Use of ddx51 gene in human melanoma and related products

By designing a lentiviral vector that interferes with the DDX51 gene RNA, the proliferation, migration, and metastasis of human melanoma cells were inhibited, and apoptosis was promoted. This filled the gap in the application of the DDX51 gene in the treatment of human melanoma and provided a new treatment approach.

CN120193023BActive Publication Date: 2025-10-17LANZHOU UNIV SECOND HOSPITAL +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510300751.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-14
Publication Date
2025-10-17
Estimated Expiration
2045-03-14

AI Technical Summary

Technical Problem

Currently, there is a lack of effective application of the DDX51 gene in the treatment of human melanoma, resulting in a lack of specific treatment for malignant melanoma and poor prognosis.

Method used

A DDX51 gene RNA interference lentiviral vector was designed to inhibit the expression of the DDX51 gene and prepare an inhibitor to treat human melanoma, including inhibiting cell proliferation, migration, invasion and metastasis, and promoting apoptosis.

Benefits of technology

It effectively inhibits the proliferation, colony formation, migration and metastasis of human melanoma cells and promotes apoptosis, providing a new treatment approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193023B_ABST
    Figure CN120193023B_ABST
Patent Text Reader

Abstract

The application discloses a use of a DDX51 gene in human melanoma and related products. The application takes the DDX51 gene as a template, designs an RNA interference target sequence, and constructs a target gene RNA interference lentivirus vector. RT-PCR detection of the expression of the target gene in target cells, lentivirus infection of the target cells, qPCR detection of the mRNA level DDX51 gene knockdown efficiency, Celigo detection of the influence of the DDX51 gene knockdown on cell proliferation, detection of the influence of the DDX51 gene knockdown on clone formation, Invasion (Transwell with ECM) detection of the influence of the DDX51 gene knockdown on the cell invasion ability, and the like confirm that the interference target gene DDX51 has the effects of inhibiting the proliferation, clone formation, invasion and metastasis of human melanoma cells A375.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine research, and particularly relates to a use of DDX51 gene in human melanoma and related products. BACKGROUND

[0002] Melanoma, usually malignant melanoma, is a highly malignant tumor derived from melanocytes, simply called malignant melanoma, which mainly occurs in the skin and can also be found in the mucosa and internal organs, accounting for about 3% of all tumors. Skin malignant melanoma accounts for about 6.8% to 20% of skin malignant tumors. It is more common in adults, and some patients have familial multiple occurrence. Malignant melanoma can be derived from congenital or acquired benign melanocyte nevus, or from dysplastic nevus, or from new occurrence. In recent years, the incidence and mortality of malignant melanoma have increased year by year, and the age of death is lower compared with other solid tumors. In addition to early surgical resection, malignant melanoma lacks specific treatment and has poor prognosis. Therefore, early diagnosis and treatment of malignant melanoma are extremely important.

[0003] In recent years, DDX gene has been reported to be involved in the occurrence of various tumors, and DDX51, as a new gene in the whole family, is composed of 666 amino acids. However, the relationship between DDX51 and melanoma is still a blank in research. There is no related report on the use of DDX51 gene for the treatment of human melanoma. SUMMARY

[0004] To solve the above technical problems, the present application provides the use of DDX51 gene as a target in the preparation of a human melanoma treatment drug.

[0005] The use of a DDX51 gene inhibitor in the preparation of a product having at least one of the following effects:

[0006] treatment of human melanoma;

[0007] inhibition of the proliferation of human melanoma cells;

[0008] inhibition of human melanoma cell cloning;

[0009] inhibition of the migration ability of human melanoma cells;

[0010] inhibition of the metastasis ability of human melanoma cells;

[0011] inhibition of the invasion ability of human melanoma cells;

[0012] promotion of apoptosis of human melanoma cells;

[0013] inhibition of human melanoma growth.

[0014] The use described above further comprises one or more of the following features:

[0015] The DDX51 inhibitor refers to a molecule having inhibitory effect on DDX51;

[0016] The DDX51 inhibitor is the only effective component or one of the effective components of the product;

[0017] The DDX51 inhibitor is selected from double-stranded RNA, shRNA, antibody or small molecule compound.

[0018] A DDX51 gene RNA interference lentivirus vector, the preparation process of the RNA interference lentivirus vector is: taking DDX51 gene as a template, designing RNA interference target sequence, constructing the target gene RNA interference lentivirus vector, after completing the RNA interference target point design, synthesizing single-stranded DNA oligo containing interference sequence, annealing to produce double-stranded DNA; then directly connecting into the enzyme-digested lentivirus vector through the enzyme-digested sites at both ends; transferring the ligation product into the prepared E. coli competent cells, PCR identification of positive recombinants, sequencing verification, and plasmid extraction of the correct clones after comparing the sequencing results.

[0019] Recombinant sequencing results:

[0020] TTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGtaatAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGGGCCTAACTGTGTCAGAAGGAATTCAAGAGATTCCTTCTGACACAG TTAGGCTTTTTG AATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC

[0021] shRNA interference sequence insertions are marked with underlines, in which the Age I enzyme cutting site is destroyed.

[0022] Preferably, the preparation process of the RNA interference lentivirus vector comprises:

[0023] I. RNA interference target design and double-stranded DNA oligo preparation

[0024] 1. Gene information

[0025]

[0026] 2. RNA interference target design

[0027] According to the RNA interference sequence design principle, a plurality of 19-21 nt RNA interference target sequences are designed with DDX51 gene as a template; after being determined by a design software, the following sequences are selected as interference target points:

[0028]

[0029] 3. DNA oligo sequence synthesis

[0030] According to the shRNA interference sequence designed according to the selected target point sequence, appropriate restriction enzyme cutting sites are added at both ends to complete the vector construction; a TTTTT termination signal is added at the 3' end of the positive strand, and a termination signal complementary sequence is added at the 5' end of the negative strand; after the design is completed, a single-stranded DNA oligo is synthesized by a biological company;

[0031] * CCGG: Age I enzyme cutting site; AATTC: EcoRI enzyme cutting site; G: EcoRI enzyme cutting site complementary sequence.

[0032]

[0033] 4. Double-stranded DNA oligo preparation

[0034] The synthesized single-stranded DNA oligo dry powder is dissolved in annealing buffer, 90°C water bath for 15 min, and then naturally cooled to room temperature to form double-stranded with sticky ends;

[0035] II. Linearized vector preparation

[0036] III. RNA interference lentivirus vector construction

[0037] 1. Ligation

[0038] 2. Transformation

[0039] 3. PCR identification of positive clones

[0040] 4. Positive clone sequencing result analysis

[0041] IV. Plasmid extraction.

[0042] A DDX51 gene RNA interference lentivirus is formed by virus packaging of the above-mentioned DDX51 gene RNA interference lentivirus vector.

[0043] The DDX51 gene RNA interference lentivirus can infect human melanoma A375 cells, so that the expression amount of the DDX51 gene in the A375 cells at the mRNA level is inhibited.

[0044] The DDX51 gene RNA interference lentivirus or the DDX51 gene RNA interference lentivirus is applied to the preparation of a drug for treating human melanoma, or the preparation of a kit for reducing the expression of the DDX51 gene in human melanoma cells.

[0045] Beneficial effects:

[0046] The present application takes the DDX51 gene as a template, designs an RNA interference target sequence, constructs a target gene RNA interference lentivirus vector, and carries out RT-PCR detection of the expression of the target gene in target cells, a lentivirus infection experiment of target cells, qPCR detection of the mRNA level DDX51 gene knockdown efficiency experiment, Celigo detection of the influence of DDX51 gene knockdown on cell proliferation, detection of the influence of DDX51 gene knockdown on clone formation, Invasion (Transwell with ECM) detection of the influence of DDX51 gene knockdown on cell invasion ability, and the like, so as to confirm that the interference of the target gene DDX51 has the effects of inhibiting the proliferation, clone formation, invasion and metastasis of human melanoma cells A375. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 It is a flow chart for RNAi lentivirus cloning;

[0048] Figure 2 It is a GV115 vector map;

[0049] Figure 3 It is an agarose gel electrophoresis picture;

[0050] Figure 4 It is a schematic diagram of RNA interference vector construction and positive clone identification;

[0051] Figure 5 It is a qPCR target gene endogenous expression detection flow chart;

[0052] Figure 6 It is a column chart of the mRNA expression abundance of the target gene in the target cells (the vertical coordinate is ΔCt);

[0053] Figure 7 Figure 1 is a flow chart of RNA interference lentivirus infection of cells;

[0054] Figure 8 Figure 2 is an infection fluorescence picture of the experiment of lentivirus infection of target cells;

[0055] Figure 9 Figure 3 is a flow chart of the experiment of A375 qPCR detection of knockdown efficiency;

[0056] Figure 10 Figure 4 is a comparison chart of mRNA expression abundance after knockdown of target genes;

[0057] Figure 11 Figure 5 is a WB detection of mRNA level DDX51 gene knockdown efficiency;

[0058] Figure 12 Figure 6 is Celigo detection of the influence of DDX51 gene knockdown on cell proliferation;

[0059] Figure 13 Figure 7 is flow detection of the influence of DDX51 gene knockdown on cell apoptosis;

[0060] Figure 14 Figure 8 is MTT detection of the influence of DDX51 gene knockdown on cell proliferation;

[0061] Figure 15 Figure 9 is detection of the influence of DDX51 gene knockdown on colony formation;

[0062] Figure 16 Figure 10 is scratch detection of the influence of DDX51 gene knockdown on cell migration;

[0063] Figure 17 Figure 11 is Migration (Transwell without ECM) detection of the influence of DDX51 gene knockdown on cell metastasis;

[0064] Figure 18 Figure 12 is Invasion (Transwell with ECM) detection of the influence of DDX51 gene knockdown on cell invasion ability. DETAILED DESCRIPTION

[0065] The present application will be further described by the following specific embodiments. It should be clear that the following described embodiments are only a part of the embodiments of the present application, but not all the embodiments of the present application, and the present application is not limited in the scope of the described embodiments.

[0066] Embodiment 1

[0067] DDX51 gene is used as a template to design RNA interference target sequence, and a target gene RNA interference lentivirus vector is constructed.

[0068] The lentivirus cloning procedure is shown in Figure 1

[0069] After the design of the RNA interference target, single-strand DNA oligo containing the interference sequence is synthesized, and double-strand DNA is generated by annealing pairing. Then the lentivirus vector is directly connected to the enzyme-digested lentivirus vector through its two end enzyme digestion sites. The ligation product is transferred into the prepared E. coli competent cells, and the positive recombinants are identified by PCR and verified by sequencing. The plasmid extraction is performed for the correct sequencing results.

[0070] 1. Experimental plasmid

[0071] The GV115 vector is used in this experiment, and the vector map is shown in Figure 2 .

[0072] 2. Experimental strain

[0073] TOP10 E. coli competent cells (TIANGEN, Cat. # CB104-03)

[0074] 3.1 Enzymatic reagents

[0075]

[0076] 3.2 Other reagents

[0077]

[0078] 3.3 Experimental instruments

[0079]

[0080] 4. Preparation of experimental reagents

[0081] 4.1 Annealing buffer (pH = 7.5-8.0)

[0082]

[0083] 4.2 LB liquid medium (100 ml, pH = 7.0)

[0084]

[0085] The content of ampicillin in the LB medium containing ampicillin is 100 μg / ml.

[0086]

[0087] The content of ampicillin in the LB medium containing ampicillin is 100 μg / ml. ​

[0088] I. RNAi target design and double-stranded DNA oligo preparation

[0089] 1. Gene information

[0090]

[0091] 2. RNAi target design

[0092] According to the principle of RNA interference sequence design, multiple 19-21 nt RNA interference target sequences were designed using DDX51 gene as a template. After evaluation and determination by the design software, the following sequences were selected as interference targets.

[0093]

[0094] 3. DNA oligo sequence synthesis

[0095] According to the selected target sequence, shRNA interference sequences were designed, and appropriate restriction enzyme cleavage sites were added at both ends to complete the vector construction. In addition, a TTTTT termination signal was added at the 3' end of the positive strand, and a complementary sequence of the termination signal was added at the 5' end of the negative strand. After design, the single-stranded DNA oligo was synthesized by Jierui Company.

[0096] * CCGG: AgeI cleavage site; AATTC: EcoRI cleavage site; G: EcoRI cleavage site complementary sequence.

[0097]

[0098]

[0099] 4. Double-stranded DNA oligo preparation

[0100] Dissolve the synthesized single-stranded DNA oligo dry powder in annealing buffer (final concentration 20 μM), 90°C water bath for 15 min. After natural cooling to room temperature, double-stranded with sticky ends are formed.

[0101] II. Linearized vector preparation

[0102] Prepare 50 μl reaction system according to NEB instructions, and linearize GV115 vector by using AgeI and EcoRI double enzyme digestion.

[0103]

[0104] 37°C (optimum temperature) reaction for 1 h, then cut the gel to recover the target fragment.

[0105] Electrophoresis loading instructions:

[0106] Lane 1: 1 kb Marker: from top to bottom, 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp;

[0107] Lane 2: vector plasmid linearized by Age I and EcoR I double enzyme digestion;

[0108] Lane 3: vector plasmid without enzyme digestion.

[0109] The agarose gel electrophoresis picture is shown in Figure 3 .

[0110] III. Construction of RNA Interference Lentiviral Vector

[0111] 1. Ligation

[0112] According to the Fermentas T4 DNA Ligase instruction, 20 μl reaction system was prepared, and the double-stranded DNA oligo was ligated with the linearized vector.

[0113]

[0114]

[0115] The reaction was carried out at 16 °C for 1 h-3 h, and the ligation product was named as psc3641, and then the transformation experiment was carried out.

[0116] 2. Transformation

[0117] The ligation product was transformed into E. coli competent cells, and the detailed operation steps were as follows:

[0118] 1) 10 μl of ligation product psc3641 was added into 100 μl of E. coli competent cells, and ice bath was carried out for 30 min.

[0119] 2) 42 °C heat shock for 90 sec, and ice bath for 2 min.

[0120] 3) 500 μL of LB liquid medium without antibiotic was added, and 200 rpm was carried out in a shaking incubator at 37 °C for 1 hr.

[0121] 4) 150 μl of bacterial liquid was evenly smeared on LB solid medium containing Amp, and was cultured in a 37 °C incubator overnight.

[0122] 3. PCR identification of positive clones

[0123] 3.1 Figure 4 is a schematic diagram for RNA interference vector construction and positive clone identification.

[0124] 3.2 Primers

[0125]

[0126] 3.3 PCR amplification

[0127] The 20 μl PCR reaction system was prepared according to the following table, and a single colony was picked up with a sterile gun head as a template for PCR amplification. The reaction conditions were as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, 22 cycles; 72°C for 5 min. After the PCR, 5 μl of the product was taken for 1% agarose gel electrophoresis to detect the band.

[0128]

[0129]

[0130] The clones with correct identification results were preserved and sequenced.

[0131] 4. Analysis of sequencing results of positive clones

[0132] The positive clones were sequenced with the identification primer-F, and the clones with sequencing results completely consistent with the target sequence were selected for the next experiment.

[0133] Sequencing results of psc3641:

[0134]

[0135] The shRNA interference sequence insertion fragment is marked with a lower line, and the Age I enzyme cutting site is destroyed.

[0136] Four, plasmid extraction

[0137] The bacterial liquid with correct sequencing was transferred to 150 ml of LB liquid medium containing Amp antibiotic and cultured overnight at 37°C on a shaking table. The plasmid was extracted according to the EndoFree Maxi Plasmid Kit instructions, and the qualified plasmid entered the downstream process.

[0138] The detailed operation steps are as follows:

[0139] 1. Centrifuge at 8000 rpm for 4 min to collect the bacterial body.

[0140] 2. Add 7 ml P1 and shake well;

[0141] 3. Add 7 ml P3, invert and mix well for 6-8 times, and stand for 5 min;

[0142] 4. Add 7 ml P4, invert and mix well for 6-8 times, and stand for 10 min on ice;

[0143] 5. 9000rpm centrifuge 10min, transfer the supernatant to filter CS, add 10ml isopropanol after filtration, mix well;

[0144] 6. Add 2.5ml of the equilibrium solution BL to the adsorption column, centrifuge at 8000rpm for 2min, discard the waste liquid in the collection tube, and put the column back for standby;

[0145] 7. Pour the supernatant into the adsorption column in two times, centrifuge at 8000rpm for 2min, discard the waste liquid;

[0146] 8. Add 10ml of the rinse solution PW (with the addition of anhydrous ethanol) to the adsorption column, centrifuge at the same speed for 2min, discard the waste liquid, and repeat this step once;

[0147] 10. Add 3ml of anhydrous ethanol to the adsorption column, centrifuge at 8000rpm for 2min, discard the waste liquid;

[0148] 11. 9500rpm air spin for 5min to remove residual rinse solution;

[0149] Transfer the adsorption column to a new white tube, add 800μl of elution buffer TB (preheated) to the center of the column, and stand at room temperature for 5min, then centrifuge at 9500rpm for 2min;

[0150] 12. Transfer the elution solution in the tube to a clean 1.5ml EP tube, and store at -20℃;

[0151] 13. Take samples for electrophoresis, use a spectrophotometer (Thermo_Nanodrop 2000) to determine the plasmid concentration, and perform quality inspection.

[0152] 14. Deliver the qualified plasmid to the downstream platform for virus packaging.

[0153] Objective gene RNAi lentivirus packaging Reference: RNAi lentivirus vector construction and packaging manual of Jikai Gene. Example 2 qPCR detection of endogenous expression of objective gene (1, DDX51 gene expression in melanoma cells)

[0154] I. Experimental purpose:

[0155] In this experiment, the method of Real-time quantitative PCR was used to detect the expression abundance of mRNA of the objective gene in different target cells.

[0156] II. Experimental parameters:

[0157] 1. Gene information

[0158]

[0159] 2. Cell information

[0160]

[0161] 3. Primer information

[0162]

[0163] III. Experimental procedure

[0164] The experimental procedure is shown in Figure 5 , and the specific experimental method is referred to: Real-time PCR experimental method.

[0165] IV. Experimental results

[0166]

[0167] Figure 6 is the column chart of the mRNA expression abundance of the target gene in the target cells (the vertical coordinate is ΔCt). ΔCt = Ct value of the target gene - Ct value of the reference gene, and the relative lower the ΔCt is, the lower the expression abundance of the target gene is:

[0168] When the ΔCt value is ≤12, the expression abundance of the gene in the cell is high;

[0169] When 12 < ΔCt value < 16, the expression abundance of the gene in the cell is medium;

[0170] When the ΔCt value is ≥16, the expression abundance of the gene in the cell is low.

[0171] The QPCR result with ACTB as the reference suggests that the DDX51 gene is highly expressed in the model cells A375, SK-MEL-28, A2058 and SK-MEL-1, and the relative lower the ΔCt is, the lower the expression abundance of the target gene is.

[0172] Example 3 Lentivirus infection of target cells

[0173] Experimental purpose

[0174] In this experiment, lentivirus containing the RNA interference sequence of the target gene was used to perform target cell infection experiment.

[0175] Experimental parameters

[0176] 1. Experimental cell information

[0177]

[0178] 2. Virus information

[0179]

[0180] shCtrl: normal target cells, plus negative control virus infected cell group;

[0181] shDDX51 (PSC3641): normal target cells, plus DDX51 gene shRNA PSC3641 virus infected cell group.

[0182] Figure 7 Flow chart of RNA interference lentivirus infection of cells.

[0183] Experimental results:

[0184] Figure 8 Infection fluorescence picture of lentivirus infection of target cells [original picture].

[0185] Infection result description:

[0186] After 72 hours of lentivirus infection of target cells, fluorescence observation under microscope showed that the cell infection efficiency reached 80%, and the cell state was normal.

[0187] Example 4 qPCR detection of mRNA level DDX51 gene knockdown efficiency

[0188] I. Experimental purpose:

[0189] In this experiment, the expression of mRNA after the knockdown of target gene in cells was detected by real-time quantitative PCR method, so as to judge the interference effect of target.

[0190] II. Experimental parameters:

[0191] 1. Gene information

[0192]

[0193] 2. Cell information

[0194]

[0195] 3. RNA interference target information

[0196]

[0197] 4. Primer information

[0198]

[0199]

[0200] III. Experimental grouping:

[0201]

[0202] IV. Experimental procedure

[0203] Figure 9 Figure is the experimental procedure of A375 qPCR detection of knockdown efficiency.

[0204] V. Experimental results

[0205]

[0206] Figure 10 Figure is a comparison chart of mRNA expression abundance after knockdown of the target gene

[0207] As can be seen from the quantitative PCR results, after shRNA lentivirus infection, the expression of DDX51 gene in the A375 cells of the knockdown experimental group was inhibited at the mRNA level (p<0.05), and the knockdown efficiency reached 60.81%.

[0208] After 3 days of shRNA lentivirus infection, the expression of DDX51 gene in the A375 cells of the experimental group was inhibited at the mRNA level.

[0209] Example 5 WB detection of mRNA level DDX51 gene knockdown efficiency

[0210] As shown in Figure 11 , after 3 days of shRNA lentivirus infection, the expression of DDX51 gene in the A375 cells of the experimental group was inhibited at the protein level.

[0211] Example 6 Celigo detection of the effect of DDX51 gene knockdown on cell proliferation

[0212] As shown in Figure 12 , after 3 days of shRNA lentivirus infection, the cells were plated in a 96-well plate, and the number of A375 cells plated was 2000. Celigo was continuously detected for 5 days, and it was found that the proliferation rate of the A375 cells in the experimental group was significantly inhibited. It is suggested that DDX51 gene is significantly related to the proliferation ability of A375 cells.

[0213] Example 7 Flow detection of the effect of DDX51 gene knockdown on cell apoptosis

[0214] As shown in Figure 13 , after 5 days of shRNA lentivirus infection, it was found that the apoptosis rate of the A375 cells in the experimental group increased significantly. It is suggested that DDX51 gene is significantly related to the apoptosis ability of A375 cells.

[0215] Example 8 MTT detection of the effect of DDX51 gene knockdown on cell proliferation

[0216] As shown in Figure 14As shown in Figure 9, after 3 days of shRNA lentivirus infection, the A375 cells in the experimental group were plated in 96-well plates at a cell plating number of 2000, and continuously detected for 5 days. It was found that the proliferation rate of the A375 cells in the experimental group was significantly inhibited. This indicates that the DDX51 gene is significantly related to the proliferation ability of the A375 cells.

[0217] Example 9 Detection of the Effect of DDX51 Gene Knockdown on Colony Formation

[0218] As shown in Figure 10, after 3 days of shRNA lentivirus infection, the number of cell colonies of the A375 cells in the experimental group was significantly reduced, indicating that the DDX51 gene is significantly related to the colony formation of the A375 cells. Figure 15

[0219] Example 10 Scratch Test of the Effect of DDX51 Gene Knockdown on Cell Migration

[0220] As shown in Figure 11, after 3 days of shRNA lentivirus infection, the migration ability of the A375 cells in the experimental group was significantly inhibited. This indicates that the DDX51 gene is significantly related to the migration ability of the A375 cells. Figure 16

[0221] Example 11 Migration (Transwell without ECM) Test of the Effect of DDX51 Gene Knockdown on Cell Metastasis

[0222] As shown in Figure 12, after 3 days of shRNA lentivirus infection, the invasion ability of the A375 cells in the experimental group was significantly inhibited. This indicates that the DDX51 gene is significantly related to the invasion ability of the A375 cells. Figure 17

[0223] Example 12 Invasion (Transwell with ECM) Test of the Effect of DDX51 Gene Knockdown on Cell Invasion Ability

[0224] As shown in Figure 13, after 3 days of shRNA lentivirus infection, the invasion ability of the A375 cells in the experimental group was significantly inhibited. This indicates that the DDX51 gene is significantly related to the invasion ability of the A375 cells. Figure 18

[0225] Statistical Analysis:

[0226] The column chart represents the average value of three experiments, and the error bar represents the standard deviation (SD).

[0227] *** shCtrl compared with the target gene shRNA lentivirus treatment group, P < 0.001.

[0228] **, shCtrl compared with the target gene shRNA lentivirus treatment group, P < 0.01.

[0229] ​​​​*, shCtrl compared with the target gene shRNA lentivirus treatment group, 0.01

[0230] According to the above experimental results, it is confirmed that the interference target gene DDX51 has the effects of inhibiting the proliferation, clone formation, invasion and metastasis of human melanoma cells A375.

[0231] As can be seen from the above examples, the application provides a new antibacterial peptide CR24, and the screening process, synthesis method, antibacterial activity, safety, antibacterial mechanism and antibacterial application thereof are described. However, it can also be seen that the above examples are only preferred embodiments of the application, and some modifications can be made on the basis of the application. Therefore, improvements and changes made without departing from the spirit and principles of the application should also be considered within the protection scope of the application.

Claims

1. Use of a DDX51 inhibitor in the preparation of a product having at least one of the following effects: Treating human melanoma; Inhibit the proliferation of human melanoma cells; Inhibits human melanoma cell cloning; Inhibits the migration ability of human melanoma cells; Inhibits the metastatic ability of human melanoma cells; Inhibit the invasive ability of human melanoma cells; Promotes apoptosis of human melanoma cells; Inhibits human melanoma growth; The sequence of the DDX51 inhibitor is: .

2. The use according to claim 1, characterized in that Also includes one or more of the following characteristics: The DDX51 inhibitor refers to a molecule that has an inhibitory effect on DDX51; The DDX51 inhibitor is the only active ingredient or one of the active ingredients of the product.

3. Use of a DDX51 gene RNA interference lentiviral vector or a DDX51 gene RNA interference lentivirus in the preparation of a drug for treating human melanoma or a kit for reducing DDX51 gene expression in human melanoma cells; The preparation process of the DDX51 gene RNA interference lentiviral vector is as follows: using the DDX51 gene as a template, designing an RNA interference target sequence, constructing a target gene RNA interference lentiviral vector, after completing the RNA interference target design, synthesizing a single-stranded DNA oligo containing the interference sequence, annealing and pairing to produce a double-stranded DNA; then directly ligating the double-stranded DNA into the lentiviral vector after enzyme digestion through the restriction sites at both ends; transforming the ligation product into prepared Escherichia coli competent cells, identifying positive recombinants by PCR, sending them for sequencing verification, and performing plasmid extraction on clones whose sequencing results are correct; The DDX51 gene RNA interference lentivirus is formed by viral packaging of the DDX51 gene RNA interference lentiviral vector; The sequence of the DDX51 gene RNA interference lentiviral vector is: .

Citation Information

Patent Citations

  • New application of BTF3 interfering in inhibiting proliferation of melanoma cells

    CN107334777A