Rice herbicide-resistant gene and application thereof

Abstract

The invention belongs to the technical field of herbicide resistance genes, and relates to a rice herbicide resistance gene and application thereof. The herbicide-resistant gene provided by the invention is OsCYP704A5, and the sequence of the herbicide-resistant gene is as shown in SEQ ID NO. 1. According to the application disclosed by the invention, molecular docking analysis is carried out on the OsCYP704A5 gene and the triazole sulcotrione, and the result shows that the OsCYP704A5 and the triazole sulcotrione have relatively high combining capacity and have a certain promoting effect on detoxification metabolism. The OsCYP704A5 gene is further over-expressed in Nipponbare rice, so that the transgenic rice can obtain the drug resistance to triazole sulcotrione. The HPPD inhibitor herbicide-resistant rice strain can be used for cultivating HPPD inhibitor herbicide-resistant rice varieties, and provides a new possibility for researching HPPD inhibitor herbicide resistance of paddy field weeds (barnyard grass).

Description

Technical Field

[0001] The present invention belongs to the technical field of herbicide resistance genes, and relates to a rice herbicide-resistant gene and its application. Background Art

[0002] As a major food crop in China, the production mode of rice is undergoing a transformation from traditional transplanting to direct seeding cultivation, which is accompanied by a significant increase in the degree of agricultural mechanization and the continuous expansion of the planting area. However, weeds, as one of the key biological factors affecting rice yield, their management has become a major challenge in agricultural production. Currently, chemical herbicides have become the main means of weed control due to their high efficiency, rapidity, and simplicity. Nevertheless, the long-term and large-scale use of herbicides has led to an increase in weed resistance, and this problem is becoming increasingly serious globally.

[0003] In recent years, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor herbicides have received extensive attention due to their low resistance risk. Triazosulfuron (QYR301), as a new type of HPPD inhibitor herbicide, belongs to pyrazolinone chemicals and is mainly used for the control of weeds in the middle and late stages of paddy fields. This herbicide is rapidly converted into the active metabolite HDT in plants, showing good herbicidal effects. However, during the use of these herbicides, they also have varying degrees of impact on rice growth, and currently, no ideal method for enhancing rice herbicide resistance has been reported. Summary of the Invention

[0004] The present invention proposes a novel rice herbicide-resistant gene and its application in view of the problems existing in the use of traditional herbicides.

[0005] In order to achieve the above object, the present invention is implemented by the following technical solutions: The target gene proposed by the present invention is derived from Nipponbare rice. Specifically, a herbicide tolerance gene is provided, which provides a candidate gene for the cultivation of herbicide-tolerant rice varieties, and contributes to the effective control of barnyard grass, the sustainable development of agriculture, and food security.

[0006] The herbicide-resistant gene proposed by the present invention is OsCYP704A5 , and its sequence is shown in SEQ ID NO.1.

[0007] The present invention proposes the application of a substance overexpressing the OsCYP704A5 gene in the cultivation of rice varieties with enhanced resistance to triazosulfuron.

[0008] Furthermore, the present invention proposes the application of a reagent or kit for detecting the expression level of the OsCYP704A5 gene in rice in detecting the resistance level of rice to triazosulfuron. OsCYP704A5The increase in gene expression indicates enhanced resistance of rice to triazosulfuron.

[0009] Furthermore, the present invention provides the application of a reagent or kit for detecting the level of OsCYP704A5 gene expression in rice in screening herbicides for weed control in rice and investigating the dosage. For example, it can be used to detect whether a rice paddy is suitable for control with triazosulfuron and the effective dosage of triazosulfuron for control, etc.

[0010] Furthermore, the present invention provides the application of a substance overexpressing the OsCYP704A5 gene in cultivating rice varieties with enhanced resistance to HPPD herbicides.

[0011] Furthermore, the present invention provides the application of a reagent or kit for detecting the level of OsCYP704A5 gene expression in rice in detecting the level of resistance of rice to HPPD herbicides.

[0012] Compared with the prior art, the advantages and positive effects of the present invention are as follows: The present invention verified that expressing the OsCYP704A5 gene in WAT11 yeast can endow transgenic yeast with resistance to triazosulfuron. Further, through molecular docking analysis of the OsCYP704A5 gene and triazosulfuron, it was shown that the OsCYP704A5 gene has a high binding ability with triazosulfuron and has a certain promoting effect on detoxification metabolism. Further, overexpressing the OsCYP704A5 gene in Nipponbare rice can endow transgenic rice with resistance to triazosulfuron. The OsCYP704A5 gene provided by the present invention can be used for cultivating rice varieties resistant to HPPD inhibitor herbicides, providing new possibilities for studying the mechanism of resistance of weeds (barnyard grass) in rice paddies to HPPD inhibitor herbicides, detecting weed resistance, and determining the application period and dosage of the herbicide. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is OsCYP704A5 Gel electrophoresis diagram of the PCR product of the

[0014] Figure 2 is the single enzyme digestion gel electrophoresis diagram of the PESC-TRP Expression Vector.

[0015] Figure 3 is OsCYP704A5 the sensitivity of transgenic yeast expressing the

[0016] Figure 4 A is the WB development image of the thermal shift of the OsCYP704A5 protein; Figure 4B is the thermal shift melting temperature curve of the OsCYP704A5 protein.

[0017] Figure 5 A is the three-dimensional structure of the OsCYP704A5 protein; Figure 5 B and C are the binding model of the OsCYP704A5 protein with HDT 3D and the characteristics of the substrate binding pocket; Figure 5 D is the RMSD value in molecular dynamics simulation.

[0018] Figure 6 is the sensitivity of transgenic OsCYP704A5 gene rice to tritosulfuron. Specific embodiments

[0019] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be noted that, without conflict, the embodiments of the present application and the features in the embodiments can be combined with each other.

[0020] Many specific details are set forth in the following description in order to fully understand the present invention. However, the present invention can also be implemented in other ways different from those described herein. Therefore, the present invention is not limited to the limitations of the specific embodiments disclosed in the following specification. Unless otherwise specified, all operations in the following embodiments are conventional operations in the field of biological genetic engineering, and the percentage of substances not otherwise specified refers to the mass fraction.

[0021] Example 1 1. Construction of the cloning vector 1.1 Select the seeds of the rice resistant variety Nipponbare that are uniform and plump, soak them in warm water at 30 - 40 °C for 12 hours, then transfer them to a 9 cm petri dish lined with double-layer filter paper, add appropriate deionized water to keep the filter paper moist in the petri dish, and transfer the petri dish to a light incubator for germination. The light incubator is set with the following culture conditions: 25 / 20 °C (day / night), 12-hour light-dark alternation. When the seeds germinate to about 0.5 cm, select the germinated seeds with consistent growth and place them in a plastic culture pot with a diameter of 12 cm. The soil used for plant cultivation is the soil without a history of herbicide application in the teaching experimental base farm of Shandong Agricultural University. The seeding rate is 10 plants per pot. When the seedlings grow to the 3 - 4 leaf stage, keep 5 plants with uniform growth in each pot.

[0022] 1.2 Use the FastPure ® Plant Total RNA Isolation Mini Kit (purchased from Nanjing Novozymes Biotech Co., Ltd.) to extract the total RNA of Nipponbare rice leaves according to the method steps in its instruction manual. And take 1 μL of the Nipponbare rice total RNA extraction sample and measure its OD under an ultra-micro spectrophotometer260 and OD 280 The ratio of; After mixing 2 μL of the total RNA extraction sample of Nipponbare rice with 2 μL of 10x DNA loading buffer (Novizan), ddH2O (Beyotime) was added to make up to 20 μL, and the integrity of the RNA extracted from Nipponbare rice was detected by agarose gel electrophoresis.

[0023] 1.3 According to the instructions attached to the All-in-One First-Strand Synthesis MasterMix kit (purchased from Jiangsu Yugong Biotechnology Co., Ltd.), the obtained high-quality RNA was reverse transcribed into cDNA: Using 1 μg of total RNA as a template and Oligo (dT) 20 VN (Yugong Biology) as a primer, prepare the reaction system. Incubate at 37 °C for 2 min, incubate at 55 °C for 5 min. After the reaction, quickly place the obtained cDNA on ice and store it at -20 °C for later use.

[0024] 1.4 Using the obtained cDNA as a template, use the following sequences as primers (synthesized by Shanghai Bioengineering Co., Ltd.): Forward: ATGGGAGAAGATGGCGGC; Reverse: TCATCTCGCCATAGCCGTCAG.

[0025] Use Phanta ® Max Super-Fidelity DNA Polymerase (purchased from Nanjing Novizan Biotech Co., Ltd.) to amplify the full length of the gene. The total volume of the amplification reaction system is 50 μL, including: 25 μL of 2×PhantaMax Master Mix (Novizan), 2 μL of the forward primer dissolved in ddH2O (10 μmol·L -1 ), 2 μL of the reverse primer dissolved in ddH2O (10 μmol·L -1 ), 4 μL of template DNA, 17 μL of ddH2O. The PCR reaction conditions are: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 65 °C for 15 s, extension at 72 °C for 60 s, for a total of 34 cycles; final extension at 72 °C for 5 min.

[0026] 1.5 After the PCR reaction, the amplification products were detected by 1% agarose gel electrophoresis and observed in the ultraviolet gel imaging system. The results are as Figure 1As shown, the 1548bp band was excised and recovered and purified using the FastPure Gel DNA Extraction Mini Kit (purchased from Nanjing Novoprotein Scientific Inc.). The purified target fragment was quantified using a ultra-micro spectrophotometer (Thermo Fisher, NanoDrop One) for the construction of the cloning vector.

[0027] 2. Construction of a recombinant cloning vector containing Nipponbare rice OsCYP704A5 gene 2.1 The recovered and purified product obtained in step 1.5 was ligated to the cloning vector TA / Blunt-Zero using the 5 min TA / Blunt-Zero Cloning Kit (purchased from Nanjing Novoprotein Scientific Inc.). Ligation reaction system: 1μL 5 × TA / Blunt-Zero Cloning Mix (Novoprotein), 2μL OsCYP704A5 gene purified product, 2μL ddH2O. Ligation reaction conditions: React at 25°C for 5 min. After the reaction, place the centrifuge tube on ice for later use.

[0028] 2.2 Take DH5α competent cells (Novoprotein) and place them on ice to thaw. When the competent cells are in an ice-water mixture state, add 10μL of the ligation product obtained in step 2.1, and gently tap the bottom of the centrifuge tube with your hand to mix well. Let it stand on ice for 25 min; heat shock in a 42°C water bath for 45 s, quickly place it on ice and let it stand for 2 min; add 700μL of antibiotic-free LB sterile liquid medium (MDBio, Inc), mix well, and shake the bacteria at 37°C and 200 rpm for 1 h; centrifuge the incubated bacterial solution at 5000 rpm for 1 min, discard 900μL of the supernatant, gently pipette the remaining bacterial solution to resuspend it, and spread it on an LB sterile solid medium (MDBio, Inc) plate containing 50 mg·L -1 ampicillin, and invert the plate and place it in a 37°C incubator for overnight culture.

[0029] 2.3 After colonies grow on the plate, pick single colonies for PCR verification. The PCR primers, reaction system, and amplification conditions are the same as in step 1.4. Inoculate the verified positive clones into an LB sterile liquid medium containing 50 mg·L -1Cultured in LB sterile liquid medium containing ampicillin; 1 mL of the overnight cultured bacterial solution was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were analyzed by alignment using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). After verification, the alignment analysis with the NCBI database sequence showed that the cloned gene was OsCYP704A5 with 100% similarity to the Nipponbare rice, and the positive bacterial solution determined by sequencing was preserved for the construction of the expression vector.

[0030] 3. Bacterial solution culture 3.1 The recombinant expression vector selected was pYeDP60 Expression Vector, and the restriction enzyme site selected was KpnI. The following sequence primers (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) were used: Forward: TGACCGGATCCCCGGGTACCATGGGAGAAGATGGCGGC; Reverse: CGGAATTCGAGCTCGGTACCTCATCTCGCCATAGCCGTCAGA.

[0031] Using the correctly sequenced bacterial solution obtained in step 2.3 as a template, Phanta ® Max Super-Fidelity DNA Polymerase (Vazyme) was used to amplify OsCYP704A5 the full-length gene with homologous arms. The reaction system and amplification conditions were the same as in step 1.4. The PCR product was subjected to agarose gel electrophoresis, and then the target fragment was recovered using a gel recovery kit and quantified using a ultra-micro spectrophotometer (NanoDrop One).

[0032] 3.2 pYeDP60 Expression Vector was digested with LightNing KpnI endonuclease (purchased from Jiangsu Yugong Biotechnology Co., Ltd.). The reaction system was prepared on ice according to the following loading order: 15 μL of ddH2O, 2 μL of 10×CutOne TM Buffer (Yugong Biotech), 2 μL of pYeDP60 plasmid (up to 1 μg), LightNing TM KpnI 1 μL. Gently pipette and mix well, centrifuge instantaneously, incubate at 37° for 15 min, incubate at 80° for 20 min, and the product was loaded onto the electrophoresis and recovered. The restriction enzyme gel electrophoresis pattern is as Figure 2 .

[0033] 3.3 The recovered product of the target gene was used to construct the expression vector according to the instructions of the ClonExpress II One Step Cloning Kit C112 (purchased from Nanjing Novoprotein Scientific Co., Ltd.). The reaction system was as follows: 60 ng of the PCR product obtained in step 3.1 (0.02 × the number of base pairs of the inserted fragment), 130 ng (0.04 × the number of base pairs of the cloning vector) of the product of digesting pYeDP60 Expression Vector in step 3.2, 4 μL of 5×CE ll buffer (Novoprotein), 2 μL of Exnase (Novoprotein), and 20 μL of ddH2O. The reaction mixture was gently pipetted and mixed well, and then briefly centrifuged to collect the reaction solution at the bottom of the tube. The reaction was carried out at 37 °C for 30 min. After the reaction, the centrifuge tube was placed on ice.

[0034] 3.4 Take the DH5α competent cells and melt them on ice. When the cells were in the state of ice-water mixture, add 10 μL of the ligation product obtained in step 3.3. The transformation procedure was the same as that in step 2.2. Take 1 mL of the overnight culture broth and send it to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing. The sequencing primers used were the primers in step 3.1. Use DNAMAN 9.0 to OsCYP704A5 Compare the gene sequencing results with the gene sequences obtained from the transcriptome sequencing data of Nipponbare rice. The results showed that the sequences were identical.

[0035] 4. Transformation 4.1 Take 5 ml of the overnight culture in step 3.4 and use the FastPure ® Plasmid Mini Kit (purchased from Nanjing Novazon Biotech Co., Ltd.) to extract the plasmid. Centrifuge at 10,000 rpm for 1 min. Discard the culture medium, add 250 μl Buffer P1 (Novazon) to the centrifuge tube with the bacterial pellet and mix well, add 250 μl Buffer P2 (Novazon) and mix well by inversion, add 350 μl Buffer P3 (Novazon), and immediately gently invert up and down 8-10 times. Centrifuge at 12,000 rpm for 10 minutes. Place the FastPure DNA Mini Columns adsorption column in the CollectionTube 2 ml collection tube. Transfer the supernatant to the adsorption column and centrifuge at 12,000 rpm for 30 s. Discard the waste liquid. Add 600 μl Buffer PW2 (Novazon) to the adsorption column. Centrifuge at 12,000 rpm for 30 s. Discard the waste liquid, put the adsorption column back into the collection tube, and repeat. Centrifuge at 12,000 rpm for 1 min to dry the adsorption column. Place the adsorption column in a new sterilized 1.5 ml centrifuge tube. Add 100 μl Elution Buffer (Novozyme) to the center of the membrane of the column adsorption column. Let stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min to elute the DNA.

[0036] 4.2 The obtained recombinant expression vector plasmid was transformed into WAT11 yeast (Weidi Biotechnology), and the specific steps are as follows: Place Carrier DNA (Vidi Biotech) in a 95℃ metal bath for 5 min, and then quickly place in ice after heating. Take 2 tubes of WAT11 competent cells (Vidi Biotech) and place them on ice to melt. Add the pre-cooled DNA extracted in step 4.1 in turn. OsCYP704A5 5 µg of recombinant pYeDP60 plasmid, 10 µl of pretreated Carrier DNA, 500 µl of PEG / LiAc (Weidi Biotechnology) were pipetted several times to mix, and placed in a 30°C water bath for 30 min (inverted 8 times at 15 min to mix). The tube was placed in a 42°C water bath for 15 min (inverted 8 times at 7.5 min to mix). Centrifuged at 5000 rpm for 40 s, discarded the supernatant, resuspended in 400 µl of ddH2O, centrifuged for 30 s, and discarded the supernatant. Resuspended in 50 µl of ddH2O, plated (select SD / -Trp-deficient plates), and cultured at 29°C for 48 h. Pick a single colony and inoculate it into SD / -Trp-deficient liquid medium for culture.

[0037] 4.3 Yeast rapid lysis buffer was used to lyse Saccharomyces cerevisiae, and the lysate was used as a PCR template. The product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification, and the sequencing results were analyzed by sequence alignment using DNAMAN 9.0 software. The results showed successful transformation.

[0038] 5. Examine the sensitivity of WAT11 yeast with the OsCYP704A5 gene in 4.3 to triazosulfuron and HDT 5.1 Weigh accurately 55.9 mg of triazosulfuron technical (Qingyuan Nongguan), dissolve it with 10 mL of dimethyl sulfoxide (DMSO) to prepare a 10 mM stock solution, and then pipette 1.25 mL of the stock solution and add it before the sterilized SD / -Ura defective solid yeast medium (Coolaber) solidifies to make 25 mL of SD / -Trp defective yeast solid medium with a final concentration of 500 μM of triazosulfuron and HDT. Among them, HDT (Qingyuan Nongguan) is the active ingredient of triazosulfuron, and triazosulfuron is rapidly absorbed and hydrolyzed to HDT in plants.

[0039] 5.2 Inoculate the OsCYP704A5 single colonies of WAT11 with successful gene transformation and the single colonies of WAT11 with empty vector into 20 mL of SD / -Ura defective liquid yeast medium (Coolaber), and culture at 28 °C. When the OD 600 of the bacterial solution = 1, dilute it to OD 600 = 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 , respectively take 5 μL of the bacterial solution and drop it on the SD / -Trp defective yeast solid medium containing 2% galactose (Coolaber) and a final concentration of 500 μM of triazosulfuron and HDT, and analyze the growth of WAT11 yeast and take pictures after culturing at 28 °C for 48 h, with the WAT11 with empty vector as the control. The results are as Figure 3 , Figure 3 In the first row of both culture dishes are the different dilution concentrations of the single colonies with the OsCYP704A5 gene, and in the second row are the different dilution concentrations of the single colonies with empty vector. It can be seen from the figure that under the stress treatment condition of triazosulfuron, the growth of the yeast WAT11 with empty vector is slow, OsCYP704A5 the transformed WAT11 can still grow normally although its growth is inhibited under 500 μM of triazosulfuron and HDT, which indicates that the expression of the target gene OsCYP704A5 enhances the resistance of WAT11 yeast to triazosulfuron. The above results indicate that OsCYP704A5 overexpression can endow yeast with resistance to triazosulfuron.

[0040] 6. Investigation of the Binding and Metabolic Capacity of OsCYP704A5 to HDT 6.1 Expression and purification of the protein. Take the successfully transformed WAT11 yeast strain in step 4.3 and inoculate it into the SD / -Ura defective liquid yeast medium. Culture it at 30 °C until the logarithmic growth phase, and add 2% galactose to induce the expression of OsCYP704A5 protein. Centrifuge to collect yeast cells and wash them with PBS buffer (Thermo Fisher). Use the glass bead disruption method or the ultrasonic disruption method to break the yeast cells. Centrifuge to remove cell debris and collect the supernatant. Use a Ni-NTA affinity chromatography column to purify the His-tagged OsCYP704A5 protein. Elute the target protein with an imidazole gradient. Dialyze the eluted protein into PBS buffer to remove imidazole.

[0041] 6.2 Thermal shift treatment. Divide the purified CYP704A5 protein into two major groups. Add 2 μL of dimethyl sulfoxide (DMSO) to one group, and add HDT (the active ingredient of triazosulfuron) to the other group to a final concentration of 200 μM; use the standardized internal reference GAPDH as the control for CYP704A5. Similarly, add 2 μL of dimethyl sulfoxide (DMSO) to one group and add HDT (the active ingredient of triazosulfuron) to the other group. Incubate the four groups of samples at different temperatures (35 °C, 39.6 °C, 44.5 °C, 50 °C, 54.6 °C, 57.9 °C, 60 °C) for 10 minutes. Immediately cool in an ice bath after incubation and centrifuge at 8000 rpm for 1 min to remove the precipitate. Perform SDS-PAGE electrophoresis on the supernatant to detect the protein content. Use software such as ImageJ to perform quantitative analysis on the SDS-PAGE gel and draw a curve of protein content changing with temperature. Compare the precipitation temperature curves of the DMSO group and the HDT group to analyze the effect of HDT on the thermal stability of the OsCYP704A5 protein.

[0042] The results are as Figure 4 , as can be seen from the figure, as the temperature rises, the content of the OsCYP704A5 protein gradually decreases. Compared with DMSO, the OsCYP704A5 protein after HDT treatment has more protein content at 54.6 °C and 57.9 °C ( Figure 4 A), and its precipitation temperature curve migrates ( Figure 4 B), indicating that triazosulfuron can effectively bind to the OsCYP704A5 protein and enhance the thermal stability of the protein.

[0043] 7. Molecular docking analysis 7.1 The amino acid sequence of OsCYP704A5 is shown in SEQ ID NO.7. Through homology modeling, the protein structure of OsCYP704A5 was predicted using SWISS-MODEL and SVAESv6 (https: / / saves.mbi.ucla.edu / ) for validating the protein structure. The 3D models of triazosulfuron and HDT were generated using ChemOffice Pro version 18.0 and the energy was minimized. Molecular docking experiments were performed on the herbicide molecules in the active site of OsCYP704A5 using AutoDock Vina.

[0044] 7.2 The three-dimensional structure of OsCYP704A5 was obtained through homology modeling and the AlphaFold protein database ( Figure 5 A). The simulated docking results of AutoDock vina showed that OsCYP704A5 had a high affinity for HDT, with a binding energy of -30.92 kcal / mol -1 , and the key amino acid residues involved were MET-116, ALA-312, GLN-456, PRO-387, LEU-388, ASN-390, THR-223 ( Figure 5 BC). Meanwhile, the key cofactor heme in the active center of OsCYP704A5 had a Pi-Alkyl interaction with HDT, and the molecular distance was short ( Figure 5 BC). As shown in Figure 5 D, the molecular dynamics results found that the binding of OsCYP704A5 to HDT was stable, with an RMSD value less than 3.0 Å, and MMPBSA and MMGBSA were -18.74 and -24.24 kcal / mol respectively -1 , indicating that the molecular docking results were reliable and OsCYP704A5 had the protein structure for catalytic degradation of HDT.

[0045] 8. Investigate the sensitivity of rice overexpressing OsCYP704A5 gene to triazosulfuron 8.1 Change the vector transferred into rice to pCAMBIA1390, with the restriction enzyme site being SpeI. The upstream primer is GGTAGATCTGACTAGTATGGGAGAAGATGGCGGC; the downstream primer is TAGCGTTAACACTAGTTCATCTCGCCATAGCCGTCAG. For the remaining steps, refer to 3.1 - 3.4. Introduce this vector into Agrobacterium tumefaciens EHA105 (Vidi Biotechnology) by electroporation. Perform Western blotting analysis using an anti-6×His antibody to verify whether the target protein is effectively overexpressed. Use green fluorescent protein (GFP) as a negative control. Screen successfully transformed plants using a medium containing antibiotics. Select hygromycin-resistant rice calli and culture them in a petri dish containing nutrient solution and hygromycin to obtain proliferated rice calli.

[0046] 8.2 Effects of triazosulfuron on transgenic rice lines with overexpressed genes: Regenerate the overexpressed OsCYP704A5 and GFP rice calli to obtain overexpressed GFP and OsCYP704A5 -OE lines. Propagate the F1 generation through seed harvest, screen individuals containing the transgene, and conduct segregation and analysis. Continuously screen the transgenic lines for multiple generations to ensure stable inheritance of the transgene and continuous manifestation of the overexpression effect. At the three- to four-leaf stage, treat the transgenic seedlings with the herbicide. Spray triazosulfuron on the leaves of the transgenic seedlings at a dose of 2160 g a.i. ha -1 , and place the treated plants in outdoor pots. After 14 days of treatment, conduct visual evaluation.

[0047] The results are as Figure 6 shown. ① is the non-transgenic untreated control group 1, ② is the non-transgenic control group 2 treated with 2160 g a.i.ha -1 triazosulfuron, and ③ and ④ are the overexpressed -1 gene lines CYP704A5OE-1 and CYP704A5OE-2 treated with 2160 g a.i. ha OsCYP704A5 triazosulfuron. After application of the drug, the growth of the transgenic lines was hardly affected, while the growth of the non-transgenic control lines was significantly inhibited. Therefore, rice transformed with the P450 gene of rice OsCYP704A5 significantly improved the tolerance to triazosulfuron.

[0048] In summary, the present invention verified that overexpression of the OsCYP704A5 gene in WAT11 yeast and rice can endow transgenic yeast and rice with tolerance to triazosulfuron. The present invention provides a new candidate gene of the triazosulfuron-tolerant P450 family derived from Nipponbare rice; the providedOsCYP704A5 Genes can be used for the cultivation of rice varieties resistant to HPPD inhibitor herbicides, providing new possibilities for studying the mechanism of weed resistance to HPPD inhibitor herbicides, detecting weed resistance, and determining the application period and dosage of herbicides.

[0049] As described above, it is only the preferred embodiment of the present invention, and it is not a limitation of the present invention in other forms. Any person skilled in the art may use the technical content disclosed above to make changes or modifications into equivalent embodiments with equivalent changes and apply them to other fields. However, as long as it does not depart from the technical solution content of the present invention, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A rice herbicide-tolerant gene, characterized in that: The herbicide-tolerant gene is OsCYP704A5 , whose sequence is shown in SEQ ID NO.

1.

2. Overexpression OsCYP704A5 Application of genetic materials in the breeding of rice varieties with enhanced resistance to triazosulfuron.

3. Used to detect OsCYP704A5 The application of a reagent or a kit for detecting the level of gene expression in detecting the resistance of rice to triazosulfuron.

4. Used to detect OsCYP704A5 Application of a reagent or kit for detecting high or low gene expression levels in screening rice weed control agents.

5. Overexpression OsCYP704A5 Application of genetic materials in the breeding of rice varieties with enhanced resistance to HPPD inhibitor herbicides.

6. Used to detect OsCYP704A5 The application of a reagent or a kit for detecting the level of gene expression in detecting the resistance of rice to HPPD herbicides.

Images