Application of thiamphenicol in preparation of preparation for resisting porcine Seneca virus
By using the preparations prepared by thylomycin, the problem of lack of effective prevention and control and treatment measures for Seneca virus disease in pigs was solved, and effective inhibition and prevention and treatment of Seneca virus in pigs was achieved.
Patent Information
- Application Number
- CN202510476883.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-06-27
Smart Images
Figure CN120204188A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of the preparation of antiviral agents, and particularly relates to the application of thiamphenicol in the preparation of agents against Seneca virus of pigs. Background Art
[0002] Senecavirus A (SVA), formerly known as Seneca valley virus (SVV), is the only member of the genus Senecavirus in the family Picornaviridae. Senecavirus is a positive single-stranded RNA virus without an envelope. It is a spherical virus particle with a diameter ranging from 26 to 30 nm and icosahedral symmetry.
[0003] Porcine Senecavirus disease is caused by SVA. The main symptoms are vesicular lesions. Vesicles and ulcers appear on the skin or mucous membranes of the snout, muzzle, and coronary band of diseased pigs. In severe cases, it can cause the acute death of newborn piglets. Clinically, this disease is difficult to distinguish from porcine foot-and-mouth disease, vesicular stomatitis, porcine infectious vesicular disease, etc. It can only be identified by laboratory means, which easily causes panic among pig breeding enterprises. This virus has spread widely worldwide, affecting major pig breeding countries such as the United States, Canada, and Thailand. SVA was first introduced into Guangdong Province, China in 2015, and has since been widely prevalent in many provinces and regions of China, causing serious economic losses to the pig farming industry in China. As of 2019, SVA has been prevalent in at least 16 provinces, municipalities, and autonomous regions in China, causing significant economic losses.
[0004] The prevention and control of newly emerging and sudden infectious diseases is a common problem faced worldwide. Porcine Senecavirus disease caused by SVA, as a newly emerging pig disease, has no effective prevention and control technical means. Among them, commercial vaccines and antibodies are still in the development stage, and few research teams have reported on drug research and development. In addition, in recent years, SVA has been constantly evolving, and its strains frequently show genomic variation and recombination phenomena, further hindering the research and development process of effective vaccines. In the prevention and control of animal diseases, chemical drugs have the characteristics of easy use, low price, obvious effect, etc., and can be used in combination with vaccines to prevent the occurrence of diseases. Therefore, the timely research and development of drugs with SVA antagonistic activity is of great research significance for the prevention and treatment of SVA. Summary of the Invention
[0005] The purpose of the present invention is to provide the application of thiamphenicol in the preparation of agents against porcine Senecavirus disease, so as to effectively prevent and treat porcine Senecavirus disease.
[0006] The present invention first provides a use of thiamphenicol, which is used for the preparation of products for preventing and / or treating SVA infection; In another aspect, the present invention also provides a product for preventing and / or treating SVA infection, and the product contains thiamphenicol at a pharmaceutically effective concentration; The pharmaceutically effective concentration, as specifically described in some embodiments, is 10 - 100 μmol / L.
[0007] Preferably, the concentration of thiamphenicol in the preparation is 20 - 80 μmol / L.
[0008] Preferably, the concentration of thiamphenicol in the preparation is 40 - 60 μmol / L.
[0009] Preferably, the preparation is a liquid preparation; Furthermore, the liquid preparation is PBS buffer or DMSO.
[0010] Preferably, the concentration of the PBS buffer is 0.05 - 0.15 mol / L.
[0011] Preferably, the concentration of the PBS buffer is 0.08 - 0.12 mol / L.
[0012] The present invention provides the application of thiamphenicol in the preparation of a preparation for preventing and / or treating SVA infection. The anti - SVA infection effect of thiamphenicol is very significant, which can reduce cell infection caused by SVA, inhibit the adsorption, entry into cells and release stages of SVA, and provides a new component selection for the clinical treatment of porcine Seneca virus disease. Description of the Drawings
[0013] Figure 1 Under a fluorescence microscope, a photo of the effect of thiamphenicol on the infection efficiency of SVA - infected BSR cells; Figure 2 The effect diagram of thiamphenicol on SVA infection on BSR cells; wherein A is the effect of thiamphenicol on SVA infection on BSR cells measured by Western blot; B is the effect of thiamphenicol on SVA infection on BSR cells measured by TCID50; C is the effect of thiamphenicol on SVA infection on BSR cells measured by fluorescence quantitative RT - PCR; Figure 3 The effect diagram of fluorescence quantitative RT - PCR for measuring the adsorption of thiamphenicol on SVA on BSR cells; Figure 4 The effect diagram of thiamphenicol on SVA entry into cells on BSR cells; wherein A is the effect of thiamphenicol on SVA entry into cells on BSR cells measured by Western blot; B is the effect of thiamphenicol on SVA entry into cells on BSR cells measured by fluorescence quantitative RT - PCR; Figure 5It is a diagram showing the effect of thiamphenicol on the replication of SVA in BSR cells; among which, A shows the effect of thiamphenicol on the replication of SVA in BSR cells determined by Western blot; B shows the effect of thiamphenicol on the replication of SVA in BSR cells determined by TCID50; C shows the effect of thiamphenicol on the replication of SVA in BSR cells determined by fluorescence quantitative RT-PCR. Figure 6 It is a diagram showing the effect of thiamphenicol on the assembly and release of SVA in BSR cells; among which, A shows the effect of thiamphenicol on the assembly of SVA in BSR cells determined by fluorescence quantitative RT-PCR, and B shows the effect of thiamphenicol on the release of SVA determined by TCID50. Detailed implementation manners
[0014] The thiamphenicol used in the present invention is a white crystalline powder and odorless. Clinically, it is mainly used for the treatment of infectious diseases such as respiratory tract, urinary tract, and intestinal infections caused by sensitive bacteria such as Haemophilus influenzae, Escherichia coli, and Salmonella spp. The present invention has no special requirements for the source of the thiamphenicol used, and it can be obtained by using conventional commercially available products in the art or by self-preparation.
[0015] The present invention also provides a preparation for preventing and / or treating SVA infection, wherein the concentration of thiamphenicol in the preparation is 10 - 100 μmol / L, preferably 20 - 80 μmol / L, more preferably 40 - 60 μmol / L, and most preferably 50 μmol / L. In the present invention, the drug is preferably a liquid preparation, and the solvent of the drug is preferably PBS buffer or DMSO; when the solvent is PBS buffer, the concentration of the PBS buffer is preferably 0.05 - 0.15 mol / L, more preferably 0.08 - 0.12 mol / L, and most preferably 0.1 mol / L.
[0016] In the present invention, the drug is preferably obtained by dissolving the thiamphenicol in a solvent.
[0017] The present invention will be described in detail below in combination with examples and drawings.
[0018] Example 1 In this example, two thiamphenicol preparations are prepared. One preparation is to dissolve thiamphenicol in 0.1 mol / L PBS buffer, and the concentration of thiamphenicol is 10 mmol / L.
[0019] The other preparation is to dissolve thiamphenicol in DMSO, and the concentration of thiamphenicol is 10 mmol / L.
[0020] To verify the effect of thiamphenicol on the infection efficiency caused by SVA, the specific experimental method is as follows: The BSR cells digested with trypsin were diluted and counted with a nutrient solution containing 10% fetal bovine serum, and seeded into a six-well plate at a concentration of 5×10 5 cells / well, and placed in an incubator at 37°C with 5% CO2. After the cells grew to a density of 80-90% (about 24 h), the cells were washed 3 times with PBS solution, pretreated with empty DMEM and PBS solutions of different concentrations of thiamphenicol (10 μM, 25 μM, 50 μM) for 1 h respectively, then infected with SVA strain (MOI = 1). After 1 h, the medium was changed, and the infection lasted for 24 h with the drug present all the time. The infection situation of the cells was observed under a fluorescence microscope. According to Figure 1 the results shown, thiamphenicol could reduce the green fluorescence produced by SVA, indicating that thiamphenicol might reduce the infection of SVA.
[0021] Example 2 Verify the effect of thiamphenicol on inhibiting its infection activity (Western blot, fluorescence quantitative PCR and TCID 50 assay) during the whole infection cycle of SVA. The specific steps are as follows: 1) Western blot was used to determine the activity of thiamphenicol in inhibiting SVA infection on BSR cells The digested BSR cells were diluted with DMEM nutrient solution containing 10% FBS by volume, and dropped onto a 6-well plate at a concentration of 5×10 5 / well. After the cells adhered to form a monolayer in an incubator at 37°C with 5% CO2 (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, thiamphenicol (50 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM was added, and incubated with BSR cells at 37°C for 1 h. Then the cells were infected with SVA (MOI = 1) in the presence of thiamphenicol at the corresponding concentration (50 μM). After incubating in an incubator at 37°C with 5% CO2 for 1 h, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS and maintained in the presence of thiamphenicol at the corresponding concentration (50 μM), and cultured in an incubator at 37°C with 5% CO2. At 8 h, 12 h, 24 h, and 36 h after infection respectively, the cell supernatant was collected (1 mL was stored at -70°C for preparation of the later TCID50 assay). After washing three times with PBS and sucking out the residual liquid, the cells were lysed with a lysis buffer containing protease inhibitors. After measuring the concentration of the lysis buffer, 5× protein loading was added to collect the cell samples, boiled in a metal bath at 96°C for 15 min, and then detected by Western blot. It was found that thiamphenicol could reduce the expression of SVA VP3 protein( Figure 2 A), confirming that thiamphenicol could reduce the infection of SVA.
[0022] 2) TCID50 was used to determine the activity of thiamphenicol in inhibiting SVA infection on BSR cells BSR cells were diluted with DMEM nutrient solution containing 10% FBS by volume concentration, and added dropwise to a 96-well plate at a concentration of 2×10 4 / well. After placing it in an incubator at 37°C and 5% CO2 until the cells adhered to form a monolayer, they were washed three times with PBS. After sucking out all the residual liquid, the virus supernatant collected in the previous experiment diluted with serum-free DMEM was added. Eight replicates were made for each concentration. After 1.5 h of infection, it was replaced with DMEM containing 2% FBS for maintenance. After 72 h of infection, the cell infection situation was observed until 120 h after infection. It was found that thiamphenicol reduced the virus titer of the SVA-infected supernatant ( Figure 2 B in), confirming that thiamphenicol reduced the infection of SVA.
[0023] 3) Fluorescent quantitative RT-PCR was used to determine the activity of thiamphenicol in inhibiting SVA infection on BSR cells After digestion, BSR cells were diluted with DMEM nutrient solution containing 10% FBS by volume concentration, and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After placing it in an incubator at 37°C and 5% CO2 until the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After sucking out all the residual PBS, thiamphenicol (10 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM was added. After incubating with BSR cells at 37°C for 1 h, the cells were infected with SVA in the presence of thiamphenicol (10 μM). After incubating in an incubator at 37°C and 5% CO2 for 1 h, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance and in the presence of the corresponding concentration of thiamphenicol (10 μM). After culturing in an incubator at 37°C and 5% CO2 for 24 h, it was directly frozen and stored in a -70°C refrigerator. After repeated freezing and thawing 3 times, viral RNA was extracted for detection by real-time fluorescent quantitative RT-PCR method.
[0024] The sequence information of the fluorescent quantitative RT-PCR primers and probes used is as follows: SVA-F CTGCGCTGGGACCGTATCTCA, SVA-R CGCCGCGCCACCTCATT, SVA-P TCGCCGTAAGCGTGCACCGAGACAG.
[0025] The 20 μL reaction system used contained 5×One Step U ＋ Mix 4 μL, One Step U ＋Mix 1 μL, 0.4 μL each of the forward and reverse primers, 0.2 μL of the probe, 14.0 μL of RNase-free water, and 5 μL of the template. The amplification program is reverse transcription at 55 °C for 15 min, pre-denaturation at 95 °C for 2 min 30 s, and the PCR reaction is denaturation at 95 °C for 8 s, annealing at 60 °C for 16 s, for a total of 45 cycles, and fluorescence is read at 60 °C. The results are as Figure 2 shown in C. Thiamphenicol can reduce the SVA nucleic acid copy number, confirming that thiamphenicol reduces SVA infection.
[0026] Example 3: Verification of the effect of thiamphenicol on SVA adsorption After digestion, BSR cells were diluted with DMEM nutrient solution containing 10% FBS and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After being placed in an incubator at 37 °C and 5% CO2 until the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After aspirating the residual PBS, thiamphenicol diluted to the corresponding concentration with 1 mL of serum-free DMEM (10 μM, 25 μM, 50 μM) was added. After incubating with BSR cells at 37 °C for 1 h, it was replaced with cold serum-free DMEM, and SVA was infected at 4 °C in the presence of thiamphenicol at the corresponding concentration (10 μM, 20 μM, 50 μM). After incubating for 1 h, it was washed three times with cold PBS, 1 mL of cold serum-free DMEM was added, and it was frozen in a -70 °C refrigerator. After repeated freezing and thawing three times, viral RNA was extracted for fluorescence quantitative RT-PCR determination. The results are as Figure 3 shown in, and it was found that thiamphenicol reduced the SVA nucleic acid copy number, confirming that thiamphenicol reduced SVA adsorption.
[0027] Example 4: Verification of the effect of thiamphenicol on SVA entry into cells (Western blot and fluorescence quantitative RT-PCR) After digestion, BSR cells were diluted to an appropriate density with DMEM nutrient solution containing 10% FBS at a concentration of 5×10 5The concentration of / holes was added dropwise to a 6-well plate and placed in an incubator at 37°C and 5% CO2. After the cells adhered to form a monolayer (about 24 h), the cells were washed 3 times with PBS. After sucking out the residual PBS, 1 mL of serum-free cold DMEM was added and the cells were infected with SVA (MOI = 10). After incubation at 4°C for 1 h, the cells were washed three times with cold PBS and the residual liquid was sucked out completely. 1 mL of cold DMEM containing 2% FBS and dipotassium glycyrrhizinate at corresponding concentrations (0 μM, 10 μM, 25 μM, and 50 μM) was added. After incubation at 37°C for 1 h, the cells were washed three times with citric acid and then three times with PBS, and the residual liquid was sucked out. Then, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance and placed in an incubator at 37°C and 5% CO2 for culture. After 18 h of infection, cell samples were collected for Western blot and fluorescence quantitative RT-PCR detection. The results are as Figure 4 shown. Thiamphenicol reduced the expression of SVA VP3 protein entering the cells and also reduced the amount of SVA nucleic acid entering the cells, confirming that thiamphenicol decreased the entry level of SVA into cells.
[0028] Example 5: Verification of the effect of thiamphenicol on SVA replication (Western blot, TCID50, fluorescence quantitative RT-PCR) BSR cells were digested and diluted to an appropriate density with DMEM nutrient solution containing 10% FBS, and added dropwise to a 6-well plate at a concentration of 5×10 5 / holes. It was placed in an incubator at 37°C and 5% CO2. After the cells adhered to form a monolayer (about 24 h). The cells were washed three times with PBS solution. After sucking out the residual PBS, 1 ml of empty DMEM containing SVA virus (MOI = 1) was added. After incubation at 37°C for 1 h, the cells were washed three times with PBS. 2 ml of DMEM (containing 2% serum) containing 10 μmol / L, 25 μmol / L, and 50 μmol / L thiamphenicol was added to the cells. After incubation at 37°C for 12 h, Western blot, TCID50, and fluorescence quantitative RT-PCR detections were performed respectively. The results are as Figure 5 shown. It was found that thiamphenicol did not reduce the expression of SVA VP3 protein, did not reduce the SVA nucleic acid copy number and virus titer, confirming that thiamphenicol could not inhibit SVA replication.
[0029] Example 6: Verification of the effect of thiamphenicol on SVA assembly and release (Western blot, TCID50, fluorescence quantitative RT-PCR) Different cell plates were used to culture BSR cells until they reached confluence. After infecting BSR cells with SVA (MOI = 1) at 37 °C for 1 h, the cells were washed 3 times with PBS and the residual liquid was blotted dry. Then, 2% DMEM medium containing 0 μmol / L, 10 μmol / L, 25 μmol / L, and 50 μmol / L reboxetine mesylate was co-incubated with the cells for 12 h, approximately one viral replication cycle. The supernatant was collected for later use. The cells were added with 1 mL PBS and repeatedly frozen and thawed 3 times, and then the solution was collected. During one replication cycle, when the viral assembly and release mechanisms are normal, the virus titers and nucleic acid ratios in the supernatant and cells should be basically constant. The ratio of the SVA virus titers in the supernatant to that in the cells was detected by TCID50, and the ratio of the SVA nucleic acid copy numbers in the supernatant to that in the cells was detected by fluorescence quantitative RT-PCR. The results are as follows Figure 6 As shown in A, thiamphenicol could not reduce the SVA nucleic acid ratio in the extracellular and intracellular compartments, indicating that thiamphenicol could not inhibit the SVA assembly process. Figure 6 As shown in B, thiamphenicol reduced the titer ratio of SVA in the extracellular and intracellular compartments, confirming that thiamphenicol could inhibit the release of SVA.
[0030] In summary, the present invention found that thiamphenicol could reduce the titer ratio of SVA in the extracellular and intracellular compartments, and had the effect of inhibiting the release of SVA, thereby being able to effectively prevent and treat the infection of Seneca Valley virus in pigs.
Claims
1. A use of thiamphenicol, characterized in that: The use is for preparing products for preventing and / or treating SVA infection.
2. The use according to claim 1, characterized in that The product is a liquid preparation.
3. A product for preventing and / or treating SVA infection, characterized in that: The product contains thiamphenicol at a pharmacologically effective concentration.
4. The product according to claim 3, characterized in that The pharmacologically effective concentration is 10-100 μmol / L.
5. The product according to claim 3, characterized in that The pharmacologically effective concentration is 20 to 80 μmol / L.
6. The article according to claim 3, characterized in that The pharmacologically effective concentration is 40-60 μmol / L.
7. The article according to claim 3, characterized in that The product is a liquid preparation added with thiamphenicol.
8. The article according to claim 3, characterized in that The liquid preparation is PBS buffer or DMSO.
9. The article according to claim 8, characterized in that The concentration of the PBS buffer is 0.05-0.15 mol / L.
10. The article according to claim 8, characterized in that The concentration of the PBS buffer is 0.08-0.12 mol / L.