Preparation of human CD56 immune bacteriophage display antibody library

Abstract

The invention discloses preparation of a human CD56 immune phage display antibody library, which comprises the following steps: S1, animal immunization: expressing recombinant hCD56 protein in escherichia coli, then immunizing a Balb / c mouse, and detecting immune titer; s2, splenocyte preparation: extracting RNA (Ribonucleic Acid) of immune mouse spleen cells, and performing reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid); s3, preparation of an initial bacteriophage display library: amplifying a heavy chain variable region and a light chain variable region by using a PCR technology, and then assembling to form scFv; constructing scFv phagocytids, electrically transforming the scFv phagocytids into TG1 competent cells, and constructing a bacterial library; s4, constructing a phage single-chain library of the hCD56: infecting the bacterial library by using a helper phage M13K07, and constructing a phage single-chain antibody library; and S5, elutriation and screening of a phage library: specifically enriching a phage single-chain antibody library, screening positive clones from the phage single-chain antibody library, and determining a sequence. According to the invention, the human hCD56 antibody scFv sequence fragment can be screened out, and the research and development period is shortened.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to the preparation of a human CD56-immunized phage display antibody library. Background Art

[0002] CD56 is a neural cell adhesion molecule (NCAM), which is involved in processes such as neuron adhesion, neurite fasciculation, and neurite growth. At the same time, CD56 is a cell surface glycoprotein, mainly expressed in natural killer cells (NKs), and has multiple immunoglobulin superfamily domains and glycosylation sites, which are involved in cell-cell interactions and signal transduction. It is anchored to the cell membrane through a transmembrane region and has an intracellular tail that participates in intracellular signal transduction. The expression of CD56 is related to the invasiveness and prognosis of certain tumors, making it an important marker for tumor diagnosis and treatment research.

[0003] Phage display technology was first established by Smiths in 1985. Its principle is to insert the DNA sequence of an exogenous protein or polypeptide into an appropriate position of the phage coat protein structural gene, so that the exogenous gene is expressed. At the same time, the exogenous protein is displayed on the surface of the phage along with the reassembly of the phage. Subsequently, the target molecule protein is coated, and non-specific phages are washed away through the panning process. Then, the bound phages are eluted with a competing molecule, and the eluted phages are used to infect Escherichia coli for amplification. After 4-5 rounds of enrichment and panning processes, the proportion of phages that can specifically recognize the target molecule is gradually increased, and finally, polypeptides or proteins that recognize the target molecule are obtained.

[0004] In order to obtain high-affinity hCD56 antibodies, we propose the preparation of a human CD56-immunized phage display antibody library. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for preparing a human CD56-immunized phage display antibody library to solve the problems in the prior art.

[0006] To achieve the above purpose, the present invention provides the following technical solution: A method for preparing a human CD56-immunized phage display antibody library, comprising the following steps:

[0007] S1. Animal immunization: Recombinant hCD56 protein is expressed in Escherichia coli and then used to immunize Balb / c mice, and the immune titer is detected.

[0008] S2. Preparation of spleen cells: RNA of spleen cells of immunized mice is extracted and reverse transcribed into cDNA.

[0009] S3. Initial phage display library preparation: Amplify the heavy chain variable region and the light chain variable region using PCR technology, and then assemble them to form scFv; construct scFv phagemid and electrotransform it into TG1 competent cells to construct a bacterial library;

[0010] S4. Construction of phage single-chain library of hCD56: Infect the bacterial library with helper phage M13K07 to construct a phage single-chain antibody library;

[0011] S5. Panning and screening of phage library: Specifically enrich the phage single-chain antibody library, screen out positive clones from it, and determine the sequences;

[0012] S6. Recombinant antibody expression;

[0013] S7. Detection by flow cytometry.

[0014] Preferably, the animal immunization in S1 specifically includes: Dilute the purified recombinant his-hCD56 (1 mg / ml) to 0.4 mg / mL, take an equal volume mixture with water-soluble rapid adjuvant, and inoculate 6 six-week-old Balb / c female mice at multiple points in the leg muscles, with the antigen dosage being 20 μg / mouse; Inject again after 21 days, with the immunization amount being the same as the first time; Before extracting spleen cell RNA, perform an immune boost by intraperitoneal injection of recombinant hCD56 without adjuvant.

[0015] Preferably, the preparation of spleen cells in S2 specifically includes: Determine the titer of the immune mouse serum using the indirect ELISA method. When the titer of hCD56 antibody in the serum reaches 16000, boost the immunization with recombinant hCD56 once; After 3 days, collect blood from the mouse's eyeball, place the blood at 37 °C for 0.5 h, at 4 °C for 1 h, centrifuge at 4000 rpm for 5 min, and use the separated serum as positive serum; Sacrifice the mouse, soak and disinfect it with 75% alcohol for 5 min, then take out the spleen under sterile conditions and grind it on a 70 μm cell sieve; Wash the obtained spleen cells 2 times with DMEM culture medium (1000 rpm, centrifuge for 8 min), then resuspend the cells with 20 mL DMEM culture medium and count.

[0016] Preferably, the preparation of the initial phage display library in S3 specifically includes: extracting the RNA of the spleen cells of immunized mice, reverse transcribing it into cDNA, amplifying the heavy chain variable region (VH) and light chain variable region (VL) fragments by the following sequence pairing amplification, assembling them into SCFV through linker connection, performing double digestion on the phagemid and scFv after recovering the gel by agarose gel electrophoresis, then ligating with T4 DNA ligase to construct the scFv phagemid, finally electrotransforming and coating the ligation product on a solid agar plate, screening the bacterial library using bacterial resistance, calculating the library capacity and positive recombination rate of the library by gradient dilution and coating plates, collecting the bacterial library, adding 50% glycerol at a ratio of 1:1, and storing it at -80°C, which is the primary phage display library.

[0017] Preferably, the construction of the phage single-chain library of hCD56 in S4 specifically includes: inoculating the initial phage display library into 200 mL of 2×YT resistant medium, culturing it at 37°C with shaking until the logarithmic phase; adding helper phage according to the multiplicity of infection (MOI) = 20:1, infecting at 37°C for 1 h; centrifuging at 4°C and 5000 r / min for 25 min, discarding the supernatant; resuspending the precipitate with 200 mL of resistant medium, culturing overnight at 37°C, then centrifuging at 4°C and 9500 r / min for 35 min, sucking the supernatant, adding pre-cooled PEG / NaCl, mixing by inverting up and down, standing overnight at 4°C, then centrifuging at 4°C and 9500 r / min for 35 min, discarding the supernatant; resuspending the precipitate with 2 mL of PBS, taking 10 μL to measure the library capacity of the antibody library, and aliquoting the remaining antibody library and storing it at -80°C for later use.

[0018] Preferably, the phage library panning and screening in S5 specifically includes: adding the antigen with a concentration of 100 μg / mL (the antigen concentration is sequentially reduced in subsequent rounds) to the enzyme-linked immunosorbent assay (ELISA) plate, 100 μL per well, and coating it overnight at 4°C. Washing 3 times with PBST, adding 2% BSA, 300 μL per well, and blocking for 2 h at 37°C, then washing 3 times with PBST. While blocking the ELISA plate, mixing the antibody library with an equal volume of 2% BSA and blocking for 1 h at 37°C. Adding the blocked phage antibody library, 100 μL per well, and incubating at 37°C for 1 h. Washing the ELISA plate 10 times each with PBST and PBS successively, adding the elution buffer, 100 μL per well, and gently shaking on a horizontal shaker for 30 min. Terminating the elution, collecting the eluate into a sterile centrifuge tube. Taking 10 μL of the phage library after elution to measure the library capacity, and infecting the remaining phage library with host bacteria, then amplifying it through reproduction for the next round of screening and elution. After 5 rounds of "adsorption - elution - amplification", the hCD56 antibody scFv protein is obtained, and the selected clone is sequenced to obtain the scFv sequence.

[0019] Preferably, the recombinant antibody expression in S6 specifically includes constructing a recombinant scFv plasmid, transfecting the plasmid into HEK293 cells for secretory expression, collecting the supernatant for purification after 5 - 7 days of cell expression; performing affinity chromatography on the supernatant using a protein A column, rinsing with 1×PBs for about 10 column volumes, and then eluting with glycine to collect the antibody, which is aliquoted into small tubes and stored frozen.

[0020] Preferably, the flow cytometry detection in S7 specifically includes the following steps:

[0021] S71: Take a 1.5 mL centrifuge tube, add 1×106 cells to each tube, add 1 mL PBS, centrifuge at 500g for 10 min at 4°C, and discard the supernatant;

[0022] S72: Use a live / dead dye to stain for 15 min in the dark;

[0023] S73: Add 200 uL PBS and centrifuge at 500g for 8 min, and discard the supernatant.

[0024] S74: Stain each tube of cells with flow antibodies and mix well (add 5 ul of PE - CD56 antibody to 100 uL of 2% FBS) and incubate for 15 min in the dark on ice;

[0025] S75: Terminate the reaction with 200 uL of FACS buffer (PBS 2% FBS), centrifuge at 500g for 8 min, and carefully discard the supernatant;

[0026] S76: Resuspend the cells with 200 uL of FACS buffer;

[0027] S77: Perform detection on the machine.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: It can screen out the scFv sequence fragment of the human - derived hCD56 antibody, shorten the R & D cycle, and then obtain the hCD56 antibody with high affinity through antibody protein recombination and flow cytometry verification. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The drawings are used to provide a further understanding of the present invention, and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention, but do not constitute a limitation to the present invention. In the drawings:

[0030] Figure 1 is the flow cytometry verification result diagram of the hCD56 antibody before sorting of the present invention;

[0031] Figure 2 is the flow cytometry verification result diagram of the hCD56 antibody after sorting of the present invention;

[0032] Figure 3It is the flow cytometry verification result diagram of the purity hCD56 antibody of the present invention;

[0033] Figure 4 It is the comparative diagram of the flow cytometry verification results of the hCD56 antibody of the present invention. Specific embodiments

[0034] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the claimed present invention, but merely represents selected embodiments of the present invention.

[0035] Please refer to Figures 1-4 , in an embodiment of the present invention, the preparation of a human CD56 immunophage display antibody library includes the following steps:

[0036] S1. Animal immunization: The recombinant hCD56 protein is expressed in Escherichia coli and then immunizes Balb / c mice to detect the immune titer;

[0037] S2. Preparation of spleen cells: Extract the RNA of the spleen cells of the immunized mice and reverse transcribe it into cDNA;

[0038] S3. Preparation of the initial phage display library: Use PCR technology to amplify the heavy chain variable region and the light chain variable region, and then assemble them into scFv; construct an scFv phagemid and electrotransform it into TG1 competent cells to construct a bacterial library;

[0039] S4. Construction of the phage single-chain library of hCD56: Use the helper phage M13K07 to infect the bacterial library to construct a phage single-chain antibody library;

[0040] S5. Phage library panning and screening: Specifically enrich the phage single-chain antibody library, screen out positive clones from it, and determine the sequences;

[0041] S6. Recombinant antibody expression;

[0042] S7. Flow cytometry detection.

[0043] Preferably, the animal immunization in S1 specifically includes: diluting the purified recombinant his-hCD56 (1 mg / ml) to 0.4 mg / mL, taking an equal volume mixture with a water-soluble rapid adjuvant, and inoculating 6 six-week-old Balb / c female mice at multiple points in the leg muscles. The antigen inoculation dose is 20 μg / mouse; after 21 days, inject again with the same immunization dose as the first time; before extracting spleen cell RNA, perform an immune boost by intraperitoneal injection of recombinant hCD56 without adjuvant.

[0044] Preferably, the preparation of spleen cells in S2 specifically includes: using the indirect ELISA method to measure the titer of the serum of immunized mice. When the titer of the hCD56 antibody in the serum reaches 16000, boost the immunization with recombinant hCD56 once; after 3 days, collect blood from the mouse's eyeballs, place the blood at 37 °C for 0.5 h, at 4 °C for 1 h, centrifuge at 4000 rpm for 5 min, and use the separated serum as positive serum; sacrifice the mouse, soak and disinfect it with 75% alcohol for 5 min, then take out the spleen under sterile conditions and grind it on a 70 μm cell sieve; wash the obtained spleen cells twice with DMEM culture medium (1000 rpm, centrifuge for 8 min), then suspend the cells with 20 mL of DMEM culture medium and count.

[0045] Preferably, the preparation of the initial phage display library in S3 specifically includes: extracting the RNA of spleen cells from immunized mice, reverse transcribing it into cDNA, amplifying the heavy chain variable region (VH) and light chain variable region (VL) fragments by the following sequence pairing amplification, assembling them into SCFV through linker connection, cutting and recovering the gel by agarose gel electrophoresis, then performing double digestion on the phagemid and scFv, and then ligating them with T4 DNA ligase to construct the scFv phagemid. Finally, electrotransform the ligation product and coat it on a solid agar plate, screen the bacterial library using bacterial resistance, and calculate the library capacity and positive recombination rate of the library by gradient dilution and plating. After collecting the bacterial library, add 50% glycerol at a ratio of 1:1 and freeze it at -80 °C, which is the primary phage display library.

[0046] Preferably, the construction of the phage single-chain library of hCD56 in S4 specifically includes: inoculating the initial phage display library into 200 mL of 2×YT resistant medium, and culturing it at 37 °C with shaking until the logarithmic phase; adding helper phage according to the multiplicity of infection (MOI) = 20:1, and infecting at 37 °C for 1 h; centrifuging at 4 °C and 5000 r / min for 25 min, and discarding the supernatant; resuspending the precipitate with 200 mL of resistant medium, culturing it overnight at 37 °C, then centrifuging at 4 °C and 9500 r / min for 35 min, sucking the supernatant, adding pre-cooled PEG / NaCl, mixing it by inverting up and down, standing at 4 °C overnight, then centrifuging at 4 °C and 9500 r / min for 35 min, and discarding the supernatant; resuspending the precipitate with 2 mL of PBS, taking 10 μL to measure the library capacity of the antibody library, and aliquoting the remaining antibody library and storing it at -80 °C for standby.

[0047] Preferably, the phage library panning and screening in S5 specifically includes: adding an antigen with a concentration of 100 μg / mL to the enzyme-linked immunosorbent assay (ELISA) plate (the antigen concentration is sequentially decreased in subsequent rounds), 100 μL per well, and coating overnight at 4°C. Wash three times with PBST, add 2% BSA, 300 μL per well, and block at 37°C for 2 h, then wash three times with PBST. While blocking the ELISA plate, mix the antibody library with an equal volume of 2% BSA and block at 37°C for 1 h. Add the blocked phage antibody library, 100 μL per well, and incubate at 37°C for 1 h. Wash the ELISA plate 10 times each with PBST and PBS successively, add the elution buffer, 100 μL per well, and gently shake on a horizontal shaker for 30 min. Terminate the elution, collect the eluate into a sterile centrifuge tube. Take 10 μL of the phage library after elution to determine the library capacity, and the remaining phage library is used for the next round of screening and elution after infecting the host bacteria and multiplying and amplifying. After 5 rounds of "adsorption - elution - amplification", the hCD56 antibody scFv protein is obtained, and the selected clone is sequenced to obtain the scFv sequence.

[0048] Preferably, the recombinant antibody expression in S6 specifically includes constructing a recombinant scFv plasmid, transfecting the plasmid into HEK293 cells for secreted expression, collecting the supernatant for purification 5 - 7 days after cell expression; performing affinity chromatography on the supernatant using a protein A column, rinsing with 1×PBs for about 10 column volumes, and then eluting and collecting the antibody with glycine, and aliquoting and storing in small tubes at low temperature.

[0049] Preferably, the flow cytometry detection in S7 specifically includes the following steps:

[0050] S71: Take a 1.5 mL centrifuge tube, add 1×106 cells to each tube, add 1 mL PBS, centrifuge at 500 g at 4°C for 10 min, and discard the supernatant;

[0051] S72: Use a live / dead dye to stain for 15 min in the dark;

[0052] S73: Add 200 μL PBS and centrifuge at 500 g for 8 min, and discard the supernatant.

[0053] S74: Perform flow antibody staining on each tube of cells and mix well (add 5 μL of PE - CD56 antibody to 100 μL of 2% FBS) and incubate on ice in the dark for 15 min;

[0054] S75: Terminate the reaction with 200 μL of FACS buffer (PBS 2% FBS), centrifuge at 500 g for 8 min, and carefully discard the supernatant;

[0055] S76: Add 200 μL of FACS buffer to resuspend the cells;

[0056] S77. Detection on the upper machine.

[0057] The detection results show that the proportion of CD56-positive cells before sorting is 17.81% ( Figure 1 ), and the proportion of positive cells after sorting is 7.62% ( Figure 2 ), and the sorting purity is 82.22% ( Figure 3 ), which can be used for flow cytometry detection and cell sorting ( Figure 4 ).

[0058] Sequence 1 hCD56 antibody scFv

[0059] ATGGCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGTGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAACATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCAGAAACTGGGGCAGCTACTGGTACTTCGATGTCTGGGGCCAAGGCCACGGTCACCGTCTCCTCAGTGGAGGCGGTTCAGGCGGAGGTGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGAGCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAAAAGGTCACCATGACCTGCAGGGCCAGCTCAAGTATAAGTTCCAGTTACTTGCACTGGTACCAGCAGAAGTCAGGCGCTTCCCCCAAACCCTTGATTCATAGGACATCCAACCTGGCTTCTGGAGTCCCAGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCAGCGTGGAGGCTGAAGATGATGCAACTTATTACTGCCAGCAGTGGAGTGGTTACCCATTCACGTTCGGCGCTGGCACCAAGTTGGAAATCAAACGG。

[0060] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Preparation of a human CD56 immune phage display antibody library, characterized in that: The following steps are involved: S1. Animal immunization: The recombinant hCD56 protein was expressed in Escherichia coli, and then Balb / c mice were immunized to detect the immune titer; S2. Preparation of spleen cells: RNA from spleen cells of immunized mice was extracted and reverse transcribed into cDNA; S3. Preparation of initial phage display library: using PCR technology to amplify the heavy chain variable region and light chain variable region, and then assemble to form scFv; constructing scFv phagemid, electrotransforming into TG1 competent cells, and constructing bacterial library; S4. Construction of phage single-chain antibody library of hCD56: Use helper phage M13K07 to infect bacterial library and construct phage single-chain antibody library; S5. Phage library panning and screening: specifically enrich the phage single-chain antibody library, screen out positive clones, and determine the sequence; S6, recombinant antibody expression; S7, flow cytometry detection; The animal immunization in S1 specifically includes: diluting the purified recombinant his-hCD56 to 0.4 mg / mL, mixing it with an equal volume of a water-soluble rapid adjuvant, and inoculating six 6-week-old Balb / c female mice at multiple points in the leg muscles, with an antigen dose of 20 μg / mouse; injecting again 21 days later, with the same immunization dose as the first time; and before extracting spleen cell RNA, intraperitoneally injecting recombinant hCD56 without an adjuvant for immune shock.

2. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The preparation of spleen cells in S2 specifically includes: using an indirect ELISA method to determine the titer of the serum of immunized mice, and when the titer of hCD56 antibodies in the serum reaches 16,000, recombinant hCD56 is used for boosting immunization once; 3 days later, blood is collected from the mouse eyeball, the blood is placed at 37°C for 0.5h, 4°C for 1h, and centrifuged at 4000rpm for 5min, and the separated serum is used as positive serum; the mouse is killed, and after being soaked and disinfected in 75% alcohol for 5min, the spleen is removed under sterile conditions and placed on a 70μm cell sieve for grinding; the obtained spleen cells are washed twice with DMEM culture medium, and the cells are suspended with 20mL DMEM culture medium and counted.

3. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The preparation of the initial phage display library in S3 specifically includes: extracting RNA from spleen cells of immunized mice, reverse transcribing it into cDNA, amplifying heavy chain variable region and light chain variable region fragments by sequence pairing amplification, assembling to form scFv by linker connection, double enzyme digestion of phagemid and scFv after gel excision and recovery by agarose gel electrophoresis, and then connecting and constructing scFv phagemid by T4 DNA ligase, and finally electroporating the connection product to coat solid agar plate, screening by bacterial resistance to obtain a bacterial library, and calculating the library capacity and positive recombination rate by gradient dilution and coating, and freezing and storing the bacterial library at -80°C after adding 50% glycerol in a 1:1 ratio after collecting the bacterial library, which is the primary phage display library.

4. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The construction of the hCD56 phage single-chain library in S4 specifically includes: taking the initial phage display library and inoculating it into 200mL 2×YT resistance culture medium, shaking and culturing at 37°C to the logarithmic phase; adding helper phage according to the multiplicity of infection (MOI) = 20:1, and infecting at 37°C for 1h; centrifuging at 4°C and 5000r / min for 25min, and discarding the supernatant; resuspending the precipitate with 200mL resistance culture medium, culturing at 37°C overnight, and then centrifuging at 4°C and 9500r / min for 35min, aspirating the supernatant, adding pre-cooled PEG / NaCl, mixing by inversion, standing at 4°C overnight, and then centrifuging at 4°C and 9500r / min for 35min, and discarding the supernatant; resuspending the precipitate with 2mL PBS, taking 10μL to determine the antibody library capacity, and the remaining antibody library was packaged and stored at -80°C for use.

5. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The panning and screening of the phage library in S5 specifically includes: adding 100 μg / mL antigen to the ELISA plate, 100 μL / well, and coating at 4°C overnight; washing with PBST 3 times, adding 2% BSA, 300 μL / well, blocking at 37°C for 2 hours, and washing with PBST 3 times; while blocking the ELISA plate, taking the antibody library and mixing it with an equal volume of 2% BSA, blocking at 37°C for 1 hour; adding the blocked phage antibody library, 100 μL / well, and incubating at 37°C for 1 hour ; Wash the ELISA plate 10 times with PBST and PBS respectively, add elution solution, 100 μL / well, and shake slowly on a horizontal shaker for 30 minutes; stop elution and collect the eluate into a sterile centrifuge tube; take 10 μL of the eluted phage library to determine the library capacity, and the remaining phage library is used for the next round of screening and elution after infecting the host bacteria and then multiplying and amplifying. After 5 rounds of "adsorption-elution-amplification", the hCD56 antibody scFv protein is obtained, and the clone is selected for sequencing to obtain the scFv sequence.

6. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The recombinant antibody expression in S6 specifically includes constructing a recombinant scFv plasmid, transfecting the plasmid into HEK293 cells for secretory expression, collecting the supernatant for purification after 5-7 days of cell expression; using a protein A column to perform affinity chromatography on the supernatant, washing 10 columns with 1×PBs, and then eluting with glycine to collect the antibody, and then dispensing it into small tubes for freezing.

7. The preparation of a human CD56 immune phage display antibody library according to claim 1, characterized in that: The flow cytometry detection in S7 specifically comprises the following steps: S71. Take 1 × 106 cells in a 1.5 mL centrifuge tube, add 1 mL PBS, centrifuge at 500 g for 10 min at 4 °C, and remove the supernatant. S72, use dead and live dye, stain for 15 minutes in the dark; S73. Add 200uL PBS and centrifuge at 500g for 8min, then discard the supernatant. S74. Each tube of cells was stained with flow cytometry antibodies and mixed thoroughly, and incubated on ice in the dark for 15 min; S75, 200uL FACS buffer to terminate the reaction, centrifuge at 500g for 8min, and carefully remove the supernatant; S76, add 200uL FACS buffer to resuspend the cells; S77, on-machine testing.

Images