Method for transforming bacillus subtilis to produce phycocyanobilin

By modifying Bacillus subtilis, expressing the ferredoxin oxidoreductase gene and heme oxygenase gene, and optimizing the coenzyme cycle, the problem of energy waste and purification difficulties in the acquisition of phycocyanin is solved, and efficient and safe phycocyanin production is achieved.

CN120192995APending Publication Date: 2025-06-24QILU SCHOOL OF MEDICINE
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510227764.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The acquisition method of phycocyanin in the prior art has problems such as waste of energy, difficulty in purification of pigments and low production efficiency, and the E. coli expression system leads to difficulty in detection of endotoxins in purification of phycocyanin.

Method used

By modifying Bacillus subtilis, the ancestral sequence of the ferredoxin oxidoreductase gene PcyA and the expression of the heme oxygenase Ho1 gene were used, and the coenzyme cycle optimization was combined with the optimization of phycocyanin production.

Benefits of technology

The yield of phycocyanin has been increased to 20.42 mg/L, which simplifies the purification process of phycocyanin, reduces the complexity of endotoxin removal, and improves production efficiency and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192995A_ABST
    Figure CN120192995A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of phycocyanobilin, and particularly discloses a method for producing phycocyanobilin by modifying bacillus subtilis, which comprises the following steps: preparation of a culture medium, synthesis of phycocyanobilin biosynthesis key genes, construction of a carrier, and construction of phycocyanobilin synthesis efficient coenzyme factor circulation. According to the method, a ferredoxin oxidoreductase gene PcyA is used as a template, an ancestral sequence of the ferredoxin oxidoreductase gene PcyA is synthesized, a bacillus subtilis expression system is used for expressing a heterologous synthesized phycocyanobilin gene, and the yield of phycocyanobilin is increased by increasing synthesis of coenzyme and reaches 20.42 mg / L in a shake flask; the yield of the phycocyanobilin in the bacillus expression system is increased, the use of the bacillus expression system simplifies the step of removing endotoxin for the subsequent purification of the phycocyanobilin, and the purification and use of the phycocyanobilin are safer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of phycocyanin, and specifically relates to a method for modifying Bacillus subtilis to produce phycocyanin. Background Art

[0002] Phycocyanin (also known as phycocyanin or phycobiliprotein) is a pigment-protein complex mainly present in red algae, blue algae, etc. It has the ability to capture blue and green light and has a wide range of applications in the fields of food, cosmetics, health products, and pharmaceuticals. It consists of an apoprotein and a chromophore, has fluorescence activity, and its synthesis process involves the action of multiple enzymes, such as porphobilinogen synthase, uroporphyrinogen III synthase, etc.

[0003] Currently, the method for obtaining phycocyanin mainly uses high-temperature methanol decomposition to extract it from Spirulina. This method has many problems:

[0004] (1) High-temperature methanol pyrolysis requires a large amount of energy, resulting in energy waste;

[0005] (2) Other pigments coexisting with phycocyanin in Spirulina, such as a series of precursors like chlorophyll and lutein, have an adverse effect on the purification of the later products;

[0006] (3) The growth cycle of Spirulina is relatively long, restricting the production efficiency and application of phycocyanin. Therefore, extracting high-purity PCB from natural algae is a complex and uneconomical method.

[0007] In response to this problem, Zhao Xinrui et al. from Jiangnan University conducted research on phycocyanin synthesis, heterologously expressed specific genes in Escherichia coli, and strengthened the synthesis of heme, achieving the conversion of protoheme to biliverdin, an intermediate in phycocyanin synthesis, and achieving a phycocyanin yield of 28.32 mg / L in a 5 L fermenter; Zhou Jingwen et al. from Jiangnan University heterologously expressed specific genes in Escherichia coli, strengthened the synthesis of heme, achieved the conversion of protoheme to biliverdin, an intermediate in phycocyanin synthesis, reduced the accumulation of the intermediate biliverdin, and produced phycocyanin through fermentation, with a final yield reaching 147 mg / L.

[0008] The use of the above technologies has greatly improved the biosynthesis amount of phycocyanin, but this yield is still difficult to meet the requirements of industrial production. In addition, due to the use of the Escherichia coli expression system, after purifying phycocyanin, there is still a problem of detecting endotoxins. Summary of the Invention

[0009] The purpose of the present invention is to provide a method for modifying Bacillus subtilis to produce phycocyanin to solve the problems raised in the above background art.

[0010] To achieve the above purpose, the present invention provides the following technical solutions:

[0011] A method for modifying Bacillus subtilis to produce phycocyanin, comprising the following steps:

[0012] S1. Preparation of culture medium:

[0013] LB medium comprises 5 g / L of Angel yeast extract powder, 10 g / L of peptone, 10 g / L of sodium chloride, and 10 g / L of agar is added when preparing LB solid medium;

[0014] TB medium comprises 12 g / L of peptone, 24 g / L of yeast extract, 0.4% of glycerol, 2.313 g / L of potassium dihydrogen phosphate, and the glycerol is the product after separate autoclaving;

[0015] Fermentation medium comprises 10 g of yeast powder, 30 g of glycerol, 3 g / L of dipotassium hydrogen phosphate, 1.5 g / L of potassium dihydrogen phosphate, 0.5 g / L of magnesium sulfate, 0.35 g / L of ammonium sulfate, 0.2 g / L of yeast extract powder, 0.2 g / L of manganese sulfate, 0.1 g / L of ferrous sulfate, 0.1 g / L of calcium carbonate;

[0016] S2. Synthesis of key genes for phycocyanin biosynthesis and vector construction

[0017] The ancestral sequences of heme oxygenase Ho1 gene, ferredoxin oxidoreductase gene PcyA and self-cleaving peptide tag T2A are chemically synthesized, and these sequences are loaded into pMATE03 vector to successfully construct pMATE03-HO1-T2A-PcyA vector;

[0018] The heme oxygenase Ho1 gene (YP_214522.1) has a nucleotide sequence as shown in SEQ ID NO.1;

[0019] The ancestral sequence of the ferredoxin oxidoreductase gene PcyA has a nucleotide sequence as shown in SEQ ID NO.2;

[0020] The self-cleaving peptide tag T2A has a nucleotide sequence as shown in SEQ ID NO.3;

[0021] S3. Construction of an efficient cofactor cycle for phycocyanin synthesis

[0022] Under the induction of heme oxidase and ferredoxin oxidoreductase, phycocyanin is successfully produced. However, the step of converting heme to biliverdin is the rate-limiting step and requires the participation of cofactor NADPH. By knocking out the outer membrane channel protein Tolc of Bacillus subtilis and introducing the nad gene, the cofactor cycle is accelerated and the production of phycocyanin is increased.

[0023] Preferably, the successfully constructed pMATE03-HO1-T2A-PcyA vector is transferred into an expression strain by electroporation to obtain a recombinant strain containing the HO1-T2A-PcyA gene.

[0024] Preferably, the recombinant strain is cultured using LB medium or TB medium.

[0025] Preferably, the recombinant strain is fermented using a fermentation medium and induced with maltose.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] Through computational biology, the present invention synthesized an ancestral sequence of the ferredoxin oxidoreductase gene PcyA, expressed the heterologous synthetic phycocyanin gene using a Bacillus subtilis expression system, and increased the production of phycocyanin by increasing the synthesis of coenzymes. The yield reached 20.42 mg / L in shake flasks; the yield of phycocyanin in the Bacillus subtilis expression system was improved. The use of the Bacillus subtilis expression system simplifies the endotoxin removal step for subsequent purification of phycocyanin, making the purification of phycocyanin safer to use. Description of the Drawings

[0028] Figure 1 It is the plasmid map of the recombinant vector pMAT-HO1-T2A-pcyA of the present invention. Detailed Embodiments

[0029] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0030] A method for modifying Bacillus subtilis to produce phycocyanin:

[0031] The culture medium is as follows:

[0032] LB medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast extract, sterilized at 121 °C for 15 min.

[0033] TB medium: 6 g / L peptone, 5 g / L glycerol, 12 g / L yeast extract, 17 mM potassium dihydrogen phosphate, 72 mM dipotassium hydrogen phosphate, sterilized at 115 °C for 20 min.

[0034] Example 1:

[0035] An emerging technology for generating stable enzymes is ancestral sequence reconstruction (ASR), which is a bioinformatics method for predicting evolutionary ancestors based on a set of homologous sequences.

[0036] Enzymes generated by ASR usually have improved biocatalytic properties, such as enhanced thermal stability, solvent tolerance, and substrate diversity.

[0037] Using pcyA from Synechocystis sp. PCC6803 as a template, sequences with >60% identity were aligned from NCBI by Mafft to construct a library for analyzing ancestral sequences. After obtaining the ancestral sequences, codon optimization was performed using the Bacillus subtilis genome as a model.

[0038] Example 2:

[0039] The full-length gene of heme oxygenase HO-1 (YP_214522.1) from Prochlorococcus phage P-SSM2 was chemically synthesized by Tsingke Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO.1; the ancestral sequence of the ferredoxin oxidoreductase gene PcyA was synthesized, and its nucleotide sequence is shown in SEQ ID NO.2; the self-cleaving peptide tag T2A shown in SEQ ID NO.3 was synthesized. After synthesizing the above sequences, they were inserted into the pMATE03 vector by bridge PCR to successfully construct the pMATE03-HO1-T2A-PcyA vector. The above vector was transferred into the WB600 expression strain by electroporation to obtain the recombinant strain S1 containing the HO1-T2A-PcyA gene. The recombinant strain was cultured in LB medium for flask fermentation. When the recombinant Bacillus subtilis was cultured at 37°C to an OD600 value of 0.6 - 0.8, 3% maltose was added and the culture was continued at 30°C for 24 h. The results of fermentation protein expression detection are shown in the figure. The above recombinant strain was fermented and induced with maltose, and the phycocyanin content reached 14.52 mg / L.

[0040] Example 3:

[0041] Using the genome of B. subtilis 168 as a template, the gene fragment tolc-1 with a length of the first 500 bp of the outer membrane channel protein was amplified with primers tolc-1-F / tolc-1-R and kan-F / kan-R respectively, and the kanamycin resistance gene fragment kan was amplified; the two fragments were ligated using overlap PCR technology, and it was detected by 1% agarose gel electrophoresis that a specific electrophoresis band appeared at about 2000 bp, which was consistent with the theoretical value of 2002 bp, that is, the two fragments were ligated into the tolc-1-kan fragment. The gel-extracted fragment was digested with BamHⅠ restriction enzyme, and then the digested amyE-1-kan fragment was transformed into B. subtilis WB600 by the above-mentioned electrotransformation method, plated, positive clones were picked, the kan gene fragment was verified by PCR, and it was detected by 1% agarose gel electrophoresis that a specific electrophoresis band appeared at about 1500 bp, which was consistent with the theoretical value of 1502 bp, indicating that the outer membrane channel protein tolc was successfully knocked out from the genome of B. subtilis WB600 by single crossover, and the recombinant strain S2 was obtained.

[0042] Example 4:

[0043] Using the above-mentioned Bacillus subtilis with the outer membrane protein Tolc knocked out as the chassis strain, the pMATE03-HO1-T2A-PcyA vector was introduced by electrotransformation to construct the recombinant strain S3. The recombinant strain was fermented in a shake flask using TB medium. When the recombinant Bacillus was cultured at 37 °C until the OD 600 value reached 1.2, 3% maltose was added and the culture was continued at 30 °C for 24 h. The above-mentioned recombinant strain was fermented and induced with maltose, and the phycocyanin content reached 20.42 mg / L

[0044] It should be understood that in the development process of any actual implementation, such as in any engineering or design project, a large number of specific implementation decisions can be made. Such development efforts may be complex and time-consuming, but for those ordinary technical personnel who benefit from this disclosure, without excessive experimentation, the development efforts will be a routine work of design, manufacturing and production.

[0045] It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

[0046] SEQ ID NO.1

[0047] HO-1 gene:

[0048] ATGACCGTTGCTGATTTCTCCGTTCAGATCAAAGAAGGTACTAAGAAGAGCCACTCTGCTGCGGAGAACACCAGCTTCGTTGCGAGCTTCTTGCGTGGTGTGGTTTCTAAAGAATCTTACAAAGCGCTGGTTAAAGACCTGTACTACGTTTACCGTACTCTGGAAGAAGAGTTCGAGAAACACAAAGACCATCCGGTTGTAGGTAAACTGTACCTGCCGGAACTGAACCGTGTTAACGCACTGGAACGTGATCTGCGTTTCTACTACGGTCCGATCTGGCGTTCTCTGATCATGCCATCCGAAGCGTGCGCGAACTACGTTTCTCGTATCAAATGCTGCTCTATCGAAGATCCAACTCTGCTGGTTGGTCACCACTACACTCGTTACCTGGGCGACCTGTCTGGTGGTCAGATCTTGAAAGGCATCGCGGAGAAAGCGATGGGTCTGAAAGATGAAGGTCTGTACTTCTACGACTTCGACAAGATCGAGAACGCGAAGAAATACAAAGATGGTTACCGTGCGATTCTGAACGGTCTGGACGTTGACCAGCACCAGGTAGACGCTATCATCGTTGAAGCGAACTACGCGTTCCGTCTGAACATGTATATGTTCGACACCTTGGAAGGTAACTGGTTCCAGTCCCTGATCCAGATGATCTTCGGTTTCATCAAATCTATCTTGAAGAAACGTAAATCCGAA。

[0049] SEQ ID NO.2:

[0050] Pcya ancestral sequence gene:

[0051]

[0052] SEQ ID NO.3

[0053] Self-cleaving peptide tag T2A

[0054] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCA

[0055] Acetyl-CoA synthetase gene:

[0056]

Claims

1. A method for modifying Bacillus subtilis to produce phycocyanin, characterized in that: The following steps are involved: S1. Preparation of culture medium: LB medium includes 5g / L Angel yeast extract powder, 10g / L peptone, 10g / L sodium chloride, and 10g / L agar is added when preparing LB solid medium; The TB culture medium includes 12 g / L of peptone, 24 g / L of yeast extract, 0.4% of glycerol, and 2.313 g / L of potassium dihydrogen phosphate, wherein the glycerol is a product obtained by high-pressure sterilization alone; The fermentation medium includes 10 g yeast powder, 30 g glycerol, 3 g / L dipotassium hydrogen phosphate, 1.5 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.35 g / L ammonium sulfate, 0.2 g / L yeast extract powder, 0.2 g / L manganese sulfate, 0.1 g / L ferrous sulfate, and 0.1 g / L calcium carbonate; S2. Synthesis of key genes for phycocyanin biosynthesis and construction of vectors The pMATE03-HO1-T2A-PcyA vector was constructed by chemically synthesizing the ancestral sequences of the heme oxygenase Ho1 gene, the ferredoxin oxidoreductase gene PcyA, and the self-cleaving peptide tag T2A, and loading these sequences into the pMATE03 vector; The heme oxygenase Ho1 gene (YP_214522.1), the nucleotide sequence is shown in SEQ ID NO.1; The ancestral sequence of the ferredoxin oxidoreductase gene PcyA, the nucleotide sequence is shown in SEQ ID NO.2; The self-cleaving peptide tag T2A, the nucleotide sequence of which is the self-cleaving peptide tag T2A shown in SEQ ID NO.3; S3. Construction of an efficient coenzyme factor cycle for phycocyanin synthesis Under the induction of heme oxidase and ferredoxin oxidoreductase, phycocyanin was successfully produced. However, the step of converting heme to biliverdin is the rate-limiting step and requires the participation of the coenzyme factor NADPH. By knocking out the outer membrane channel protein Tolc of Bacillus subtilis and introducing the nad gene, the coenzyme factor cycle was accelerated and the production of phycocyanin was increased.

2. The method for transforming Bacillus subtilis to produce phycocyanin according to claim 1, characterized in that: The successfully constructed pMATE03-HO1-T2A-PcyA vector was transformed into the expression strain by electroporation to obtain a recombinant strain containing the HO1-T2A-PcyA gene.

3. The method for transforming Bacillus subtilis to produce phycocyanin according to claim 1, characterized in that: The recombinant strain is cultured using LB medium or TB medium.

4. The method for transforming Bacillus subtilis to produce phycocyanin according to claim 1, wherein the recombinant strain is fermented using a fermentation medium and induced using maltose.

Citation Information

Cited By

  • Escherichia coli engineering bacterium with high yield of phycocyanobilin as well as construction method and application of escherichia coli engineering bacterium

    CN121204103A