, heat-transformed into Agrobacterium EHA105, and the recipient variety was genetically transformed using Agrobacterium-mediated transformation.
[0023] Seventhly, this application also provides a specific primer, which specifically amplifies the aforementioned... GmG3PDH8 The gene, and the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0024] Eighthly, this application also provides the above-mentioned specific primers for identification GmG3PDH8 Applications in genes.
[0025] The present invention has the following beneficial effects:
[0026] 1. This invention is the first to isolate and identify GmG3PDH8 The gene was discovered for the first time to be an SMV resistance gene, which positively regulates the resistance of soybean plants to SMV. This gene provides a new and feasible solution for the breeding of high-quality disease-resistant soybeans, provides important gene resources for molecular breeding to improve the resistance of soybeans to soybean mosaic virus, and lays a good foundation for the sustainable development of the soybean industry.
[0027] 2. Based on GmG3PDH8 The disease resistance gene, along with recombinant vectors, transgenic cells, or recombinant bacteria containing the gene, can be used to regulate soybean resistance to soybean mosaic virus. On one hand, gene knockout and gene silencing can be used to reduce...GmG3PDH8 By increasing the expression level of [a specific gene], the resistance of soybean plants to soybean mosaic virus (SMV) is downregulated, resulting in transgenic plants with higher SMV infectivity, which can be used as experimental materials for research. On the other hand, gene overexpression can be used to increase the [specific expression level] in plants. Figure 1 Improving the expression level of genes, thereby enhancing the SMV resistance of soybean plants, is a method for breeding high-quality disease-resistant soybean germplasm. Attached Figure Description
[0028] GmG3PDH8 The sequence alignment results; where seq1 is Glyma.19g053500, and seq2 is soybean. Figure 2
[0029] GmG3PDH for Figure 3 Specific expression of genes in different soybean tissues;
[0030] GmG3PDH for Figure 4 Expression of family genes after SMV infection;
[0031] GmG3PDH8 for Figure 5 Changes in SMV disease resistance in silent materials; A represents leaf phenotype; B represents the results of Western blot analysis of SMV in leaves.
[0032] GmG3PDH8 for GmG3PDH8 Changes in SMV disease resistance in overexpressed materials; the left figure shows the leaf phenotype; the right figure shows the Western blot results of SMV detection in the leaves. Detailed Implementation
[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.
[0034] Example 1 GmG3PDH8 Gene cloning and sequence analysis
[0035] 1. Experimental methods and procedures
[0036] (1) GmG3PDH8 Cloning of genes
[0037] Download soybeansGmG3PDH8 Gene, design homologous primer upstream as GmG3PDH8 -F: ATGGCTCCAGCCTTGGAAG (as SEQ ID NO. 2), downstream primer GmG3PDH8 -R: GAAGGACCTGGGTAGCTTCT (as SEQ ID NO. 3), clone its homologous gene in soybean varieties Essex and Nannong 1138-2.
[0038] First, extract the RNA of soybean variety Essex by KARROTEN kit, then reverse transcription to get cDNA by using the extracted RNA as template and Oligo (dT) as primer; then, use the aforementioned designed homologous upstream primer and homologous downstream primer and Novozyme high-fidelity enzyme to amplify, and send the amplification product to the company for sequencing.
[0039] (2) GmG3PDH8 Sequence alignment of gene
[0040] Sequence alignment analysis of the sequencing results of the amplification product is performed on NCBI.
[0041] 2. Experimental results and analysis
[0042] Soybean Figure 1 The sequencing results of the gene are shown in SEQ ID NO. 1, and the length of the gene is 1140 bp. Sequence alignment is performed between the gene and the sequence Glyma.19g053500 (i.e. seq-1) in NCBI with the highest homology in soybean, and the homology of the two is 98.87%. The alignment results are shown in Figure 1 . GmG3PDH
[0043] Example 2 GmG3PDH Tissue-specific expression of gene
[0044] 1. Experimental methods and steps
[0045] The expression of GmG3PDH gene in flower, leaf, nodule, pod, root, root hair, seed, stem tip meristem (SAM) and stem in different tissues is analyzed.
[0046] The analysis method of tissue-specific expression is: download the tissue expression data of Figure 2 gene from Phytozome database, and visualize the data by using TBtools.
[0047] 2. Experimental results and analysis
[0048] From the experimental results of GmG3PDH9 , GmG3PDH Only a small amount of expression in flowers, leaves, pods and seeds, and the rest GmG3PDH8 Expressed in all tissues. Among them GmG3PDH High expression in seeds. The results show that these GmG3PDH family genes may be selectively expressed during soybean growth and development.
[0049] Example 3 Expression pattern of GmG3PDH family members in response to SMV infection
[0050] 1. Experimental methods and steps
[0051] SMV was inoculated on the susceptible variety Nannong 1138-2, and when the leaf symptoms appeared, the leaves were taken for transcriptome sequencing.
[0052] 2. Experimental results and analysis
[0053] According to the transcriptome data of soybean leaves after SMV infection, it is found that: GmG3PDH8 Family members are up-regulated to varying degrees, among which Figure 3 The expression amount is the largest, see GmG3PDH8 for details. GmG3PDH8 was selected for subsequent experiments.
[0054] Example 4 Changes in disease resistance of GmG3PDH8 silenced plants to SMV
[0055] 1. Experimental methods and steps
[0056] In order to detect whether G3PDH8 is involved in the regulation of soybean SMV infection, the virus-induced gene silencing (BPMV-VIGS) method was used to construct soybean G3PDH8 gene silencing material (S G3PDH ), and BPMV empty vector as control (V), S G3PDH and V were inoculated on the resistant variety Rsv1 and the susceptible variety Essex, respectively, then inoculated with SMV G7 strain, and the virus proliferation was monitored over time.
[0057] (1) Figure 4 The construction steps of the gene silencing material are as follows: specific primers S G3PDH - F and S G3PDH -R amplified 135 bp sequence from S40-S174 of GmG3PDH, then ligated into BPMV RNA2, forming recombinant vector BPMV-RNA2-GmG3PDH. BPMV-RNA1 and BPMV-RNA2-GmG3PDH were transcribed in vitro respectively and mixed together for rubbing inoculation of recombinant BPMV on soybean leaves. In vitro transcription reagents were purchased from NEB, and the reaction system was configured as follows:
[0058]
[0059] 37°C for 3-4 h. Take 1 μl of the above in vitro transcription product, and use 1.0% agarose gel electrophoresis to detect the RNA yield of in vitro transcription. The remaining in vitro transcription product BPMV-RNA1 and recombinant BPMV-RNA2 are mixed in equal amounts for in vitro inoculation experiment. The primer sequences are as follows:
[0060] S G3PDH - F: AGTGTGGCACAGAACAACTC (SEQ ID NO. 4);
[0061] S G3PDH - R: GCTAAGCCTGAGGGTATTGG (SEQ ID NO. 5).
[0062] (2) The S G3PDH and V were inoculated into the resistant variety Rsv1 and the susceptible variety Essex, respectively: On the 10th-14th day after in vitro inoculation of the mixture, the inoculated leaves of the soybean and the leaf phenotypic changes of the first pair and the second pair of trifoliate leaves were observed, and if typical symptoms of mosaic were observed with the naked eye, it was considered that the in vitro inoculation was successful. The mosaic symptom leaves of S G3PDH and the empty vector (V) were ground in a mortar and rubbed onto the first pair of true leaves of soybean.
[0063] (3) Virus monitoring method: within one week after rubbing inoculation, the plant disease was observed with the naked eye, the first pair of trifoliate leaves was inoculated with SMV, and Western blot experiment was performed on the diseased plants and the control group to detect the SMV virus content in the plants.
[0064] 2. Experimental results and analysis
[0065] (1) From the phenotype, the Rsv1 plants inoculated with S G3PDH showed more obvious symptoms after being infected with G7 strain, and the plants had more necrotic spots, as shown in Figure 4 A; while the control plants showed normal symptoms.
[0066] (2) Western blot analysis showed that, in Rsv1, compared with V, S G3PDH High levels of SMV accumulated on the plant surface (see Figure 4 (B lower part). In Essex soybeans, SMV protein is present in S... G3PDH Medium accumulates earlier in V plants ( GmG3PDH8 (B upper part). Therefore, the above results indicate that the Rsv1 plant... G3PDH8 It may have a positive regulatory effect on SMV resistance.
[0067] Example 5: Changes in resistance to SMV in plants overexpressing GmG3PDH8
[0068] 1. Experimental methods and procedures
[0069] (1) Recombinant vector OE overexpressing GmG3PDH8 G3PDH Construction
[0070] Constructing soybean gene silencing using the virus-induced gene silencing (BPMV-VIGS) method Figure 5 Gene overexpression material (OE) G3PDH The specific steps are as follows: Using specific primers OE-F: ATGGCTCCAGCCTTGGAA (SEQ ID NO. 6) and OE-R: GAAGGACCTGGGTAGC (SEQ ID NO. 7), the full-length CDS sequence OEGmG3PDH8 of GmG3PDH8 was amplified. The BPMV-RNA2 vector was linearized and ligated with OEGmG3PDH8 to obtain the overexpression recombinant vector pRNA2-OE. G3PDH8 .
[0071] (2) Construction of overexpression plants
[0072] pRNA2-OE G3PDH An equal amount of pRNA1 in vitro transcript was mixed and inoculated onto soybean leaves via friction. Once the upper leaves unfolded, disease incidence was observed. Diseased leaves were collected, RNA was extracted, and quantitative real-time PCR was performed to identify G3PDH expression. Plants with upregulated G3PDH expression were identified as overexpression-positive plants and labeled as OE. G3PDH The empty BPMV vector was used as a control (V), and the OE vector was used as a control. G3PDH The virus was inoculated onto the susceptible variety Nannong 1138-2, followed by inoculation with the SMV SC3 strain, and the virus replication was monitored over time.
[0073] In vitro transcription method: Refer to Example 4.
[0074] (3) Virus monitoring method: Refer to Example 4.
[0075] 2. Experimental results and analysis
[0076] From the phenotype, the symptoms of SMV in the OE plants inoculated with SC3 strain were very light or almost invisible (see Fig. A). Western blot analysis showed that the amount of SMV accumulated in the OE plants was much less than that in the V plants (see Fig. B). G3PDH Figure 5 A). Western blot analysis showed that the amount of SMV accumulated in the OE plants was much less than that in the V plants (see Fig. B). G3PDH GmG3PDH8 B).
[0077] In summary, the overexpression of SMV in soybean can be used to obtain stable plants with improved resistance to SMV.
[0078] It can be understood that, for those skilled in the art, equivalent replacements or changes can be made according to the technical solutions and concepts of the present application, and all such changes or replacements shall fall within the protection scope of the appended claims of the present application.
Claims
1. GmG3PDH8 A gene, and a recombinant vector or a recombinant bacterium containing the gene are used in regulating soybean mosaic virus resistance of soybean, and the gene is amplified by taking cDNA of soybean variety Essex as a template and taking SEQ ID NO. 2 and SEQ ID NO. 3 as primers. GmG3PDH8 A gene, and a recombinant vector or a recombinant bacterium containing the gene are used in regulating soybean mosaic virus resistance of soybean, and the gene is amplified by taking cDNA of soybean variety Essex as a template and taking SEQ ID NO. 2 and SEQ ID NO. 3 as primers. GmG3PDH8 A gene, and a recombinant vector or a recombinant bacterium containing the gene are used in regulating soybean mosaic virus resistance of soybean 2. As described in claim 1 GmG3PDH8 Genes, and those containing this GmG3PDH8 Application of gene recombinant vectors or recombinant bacteria in the cultivation of soybean plants resistant to soybean mosaic virus.
3. A method for breeding a soybean plant resistant to soybean mosaic disease, characterized by, Constructing a plant as claimed in claim 1 GmG3PDH8 Overexpressing the soybean plants, thereby obtaining soybean plants resistant to soybean mosaic virus disease.
4. The breeding method according to claim 3, characterized by, The cultivation method is: constructing GmG3PDH8 recombinant expression vectors, inoculating the GmG3PDH8 GmG3PDH8 recombinant expression vectors into soybean leaves.