Formaldehyde tolerance module based on reactive oxygen species (ROS) removal system and application

Abstract

The invention discloses a formaldehyde tolerance module based on an active oxygen ROS (reactive oxygen species) removal system and application, SodB and KatA are introduced into escherichia coli, and tolerance of cells to formaldehyde is remarkably enhanced. Formaldehyde is used as a toxic intermediate in methanol metabolism, a severe challenge is provided for research of methanol, and introduction of an active oxygen (ROS) removal system has a strong advantage on improvement of methanol assimilation ability. Engineering strains introduced into the ROS removal system show that the methanol assimilation level is obviously superior to that of control bacteria. Under the culture condition of 900mM methanol, the strain consumes about 200mM methanol and 300mM methanol respectively, which are 20 times and 30 times higher than those of a control strain without an ROS removal system respectively. In the efficient methanol assimilation strain, xylose and methanol are additionally added, so that methanol consumption is remarkably promoted.

Description

Technical Field

[0001] The present invention belongs to the fields of microbial genetic engineering and metabolism, and particularly relates to a formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system and its application. Background Art

[0002] The accelerating industrial development has increased the demand for alternative raw materials in many regions to support the production of sustainable fuels and chemicals. Among these raw materials, methanol stands out due to its mature production technology, diverse and abundant sources, and potential as an efficient non-food carbon source for industrial bioprocesses. In addition, the high electron density of each carbon atom in methanol enables the production of higher yields of reducing chemicals, including alcohols, organic acids, and hydrocarbons, when used as a sole or co-carbon source. Methanol is first oxidized to toxic formaldehyde, which enters central carbon metabolism through the assimilation pathway to support growth, while excess formaldehyde is oxidized to carbon dioxide (CO2) through the dissimilation pathway.

[0003] Methanol-assimilating strains include natural and synthetic methanol-utilizing strains. In all methanol-utilizing methylotrophs, the initial step of methanol metabolism is its oxidation to formaldehyde. This reaction is catalyzed by methanol dehydrogenases (MDHs) in methylotrophic bacteria and alcohol oxidases (AODs) in methylotrophic yeasts. Formaldehyde is an important intermediate in methanol metabolism but is highly reactive and toxic due to its non-specific interactions with proteins and nucleic acids. Generally, Bacillus methanolutiligans assimilates formaldehyde through the ribulose monophosphate (RuMP) pathway, while other methylotrophic bacteria absorb formaldehyde through the serine cycle. All methylotrophic yeasts share the same formaldehyde assimilation pathway, i.e., the xylulose monophosphate (XuMP) pathway. Natural methylotrophs have great potential in industrial applications as platforms for synthesizing various compounds, including terpenoids, organic acids, fatty acids, alcohols, and amino acids.

[0004] Due to the insufficient understanding of the metabolic pathways of natural methylotrophs and the difficulties in genetic manipulation, the concept of synthetic methylotrophy has attracted increasing attention. For example, Julia Rohlhill et al. used methanol and yeast extract as carbon sources and regulated the expression of methanol dehydrogenase (Mdh) and RuMP pathway enzymes using a formaldehyde-responsive promoter, thereby enhancing the growth of Escherichia coli. Jia Wang et al. improved the growth rate and methanol dependence of E. coli cells through adaptive laboratory evolution (ALE) using methanol and xylose as carbon sources. Philibert Tuyishime et al. constructed a methanol-dependent Corynebacterium glutamicum strain through a combination of genetic modification and ALE engineering, achieving a 20-fold increase in methanol-dependent growth. Chang-Ting Chen et al. enabled E. coli to use 87 mM methanol and 100 mM xylose as carbon sources through genetic modification and ALE. Hong Yu et al. achieved acetate production in LB medium supplemented with methanol and xylose through an improved serine cycle, consuming a total of 30 mM xylose and 200 mM methanol. However, the methanol assimilation efficiency of these synthetic methylotrophs is still not ideal and cannot effectively support strong strain growth and metabolic engineering applications.

[0005] Notably, two major challenges have been encountered in both types of methylotrophic microorganisms: substrate toxicity tolerance. The metabolic networks of various C1 compounds (such as methane and methanol) exhibit a high degree of conservation. This metabolic similarity is essentially related to the problem of formaldehyde toxicity. The accumulation of formaldehyde causes severe cytotoxic effects and is a fundamental obstacle to the normal growth of these microorganisms. Therefore, it also poses a key limitation to the improvement of substrate utilization efficiency in the methylotrophic system.

[0006] Reactive oxygen species (ROS), including superoxide anion (O2 - ), hydrogen peroxide (H2O2), and hydroxyl radical (OH - ), are by-products of oxygen reduction that can damage DNA, RNA, proteins, and lipids, leading to cell membrane disruption, loss of protein function, inhibition of nucleic acid replication, and mutations. Superoxide dismutase (SOD), catalase (CAT), and peroxidase are three typical reactive oxygen species scavenging systems. SOD catalyzes the dismutation of superoxide to hydrogen peroxide and oxygen (2O2 - +2H +→ H2O2 + O2). Hydrogen peroxide is mainly degraded by catalase or peroxidase. Catalase converts hydrogen peroxide into water and oxygen (2H2O2 → 2H2O + O2). In the KEGG database, catalase is divided into two forms: conventional catalase (K03781) and manganese-dependent catalase (K07217). Formaldehyde can induce the formation of DNA-protein crosslinks, which disrupts cell integrity and function, leading to a synergistic increase in the level of reactive oxygen species, exacerbating oxidative stress, and ultimately triggering apoptosis or necrosis of the cells.

[0007] At present, methylotrophs are still limited in industrial applications. Natural methylotrophs are restricted due to their unclear metabolic background and lack of suitable genetic manipulation tools. For synthetic methylotrophs, due to their low methanol metabolism efficiency, despite many attempted modification strategies, such as pathway engineering design, identification and modification of key enzymes, laboratory adaptation, etc., no significant breakthrough has been achieved. Summary of the Invention

[0008] In view of this, the present invention provides a formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system and its application.

[0009] The present invention first tested the changes in the level of intracellular reactive oxygen species (ROS) of E. coli MG1655 in the presence of different concentrations of formaldehyde. The results showed that the presence of formaldehyde would cause an increase in the intracellular ROS level. Next, the ROS scavenging system was introduced into E. coli MG1655, and superoxide dismutases (SODs) and catalases (CATs) from different sources were tested. It was found that SodB from Klebsiella pneumoniae and KatA from Pseudomonas aeruginosa exhibited the highest formaldehyde tolerance. Next, these two enzymes were co-expressed by ribosome binding site (RBS) engineering, and 8 strains with different combinations were obtained through the RBS library, namely SC1, SC2, SC3, SC4, SC5, SC6, SC7, and SC8. Among them, strains SC4 and SC6 showed better performance than the strains expressing single genes.

[0010] Then, the ROS scavenging modules Kp sodB-RBS4-Pa katA and Kp sodB-RBS6-Pa katA corresponding to strains SC4 and SC6 were introduced into the pta locus of the methanol-assimilating chassis strain E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA, and the methanol-assimilating plasmid pCDF-mdh-hps-phi (pCDF-RuMP) was transferred to obtain the highly efficient methanol-assimilating strains AM1 and AM2. These two strains and the control strain E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaAΔpta / pCDF-RuMP (AM0) were subjected to methanol assimilation tests in baffled flasks under 300 mM, 600 mM, and 900 mM methanol conditions, respectively, to characterize their highly efficient methanol assimilation ability. Further, it was found that the depletion of the auxiliary carbon source might be a factor limiting methanol consumption. By additionally supplementing xylose, the methanol assimilation level of strain AM2 was further enhanced.

[0011] Next, the mechanism of the strain's efficient utilization of methanol was explored and verified. Thus, through C 13 -labeled methanol experiments, the labeling of intracellular metabolites was analyzed to determine that methanol was efficiently incorporated into cell metabolism, verifying that methanol was efficiently metabolized by the cells. The intracellular ROS levels of the methanol-assimilating strains were measured under 600 mM methanol conditions. Consistent with the expected results, the intracellular ROS levels of the highly efficient methanol-assimilating strains were much lower than those of the control strains, indicating that the introduction of the ROS system could reduce the toxicity of toxic intermediates, thereby improving the methanol assimilation efficiency. The levels of the intracellular intermediate metabolite formaldehyde were also measured. Finally, the highly efficient methanol-assimilating strain AM2 was applied to the production of 3-hydroxypropionic acid and triacetic acid lactone, and the production level was much better than that of the control strain.

[0012] The technical solution of the present invention is as follows:

[0013] <First aspect>

[0014] A formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system, including any one of the following three modules:

[0015] A. The formaldehyde tolerance module I based on superoxide dismutase (SOD), including at least one of the genes Bm sodA, Me sodB, Opsod, Ylsod2, and Kp sodB;

[0016] B. The formaldehyde tolerance module II based on catalase (CAT), including at least one of the genes Bm katA, Cn katG, MtkatG, Cb katA, and Pa katA;

[0017] C. SOD-CAT combined formaldehyde tolerance module Ⅲ, including at least one of the genes Bm sodA, Me sodB, Op sod, Ylsod2, Kp sodB, and including at least one of Bm katA, Cn katG, Mt katG, Cb katA, Pa katA.

[0018] In the formaldehyde tolerance module Ⅰ based on superoxide dismutase (SOD), or in the formaldehyde tolerance module Ⅱ based on catalase (CAT), and in the SOD-CAT combined formaldehyde tolerance module Ⅲ based on superoxide dismutase (SOD) and based on catalase (CAT), each gene is driven by the M1-93 promoter for expression.

[0019] The formaldehyde tolerance module is the introduction of heterologous superoxide dismutase (SOD) and catalase (CAT), including the separate introduction of superoxide dismutase (SOD) and catalase (CAT), or the introduction of the combined expression of both.

[0020] The formaldehyde tolerance module Ⅰ based on superoxide dismutase (SOD) and the formaldehyde tolerance module Ⅱ based on catalase (CAT) are respectively integrated into the pta locus of the Escherichia coli E.coli MG1655 genome.

[0021] The SOD-CAT combined formaldehyde tolerance module Ⅲ is integrated into the pta locus of the E.coli MG1655 genome.

[0022] The superoxide dismutase (SOD) includes SodA (Bm sodA) from Bacillus methanolicus, SodB (Me sodB) from Methylorubrum extorquens, Sod (Opsod) from Ogataea polymorpha, Sod2 (Ylsod2) from Yarrowia lipolytica, and SodB (Kp sodB) from Klebsiella pneumoniae.

[0023] The catalase (CAT) includes KatA (Bm katA) from Bacillus methanolicus, KatG (Cn katG) from Cupriavidus necator, KatG (MtkatG) from Methylosinus trichosporium, KatA (Cb katA) from Candida boidinii, and KatA (Pa katA) from Pseudomonas aeruginosa.

[0024] The accession number of the Bm sodA gene is: AIE60752.1

[0025] The accession number of the MesodB gene is: OHV15890.1

[0026] The accession number of the Op sod gene is: KAH3669950.1

[0027] The accession number of the Ylsod2 gene is: QNH86244.1

[0028] The accession number of the Kp sodB gene is: SQC38955.1

[0029] The accession number of the Bm katA gene is: AIE59405.1

[0030] The accession number of the Cn katG gene is: CAJ93856.1

[0031] The accession number of the MtkatG gene is: ATQ70313.1

[0032] The accession number of the Cb CTA1 gene is: BAB69893.1

[0033] The accession number of the Pa katA gene is: AAC03118.1.

[0034] As an embodiment of the present invention, the SOD-CAT combined formaldehyde tolerance module III includes the genes Kp sodB and Pa katA, and ribosome binding site RBS sequences with different expression intensities, and the RBS sequences include at least one of RB1, RBS2, RBS3, RBS4, RBS5, RBS6, RBS7, and RBS8.

[0035] As an SOD-CAT combined formaldehyde tolerance module III of the present invention, it includes the genes Kp sodB and Pa katA, and ribosome binding site RBS sequences with different expression intensities, and the RBS sequences include at least one of RB1, RBS2, RBS3, RBS4, RBS5, RBS6, RBS7, and RBS8.

[0036] The SOD-CAT combined formaldehyde tolerance module III is formed by connecting different RBSs generated by the genes Kp sodB and Pa katA through a ribosome binding site (RBS) library, and the ribosome binding site (RBS) library sequences include RBS1, RBS2, RBS3, RBS4, RBS5, RBS6, RBS7, and RBS8.

[0037] In one embodiment, the nucleotide sequence of RBS1 is as shown in SEQ ID NO.11; the nucleotide sequence of RBS2 is as shown in SEQ ID NO.12; the nucleotide sequence of RBS3 is as shown in SEQ ID NO.13; the nucleotide sequence of RBS4 is as shown in SEQ ID NO.14; the nucleotide sequence of RBS5 is as shown in SEQ ID NO.15; the nucleotide sequence of RBS6 is as shown in SEQ ID NO.16; the nucleotide sequence of RBS7 is as shown in SEQ ID NO.17; the nucleotide sequence of RBS8 is as shown in SEQ ID NO.18.

[0038] Preferably, the formaldehyde tolerance module I based on superoxide dismutase (SOD) includes genes Bm sodA, MesodB, Op sod, Ylsod2, Kp sodB. Each gene is driven by the M1-93 promoter for expression.

[0039] Preferably, the formaldehyde tolerance module II based on catalase (CAT) includes genes Bm katA, CnkatG, MtkatG, Cb katA, Pa katA. Each gene is driven by the M1-93 promoter for expression.

[0040] Preferably, the SOD-CAT combined formaldehyde tolerance module III based on superoxide dismutase (SOD) and based on catalase (CAT) includes one of the Kp sodB-RBS1-Pa katA fragment, Kp sodB-RBS2-Pa katA fragment, Kp sodB-RBS3-Pa katA fragment, Kp sodB-RBS4-Pa katA fragment, Kp sodB-RBS5-Pa katA fragment, Kp sodB-RBS6-Pa katA fragment, Kp sodB-RBS7-Pa katA fragment, Kp sodB-RBS8-Pa katA fragment. Each fragment is driven by the M1-93 promoter for expression.

[0041] The nucleotide sequence of Kp sodB-RBS1-Pa katA: SEQ ID NO.1

[0042] The nucleotide sequence of Kp sodB-RBS2-Pa katA: SEQ ID NO.2

[0043] The nucleotide sequence of Kp sodB-RBS3-Pa katA: SEQ ID NO.3

[0044] The nucleotide sequence of Kp sodB-RBS4-Pa katA: SEQ ID NO.4

[0045] Nucleotide sequence of Kp sodB - RBS5 - Pa katA: SEQ ID NO.5

[0046] Nucleotide sequence of Kp sodB - RBS6 - Pa katA: SEQ ID NO.6

[0047] Nucleotide sequence of Kp sodB - RBS7 - Pa katA: SEQ ID NO.7

[0048] Nucleotide sequence of Kp sodB - RBS8 - Pa katA: SEQ ID NO.8.

[0049] The nucleotide sequence of the M1 - 93 promoter is shown as SEQ ID NO.9.

[0050] Preferably, the SOD - CAT combined formaldehyde tolerance module Ⅲ based on superoxide dismutase (SOD) and catalase (CAT) includes Kp sodB - RBS4 - Pa katA (SEQ ID NO.4) and Kp sodB - RBS6 - Pa katA (SEQ ID NO.6).

[0051] <Second aspect>

[0052] A chassis strain with improved formaldehyde tolerance is obtained by integrating the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system into the Escherichia coli genome.

[0053] In one embodiment, the Escherichia coli is Escherichia coli subspecies E.coli MG1655.

[0054] In one embodiment, the integration site of the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system is the pta target. The nucleotide sequence of pta: SEQ ID NO.10.

[0055] <Third aspect>

[0056] A methanol - assimilating strain is obtained by knocking out frmA, rpiA, rpiB and cyaA in the Escherichia coli genome and integrating the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system at the pta locus.

[0057] The nucleotide sequence of frmA: SEQ ID NO.19

[0058] The nucleotide sequence of rpiA: SEQ ID NO.97

[0059] The nucleotide sequence of rpiB: SEQ ID NO.98

[0060] The nucleotide sequence of cyaA: SEQ ID NO.99.

[0061] The nucleotide sequence of pta: SEQ ID NO.10; the nucleotide sequence of pta (SEQ ID NO.10) contains the complete pta gene, and the specific target cleavage site is SEQ ID NO.96 (GCTGATTCCGCTGCGGCCTT).

[0062] The Escherichia coli is Escherichia coli subspecies E.coli MG1655(DE3)(M).

[0063] Preferably, the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system includes the SOD-CAT combined formaldehyde tolerance module Ⅲ based on Kp sodB and PakatA superoxide dismutase (SOD) and catalase (CAT).

[0064] The SOD-CAT combined formaldehyde tolerance module Ⅲ based on Kp sodB and Pa katA superoxide dismutase (SOD) and catalase (CAT) includes one of the Kp sodB-RBS1-Pa katA fragment, Kp sodB-RBS2-Pa katA fragment, Kp sodB-RBS3-Pa katA fragment, Kp sodB-RBS4-Pa katA fragment, Kp sodB-RBS5-Pa katA fragment, Kp sodB-RBS6-Pa katA fragment, Kp sodB-RBS7-Pa katA fragment, and Kp sodB-RBS8-Pa katA fragment.

[0065] The SOD-CAT combined formaldehyde tolerance module Ⅲ based on superoxide dismutase (SOD) and catalase (CAT) includes Kp sodB-RBS4-Pa katA (SEQ ID NO.4) and Kp sodB-RBS6-Pa katA (SEQ IDNO.6).

[0066] <Fourth aspect>

[0067] Application of the highly efficient methanol-assimilating strain shown in the third aspect in 3-HP synthesis or triacetic acid lactone (TAL) synthesis.

[0068] <Fifth aspect>

[0069] A methanol-assimilating strain for 3-HP synthesis is obtained by using a methanol-assimilating strain as a chassis and introducing a heterologous 3-HP (3-hydroxypropionic acid) pathway.

[0070] In one embodiment, the methanol-assimilating strain is obtained by transforming the methanol-assimilating plasmid pCDF-RuMP in the above methanol-assimilating chassis.

[0071] The present invention also provides a methanol-assimilating strain for TAL synthesis, which is obtained by using a methanol-assimilating strain as a chassis and introducing a heterologous TAL pathway.

[0072] The present invention also protects the application of strains with improved formaldehyde tolerance under other tolerance stress conditions.

[0073] The beneficial effects of the present invention are as follows:

[0074] 1) The present invention provides a series of chassis strains with improved formaldehyde tolerance (such as SC4 and SC6), and the formaldehyde tolerance is characterized by the optical density value of cell growth. Under 1 mM formaldehyde condition, their optical density values OD 600 are 5.1 and 5.6 times higher than those of the control strain E. coli MG1655Δpta respectively; under 1.2 mM formaldehyde condition, their optical density values OD 600 are 11 and 12 times higher than those of the control strain E. coli MG1655Δpta respectively.

[0075] The formaldehyde tolerance modules Kp sodB-RBS4-Pa katA and Kp sodB-RBS6-Pa katA are integrated into the methanol-assimilating chassis strain, and the methanol utilization plasmid pCDF-mdh-hps-phi is transferred to obtain strains, denoted as AM1 and AM2. Under 300 mM methanol condition, strains AM1 and AM2 consume 84 and 103 mM methanol respectively, which are 78% and 119% higher than those of the control strain AM0 (47 mM) respectively; under 600 mM methanol condition, strains AM1 and AM2 consume 106 and 149 mM methanol respectively, which are 2.1 times and 3.4 times higher than those of the control strain AM0 (34 mM) respectively; under 900 mM methanol condition, strains AM1 and AM2 consume 106 and 149 mM methanol 97 and 84 mM methanol respectively, which are 2.1 times and 1.7 times higher than those of the control strain AM0 (31 mM) respectively. Generally speaking, strain AM2 shows a higher methanol assimilation level.

[0076] To better exploit the potential of the engineered strains for methanol utilization, they were cultured in shake flasks for scale-up. Strain AM1 consumed 86 mM methanol, and strain AM2 consumed 111 mM methanol, which were 2.0-fold and 2.8-fold higher than that of the control strain AM0 (29 mM), respectively. Under 600 mM methanol condition, strain AM1 consumed 210 mM methanol, while strain AM2 consumed 238 mM methanol, which were 16.5-fold and 18.8-fold higher than that of the control strain (12 mM), respectively. Under 900 mM methanol condition, strain AM2 showed a higher methanol assimilation level, consuming a total of 291 mM methanol, and strain AM1 consumed 199 mM methanol, which were 31.3-fold and 21.1-fold higher than that of the control strain AM0 (9 mM), respectively. It was observed that under 600 mM and 900 mM methanol conditions, the engineered strains AM1 and AM2 had consumed the auxiliary carbon source xylose at the early stage of cultivation, resulting in a decrease in the optical density value, thus leading to a decrease in methanol utilization efficiency. Therefore, additional xylose was added to maintain the high methanol utilization ability of the engineered strains. The AM2 strain with stronger methanol assimilation ability was selected for testing, and fed-batch cultivation with xylose and methanol was tested under 600 mM and 900 mM conditions. Under 600 mM methanol condition, by adding additional xylose (30 mM per day) from day 2 to day 8, and adding 100 mM methanol on day 5 and day 7 respectively, finally, this strain consumed a total of 159 mM xylose and 485 mM methanol, and the methanol:xylose consumption ratio was 3.1:1. Under 900 mM methanol condition, by adding additional xylose (30 mM per day) from day 2 to day 5, and adding 20 mM xylose on day 8, finally, this strain consumed 164 mM xylose and 433 mM methanol, and the methanol:xylose consumption ratio was 2.6:1.

[0077] Next, to explore the entry of methanol into central carbon metabolism, C 13 -labeled methanol was used for testing. These metabolites showed extensive labeling, with most metabolites labeled with 3 carbon atoms, while some metabolites were labeled with all carbon atoms, indicating that methanol had been fully integrated into the central metabolic pathway. In addition, by measuring the changes in cellular ROS levels of strains AM1, AM2, AM0 and strains AC0, AC1, AC2 without the introduction of the RuMP pathway under 600 mM methanol condition, the results verified that the introduction of the ROS scavenging system enhanced the cell's tolerance to the toxic intermediate metabolite formaldehyde during methanol assimilation, and also showed an improvement in methanol tolerance, thus increasing the methanol assimilation level. The change in cellular formaldehyde levels also positively reflected that the improvement in methanol assimilation ability was due to the increased tolerance to the intermediate formaldehyde and the enhanced tolerance to the substrate methanol.

[0078] Finally, the methanol-assimilating strain with the best effect was applied to the production of 3-hydroxypropionic acid (3-HP) and 3-hydroxybutyrolactone (TAL). In the production of 3-HP, the engineered strain AM2-H produced a total of 787 mg / L during the 6-day fermentation process, which was 30.5 times higher than that of the control strain AM0-H (25 mg / L). In the synthesis of TAL, the strain AM2-T produced 155 mg / L, which was 19.3 times higher than that of the control strain AM0-T (8 mg / L). BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Other features, objects, and advantages of the present invention will become more apparent by reading the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0080] Figure 1 It is a mechanism diagram of the ROS scavenging system;

[0081] Figure 2 It is the tolerance analysis of introducing 5 superoxide dismutases (SODs) and 5 catalases (CATs) into E. coli MG1655, and the change multiples relative to the control strain are shown in the figure; where A is 5 superoxide dismutases SOD; B is catalase (CAT)

[0082] Figure 3 Formaldehyde tolerance test and ROS level determination. Among them, A is the ROS level determination of wild-type E. coli MG1655, B is the tolerance test under 1.0 mM formaldehyde condition for the combined expression of different RBS-regulated Kp sodB and Pa katA, C is the tolerance test of SC4 and SC6 strains under 1.2 mM formaldehyde condition, and D is the ROS level determination of SC4 and SC6 strains;

[0083] Figure 4 It is the methanol assimilation test in a test tube. Among them, A is the schematic diagram of the RuMP pathway plasmid construction, B is the methanol assimilation metabolic pathway, C is the OD of the strain under 300 mM methanol condition 600 , D is the methanol consumption of the strain under 300 mM methanol condition, E is the OD of the strain under 600 mM methanol condition 600 , F is the methanol consumption of the strain under 600 mM methanol condition, G is the OD of the strain under 900 mM methanol condition 600 , H is the methanol consumption of the strain under 900 mM methanol condition;

[0084] Figure 5 It is the methanol assimilation experiment in a shake flask. Among them, A is the highest OD of the strain under 300 mM methanol condition 600 , B is the methanol consumption of the strain under 300 mM methanol condition, C is the highest OD of the strain under 600 mM methanol condition 600, D shows the methanol consumption of the strain under 600 mM methanol condition, and E shows the highest OD of the strain under 900 mM methanol condition. 600 , F shows the methanol consumption of the strain under 900 mM methanol condition.

[0085] Figure 6 is the methanol assimilation fed-batch experiment. Among them, A shows the OD, 600 consumption of xylose and methanol of strain AM2 with additional supplementation of xylose and methanol under 600 mM methanol condition, and B shows the OD, 600 consumption of xylose and methanol of strain AM2 with additional supplementation of xylose under 900 mM methanol condition.

[0086] Figure 7 is the analysis of the metabolic environment and mechanism of methanol assimilation strains. A is the schematic diagram of the entry of strain AM2 C 13 -methanol labeling into the metabolic pathway and the analysis of the labeling situation, B is the determination of the ROS level of methanol assimilation strains, and C is the determination of the cellular formaldehyde level.

[0087] Figure 8 is the fermentation of 3-hydroxypropionic acid (3-HP) and triacetic acid lactone (TAL). Among them, A is the metabolic pathway of 3-HP synthesis, B is the metabolic pathway of TAL synthesis, C is the analysis chart of 3-HP production, and D is the analysis chart of TAL production. Detailed implementation manners

[0088] The following further describes the specific implementation manners of the present invention in combination with embodiments. The following embodiments are used to illustrate the present invention and will help those skilled in the art to further understand the present invention, but are not used to limit the scope of the present invention. It should be noted that those of ordinary skill in the art can make several changes and improvements without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0089] In the following examples:

[0090] Formaldehyde tolerance: The tolerance test of a large number of strains is screened using a 96-well plate. First, prepare the total system in an ep tube, including bacteria with an initial OD 600 of 0.1, MOPS minimal medium and different concentrations of formaldehyde, and then aliquot them into a 96-well plate for continuous kinetic analysis in a microplate reader to monitor OD 600 . The growth status of the strain in the medium containing formaldehyde represents the level of tolerance.

[0091] Detection of methanol and xylose consumption: The fermentation samples were centrifuged to obtain the supernatant, which was filtered through a 0.22 μm filter membrane. All detections were performed using an Agilent 1260 high-performance liquid chromatograph (HPLC), equipped with a refractive index detector (RID) and an Agilent Hi-Plex chromatographic column. The chromatographic conditions were as follows: the mobile phase was 5 mM H2SO4, the temperature of the refractive index detector was 35 °C, the temperature of the chromatographic column was 60 °C, and the flow rate was 0.6 mL / min.

[0092] C 13 -Analysis of intracellular metabolites labeled with methanol: The collected cells were hydrolyzed with 1 mL of 6 N hydrochloric acid at 95 °C for 24 hours. After hydrolysis, the samples were dried at 95 °C and redissolved in 1 mL of deionized water (ddH2O). The small molecule metabolites released during hydrolysis were analyzed by ultra-high performance liquid chromatography (UPLC) using a C18 reverse-phase chromatographic column (Agilent). Mass spectrometry analysis was performed using an Exactive mass spectrometer (Agilent), and the obtained data were processed by MassHunter software (Agilent).

[0093] Analysis of 3-HP and TAL contents: For the analysis of 3-HP, the fermentation samples were centrifuged to obtain the supernatant, which was filtered through a 0.22 μm filter membrane. The analysis was performed using an Agilent 1260 HPLC system equipped with a DAD detector and a Hi-Plex chromatographic column. The analysis conditions were as follows: the mobile phase was 5 mM H2SO4, the UV detection wavelength was 210 nm, the flow rate was 0.6 mL / min, and the temperature of the chromatographic column was maintained at 55 °C. For the analysis of TAL fermentation samples, the supernatant was collected by centrifugation, and then the absorbance was measured at 282 nm and normalized according to the standard curve.

[0094] Analysis of intracellular formaldehyde levels: A mixture of 200 μL of 20% (w / v) trichloroacetic acid, 100 μL of 2,4-dinitrophenylhydrazine, and 500 μL of acetonitrile was added to 2 mL of the collected culture medium. After the samples were shaken well, they were incubated at 60 °C for 30 minutes. After incubation, centrifugation was performed and the supernatant was carefully collected for subsequent HPLC analysis. Then, an Agilent 1260 high-performance liquid chromatography (HPLC) system was used for analysis, equipped with a diode array detector (DAD) and an Agilent C18 reverse-phase chromatographic column. The chromatographic conditions were as follows: the mobile phase was 65% acetonitrile, the detection wavelength was 355 nm, the temperature of the chromatographic column was 35 °C, and the flow rate was 0.3 mL / min.

[0095] Analysis of cellular ROS level: The collected bacterial suspension was centrifuged to remove the supernatant and washed twice with PBS buffer to remove residual formaldehyde or methanol. Then, the cells were resuspended in PBS buffer, and 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) (dissolved in DMSO at a final concentration of 10 μM) was added. The mixture was incubated at 37 °C for 1 hour, followed by centrifugation to remove the supernatant. The cells were washed twice with PBS buffer again and resuspended in PBS buffer for fluorescence measurement at an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

[0096] Methanol assimilation test: All strains for methanol assimilation test were cultured in MOPS medium containing 50 mM xylose, 2% (w / v) casein hydrolysate (Sangon Biotech), different concentrations of methanol, 0.1 mM IPTG was added to induce the expression of plasmid pCDF-RuMP, and at the same time 25 mg / L kanamycin and 50 mg / L spectinomycin were added. The strains were cultured in test tubes or 250 mL baffled shake flasks. During the culture process, samples were collected regularly to measure OD 600 and subsequent analysis and evaluation were carried out. In the fed-batch culture of xylose and methanol, xylose and methanol were added regularly, and the other conditions were the same. In addition, in the C 13 -methanol labeling experiment, methanol was 120 mM C 13 -methanol, and the other conditions were the same. In the fermentation of 3-HP and TAL, an additional 50 mg / L ampicillin antibiotic was added, and xylose was added regularly, and the other conditions were the same.

[0097] Culture media and solutions:

[0098] 2xYT medium: 10 g / L yeast extract, 5 g / L sodium chloride, 16 g / L peptone.

[0099] PBS buffer: Weigh 8 g NaCl, 0.2 g KCl, 1.44 g K2HPO4, 0.24 g KH2PO4, dissolve with 900 ml ddH2O, then make up the volume to 1 L, and adjust the pH to 7.4.

[0100] 40xMOPS stock solution: 40 mM 3-morpholinopropanesulfonic acid, 4 mM N-tris(hydroxymethyl)methylglycine, 0.01 mM FeSO4, 9.5 mM NH4Cl, 0.276 mM K2SO4, 0.5 μM CaCl2, 0.525 mM MgCl2, 50 mM NaCl, 0.292 nM (NH4)2MoO4, 40 nM H3BO3, 3.02 nM CoCl2, 0.962 nM CuSO4, 8.08 nM MnCl2, 0.974 nM ZnSO4 and 1.32 mM K2HPO4.

[0101] Table 1 Strains involved in the present invention

[0102]

[0103]

[0104] Table 2 Primer sequence list involved in the present invention

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111] Table 3 Plasmids used in the present invention

[0112] Name Source pEcCas Purchased from addgene pEcgRNA Purchased from addgene pEcgRNA-pta Constructed in the present invention pEcgRNA-frmA Constructed in the present invention pEcgRNA-rpiA Constructed in the present invention pEcgRNA-rpiB Constructed in the present invention pKD46 Purchased from BioVector pCDF-Duet Purchased from Novagen pCDF-RuMP Constructed in the present invention

[0113] Example 1 Construction and characterization of formaldehyde-tolerant strains

[0114] 1. Effects of formaldehyde on the ROS level of E. coli MG1655 and screening of SOD and CAT from different sources

[0115] Formaldehyde is a highly reactive one-carbon compound with significant cytotoxicity, which can cause serious damage to cellular proteins and nucleic acids and increase the level of intracellular reactive oxygen species (ROS) ( Figure 1 ). To investigate whether formaldehyde causes an increase in the ROS level of E. coli MG1655, the ROS level in E. coli MG1655 under different concentrations of formaldehyde was tested. As the formaldehyde concentration increased, the ROS level of the cells gradually increased. When 1.25 mM formaldehyde was added, the ROS level in the cells was 2.2 times higher than that without formaldehyde addition ( Figure 3 A in ), indicating that formaldehyde toxicity is also accompanied by an increase in the cellular ROS level.

[0116] Through mining the UniProt database, 31 SODs from different sources were identified. Through bioinformatics analysis, these protein sequences showed 42% identity, indicating that these enzymes might exhibit different ROS scavenging effects. Therefore, we selected five SODs from different branches of the phylogenetic tree for characterization, namely SodA from Bacillus methanolicus (Bm sodA), SodB from Methylorubrum extorquens (Me sodB), Sod from Ogataea polymorpha (Op sod), Sod2 from Yarrowia lipolytica (Yl sod2), and SodB from Klebsiella pneumoniae (Kp sodB). Similarly, 34 CATs from different sources were identified. Through bioinformatics analysis, these protein sequences showed 23% identity, indicating that these proteins had low similarity. Five CATs from different sources were characterized for tolerance, namely KatA from Bacillus methanolicus (Bm katA), KatG from Cupriavidus necator (Cn katG), KatG from Methylosinus trichosporium (Mt katG), CTA1 from Candida boidinii (Cb CTA1), and KatA from Pseudomonas aeruginosa (Pa katA).

[0117] The accession number of the Bm sodA gene is: AIE60752.1

[0118] The accession number of the Me sodB gene is: OHV15890.1

[0119] The accession number of the Op sod gene is: KAH3669950.1

[0120] The accession number of the Yl sod2 gene is: QNH86244.1

[0121] The accession number of the Kp sodB gene is: SQC38955.1

[0122] The accession number of the Bm katA gene is: AIE59405.1

[0123] The accession number of the Cn katG gene is: CAJ93856.1

[0124] The accession number of the Mt katG gene is: ATQ70313.1

[0125] The accession number of the Cb CTA1 gene is: BAB69893.1

[0126] The accession number of the Pa katA gene is: AAC03118.1.

[0127] 2. Construction of MG1655Δpta::M1-93-ftsZ

[0128] 2.1 Transformation of the basic plasmid pEcCas into Escherichia coli by heat shock

[0129] Prepare competent cells of Escherichia coli E.coli MG1655(DE3), and transform the plasmid pEcCas into the cells to obtain the recipient bacterium E.coli MG1655(DE3) / pEcCas containing the pEcCas plasmid.

[0130] 2.2 Construction of the pEcgRNA-pta knockout plasmid

[0131] Design primers according to the upstream and downstream sequences of the Escherichia coli pta gene. According to the Escherichia coli genome sequence published on NCBI, find the sequence of phosphoacetyltransferase pta (Accession IDs: EG20173 (EcoCyc)), select the cleavage site N20 (GCTGATTCCGCTGCGGCCTT, SEQ ID NO.96) at the pta locus, and design the bidirectional amplification primers for pEcgRNA whole plasmid PCR, pEcgRNA-pta-up (SEQ ID NO.46), pEcgRNA-pta-down (SEQ ID NO.47), to obtain the pEcgRNA-pta plasmid. The primers are shown in Table 2.

[0132] 2.3 Amplify the upstream homologous arm, downstream homologous arm, and artificial regulatory elements M1-93 and ftsZ replaced by M1-93-ftsZ by PCR. The primers are as follows:

[0133] a) Amplify the upstream homologous arm for ftsZ replacement, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0134] pta-L-up1: SEQ ID NO.89

[0135] pta-L-down: SEQ ID NO.48;

[0136] b) Amplify the artificial regulatory element M1-93, with the template being the synthesized M1-93 sequence (GenScript Biotech Corporation), and the sequence is referenced from the literature (Wenbo Hu et al, 2023):

[0137] M1-ftsZ-up: SEQ ID NO.90

[0138] M1-ftsZ-down: SEQ ID NO.91;

[0139] c) Amplify the ftsZ fragment using the genome of Escherichia coli K-12 substr. MG1655(DE3) as a template:

[0140] ftsZ-up: SEQ ID NO.92

[0141] ftsZ-down: SEQ ID NO.93;

[0142] d) Amplify the downstream homologous arm for ftsZ replacement using the genome of Escherichia coli K-12 substr. MG1655(DE3) as a template:

[0143] pta-R up: SEQ ID NO.22

[0144] pta-R down1: SEQ ID NO.94;

[0145] e) Amplify the Donor DNA-M1-93-ftsZ (the sequence is SEQ ID NO.99) fragment using the homologous recombination product of the above four fragments as a template:

[0146] pta-L up2: SEQ ID NO.20

[0147] pta-R down2: SEQ ID NO.23;

[0148] Use one-step homologous recombination technology to recombine the upstream and downstream homologous arms for ftsZ replacement, M1-93, and the ftsZ fragment; then perform one round of PCR amplification to recover the target fragment to obtain Donor DNA-M1-93-ftsZ. Subsequently, electrotransform the pEcgRNA-pta knockout plasmid and the Donor DNA-M1-93-ftsZ fragment into the recipient bacterium E. coli MG1655(DE3) / pEcCas, and use the CRISPR technology to complete gene replacement, and screen to obtain the engineered bacterium E. coli MG1655(DE3)Δpta::M1-93-ftsZ (i.e., MG1655Δpta::M1-93-ftsZ) that has successfully replaced the artificial element M1-93-ftsZ.

[0149] f) Electrocompetent cells and electrotransformation method:

[0150] (1) Inoculate the strain to be prepared into a liquid LB medium (add appropriate antibiotics if necessary), and culture it at 37°C and 220 rpm / min until the logarithmic phase.

[0151] (2) Inoculate with an inoculum of 0.05 OD into a 250 mL Erlenmeyer flask containing 30 mL of LB medium (add appropriate antibiotics if necessary), and culture at 37°C and 200 rpm / min until the OD 600 reaches 0.3 - 0.5 (add appropriate inducers if necessary).

[0152] (3) Transfer the culture solution into a 50 mL sterile centrifuge tube in a laminar flow hood, and place it on ice for 15 min.

[0153] (4) Centrifuge the bacterial solution in the centrifuge tube at 4°C and 6000 rpm for 10 min.

[0154] (5) Discard the supernatant, add 20 mL of pre-cooled ddH2O, gently resuspend the cells, centrifuge at 4°C and 6000 rpm for 10 min; repeat the operation once again.

[0155] (6) Discard the supernatant, add 20 mL of pre-cooled 10% glycerol, gently resuspend the cells, centrifuge at 4°C and 6000 rpm for 10 min.

[0156] (7) Discard the supernatant, resuspend the cells in 1 mL of pre-cooled 10% glycerol, aliquot 50 - 80 μL of competent cells into 1.5 mL centrifuge tubes, and place them on ice for standby.

[0157] (8) Add the gene fragment or plasmid to be transformed into the competent cells prepared in step (7) above, mix well, and place on ice for 30 min;

[0158] (9) Transfer the mixture into a pre-cooled 1 mm electroporation cuvette, place it on ice for at least 2 min, and wait for electroporation;

[0159] (10) Turn on the electroporator and set the parameters to 2.5 kV;

[0160] (11) Take out the electroporation cuvette from the ice, blot the surface moisture with a tissue paper, put it into the sample chamber for electroporation. Immediately after electroporation, add room temperature LB medium to resuspend the cells, recover at 37°C for 2 h, spread on an LB plate with appropriate antibiotics added, and culture at 37°C overnight;

[0161] 3. Integration of the Kp sodB gene into the E. coli MG1655 genome

[0162] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0163] 3.1. Amplify the upstream homologous arm of pta with the M1-93 promoter

[0164] Primer: pta-L-up2: SEQ ID NO.20

[0165] Z1-M1-Uni-down: SEQ ID NO.21

[0166] Template: MG1655Δpta::M1-93-ftsZ.

[0167] 3.2. Amplify the downstream homologous arm of pta

[0168] Primer pta-R-up: SEQ ID NO.22

[0169] pta-R-down2: SEQ ID NO.23

[0170] Template: MG1655Δpta::M1-93-ftsZ.

[0171] 3.3. Amplify the Kp sodB fragment

[0172] Primer: sodB-F(M1-93): SEQ ID NO.24

[0173] Kp sodB-R(pta): SEQ ID NO.25

[0174] Template: Klebsiella pneumoniae genome, GenBank accession number GCA_000009885.1.

[0175] 3.4. Construction of plasmid pECgRNA-pta

[0176] Design primers according to the upstream and downstream sequences of the Escherichia coli pta gene. According to the Escherichia coli genome sequence published on NCBI, find the sequence of phosphoacetyltransferase pta (Accession IDs: EG20173 (EcoCyc)), select the cleavage site N20 (GCTGATTCCGCTGCGGCCTT, SEQ ID NO.96) at the pta locus, and design the bidirectional amplification primers for pEcgRNA whole plasmid PCR, pEcgRNA-pta-up (SEQ ID NO.46), pEcgRNA-pta-down (SEQ ID NO.47), to obtain the pEcgRNA-pta plasmid. The primers are shown in Table 2.

[0177] 3.5. Obtaining the DonorDNA of Kp sodB

[0178] The pta upstream homologous arm, Kp sodB fragment, and pta downstream homologous arm were sequentially ligated using the Beyotime seamless assembly reagent to obtain the Donor DNA of Kp sodB (pta-up-Kp sodB-pta-down).

[0179] 3.6 Integration of Kp sodB gene and plasmid elimination

[0180] First, the commercial pECcas9 (Addgene catalog number 73227) was electrotransformed into E. coli MG1655 to obtain E. coli MG1655 / pECcas9, and competent cells were prepared. Next, the above-mentioned Donor DNA of Kp sodB (pta-up-KpsodB-pta-down) and pEcgRNA-pta were co-electrotransformed into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification and sequencing analysis were performed. Correct transformants were selected for plasmid elimination. Specifically: The cells were cultured in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, then transferred to liquid LB medium without any antibiotics and continued to be cultured for ~2 h. 10 μl of the cells were spread and inoculated on an LB plate containing 10 g / L sucrose to isolate single colonies. Single colonies were picked and sequentially transferred to LB plates, LB plates containing Kan, and LB plates containing Spe to screen for colonies. Colonies that grew only on the LB plate were positive engineering colonies that had eliminated pEcgRNA and pEcCas, namely the M-P1 strain.

[0181] 4. Integration of Ylsod2 gene into the E. coli MG1655 genome:

[0182] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0183] 4.1 Amplification of the pta upstream homologous arm with the M1-93 promoter

[0184] Primers: pta-L-up2: SEQ ID NO.20

[0185] Z1-M1-Uni-down: SEQ ID NO.21

[0186] Template: MG1655Δpta::M1-93-ftsZ.

[0187] 4.2 Amplification of the pta downstream homologous arm

[0188] Primer pta-R-up: SEQ ID NO.22

[0189] pta-R-down2: SEQ ID NO.23

[0190] Template: MG1655Δpta::M1-93-ftsZ.

[0191] 4.3. Amplify the Ylsod2 fragment

[0192] Primer: Yl sod2-F(M1-93): SEQ ID NO.26

[0193] Yl sod2-R(pta): SEQ ID NO.27

[0194] Template: Yarrowia lipolytica genome, GenBank accession number GCA_001761485.1.

[0195] 4.4. Obtain the Donor DNA of Yl sod2

[0196] Use Beyotime seamless assembly reagent to ligate the upstream homologous arm of pta, Yl sod2, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of Yl sod2 (pta-up-Yl sod2-pta-down).

[0197] 4.5. Integration of the Yl sod2 gene and plasmid elimination

[0198] First, co-electroporate the above-mentioned Donor DNA of Yl sod2 (pta-up-Yl sod2-pta-down) and pEcgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow out, perform PCR verification and sequencing analysis, and pick the correct transformants for plasmid elimination. Specifically: culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose to isolate single colonies, pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P2 strain.

[0199] 5. Integrate the Cn katG gene into the E. coli MG1655 genome:

[0200] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0201] 5.1 Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0202] Primer: pta-L-up2: SEQ ID NO.20

[0203] Z1-M1-Uni-down: SEQ ID NO.21

[0204] Template: MG1655Δpta::M1-93-ftsZ.

[0205] 5.2 Amplification of the downstream homologous arm of pta

[0206] Primer pta-R-up: SEQ ID NO.22

[0207] pta-R-down2: SEQ ID NO.23

[0208] Template: MG1655Δpta::M1-93-ftsZ.

[0209] 5.3 Amplification of the Cn katG fragment

[0210] Primer: Cn katG-F(M1-93): SEQ ID NO.28

[0211] Cn katG-R(pta): SEQ ID NO.29

[0212] Template: Cupriavidus necator genome, GenBank accession number GCA_000219215.1.

[0213] 5.4 Obtaining the Donor DNA of Cn katG

[0214] Use the Beyotime seamless assembly reagent to connect the upstream homologous arm of pta, Cn katG, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of Cn katG (pta-up-Cn katG-pta-down).

[0215] 5.5 Integration of the Cn katG gene and plasmid elimination

[0216] First, the above-mentioned Donor DNA of Cn katG and pEcgRNA-pta were co-electroporated into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification and sequencing analysis were carried out. The correct transformants were picked for plasmid curing, specifically as follows: Cultivate in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to cultivate for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have cured pEcgRNA and pEcCas, namely the M-P3 strain.

[0217] 6. Integration of the Cb CTA1 gene into the E. coli MG1655 genome:

[0218] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0219] 6.1 Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0220] Primers: pta-L-up2: SEQ ID NO.20

[0221] Z1-M1-Uni-down: SEQ ID NO.21

[0222] Template: MG1655Δpta::M1-93-ftsZ.

[0223] 6.2 Amplification of the downstream homologous arm of pta

[0224] Primer pta-R-up: SEQ ID NO.22

[0225] pta-R-down2: SEQ ID NO.23

[0226] Template: MG1655Δpta::M1-93-ftsZ.

[0227] 6.3 Amplification of the Cb CTA1 fragment

[0228] Primers: Cb CTA1-F(M1-93): SEQ ID NO.30

[0229] Cb CTA1-R(pta): SEQ ID NO.31

[0230] Template: Candida boidinii genome, GenBank accession number GCA_037935595.1.

[0231] 6.4 Acquisition of Donor DNA of 6.4Cb CTA1

[0232] Use Beyotime seamless assembly reagent to connect the upstream homologous arm of pta, Cb CTA1, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of Cb CTA1 (pta-up-Cb CTA1-pta-down).

[0233] 6.5 Integration of Cb CTA1 gene and plasmid elimination

[0234] First, co-electroporate the above-mentioned Donor DNA of Cb CTA1 and pEcgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow, perform PCR verification and sequencing analysis. Pick the correct transformants for plasmid elimination. Specifically: Culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P4 strain.

[0235] 7. Integration of Bm sodA gene into the E. coli MG1655 genome:

[0236] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0237] 7.1 Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0238] Primers: pta-L-up2: SEQ ID NO.20

[0239] Z1-M1-Uni-down: SEQ ID NO.21

[0240] Template: MG1655Δpta::M1-93-ftsZ.

[0241] 7.2 Amplification of the downstream homologous arm of pta

[0242] Primer pta-R-up: SEQ ID NO.22

[0243] pta-R-down2: SEQ ID NO.23

[0244] Template: MG1655Δpta::M1-93-ftsZ.

[0245] 7.3 Amplify the Bm sodA fragment

[0246] Primer: Bm sodA-F(M1-93): SEQ ID NO.32

[0247] Bm sodA-R(pta): SEQ ID NO.33

[0248] Template: Genomic Bacillus methanolicus, GenBank accession number GCA_000262755.1.

[0249] 7.4 Obtain the Donor DNA of Bm sodA

[0250] Use Beyotime seamless assembly reagent to connect the pta upstream homologous arm, Bm sodA and the pta downstream homologous arm in sequence to obtain the Donor DNA of Bm sodA (pta-up-Bm sodA-pta-down).

[0251] 7.5 Integration of the Bm sodA gene and plasmid elimination

[0252] First, co-electroporate the above-mentioned Donor DNA of Bm sodA and pEcgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow, perform PCR verification and sequencing analysis. Pick the correct transformants for plasmid elimination. Specifically: Culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 ul of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick the single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P5 strain.

[0253] 8. Integrate the MtkatG gene into the E. coli MG1655 genome:

[0254] The specific gene operation steps are as follows (the specific primer sequences are shown in Table 2):

[0255] 8.1 Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0256] Primer: pta-L-up2: SEQ ID NO.20

[0257] Z1-M1-Uni-down: SEQ ID NO.21

[0258] Template: MG1655Δpta::M1-93-ftsZ.

[0259] 8.2 Amplification of the downstream homologous arm of pta

[0260] Primer pta-R-up: SEQ ID NO.22

[0261] pta-R-down2: SEQ ID NO.23

[0262] Template: MG1655Δpta::M1-93-ftsZ.

[0263] 8.3 Amplification of the Mt katG fragment

[0264] Primer: Mt katG-F(M1-93): SEQ ID NO.34

[0265] Mt katG-R(pta): SEQ ID NO.35

[0266] Template: Genome of Methylosinus trichosporium, GenBank accession number GCA_000178815.2.

[0267] 8.4 Obtaining the Donor DNA of Mt katG

[0268] Use the Beyotime seamless assembly reagent to connect the upstream homologous arm of pta, Mt katG, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of Mt katG (pta-up-Mt katG-pta-down).

[0269] 8.5 Integration of the Mt katG gene and plasmid elimination

[0270] First, the above-mentioned Mt katG Donor DNA and pEcgRNA-pta were co-electroporated into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification and sequencing analysis were performed. Correct transformants were picked for plasmid curing, specifically as follows: Cultivate in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to cultivate for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have cured pEcgRNA and pEcCas, namely the M-P6 strain.

[0271] 9. Integration of the MesodB gene into the E. coli MG1655 genome:

[0272] 9.1 Amplify the upstream homologous arm of pta with the M1-93 promoter

[0273] Primers: pta-L-up2: SEQ ID NO.20

[0274] Z1-M1-Uni-down: SEQ ID NO.21

[0275] Template: MG1655Δpta::M1-93-ftsZ.

[0276] 9.2 Amplify the downstream homologous arm of pta

[0277] Primer pta-R-up: SEQ ID NO.22

[0278] pta-R-down2: SEQ ID NO.23

[0279] Template: MG1655Δpta::M1-93-ftsZ.

[0280] 9.3 Amplify the MesodB fragment

[0281] Primers: MesodB-F(M1-93): SEQ ID NO.36

[0282] MesodB-R(pta): SEQ ID NO.37

[0283] Template: The gene Methylorubrum extorquens, GenBank accession number GCA_000083545.1.

[0284] 9.4 Acquisition of Donor DNA of MesodB

[0285] Use Beyotime seamless assembly reagent to connect the upstream homologous arm of pta, MesodB, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of MesodB (pta-up-Me sodB-pta-down).

[0286] 9.5 Integration of MesodB gene and plasmid elimination

[0287] First, co-electroporate the above-mentioned Donor DNA of MesodB and pECgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow, perform PCR verification and sequencing analysis, and pick the correct transformants for plasmid elimination. Specifically: Culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose to isolate single colonies, pick the single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P7 strain.

[0288] 10. Integration of the Op sod gene into the genome of E. coli MG1655:

[0289] 10.1 Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0290] Primers: pta-L-up2: SEQ ID NO.20

[0291] Z1-M1-Uni-down: SEQ ID NO.21

[0292] Template: MG1655Δpta::M1-93-ftsZ.

[0293] 10.2 Amplification of the downstream homologous arm of pta

[0294] Primer pta-R-up: SEQ ID NO.22

[0295] pta-R-down2: SEQ ID NO.23

[0296] Template: MG1655Δpta::M1-93-ftsZ.

[0297] 10.3. Amplify the Op sod fragment

[0298] Primers: Op sod(Cu-Zn)-F(M1-93): SEQ ID NO.38

[0299] Op sod(Cu-Zn)-R(pta): SEQ ID NO.39

[0300] Template: Genomic Ogataea polymorpha, GenBank accession number GCA_001664045.1

[0301] 10.4. Obtain the Donor DNA of Op sod

[0302] Use the Beyotime seamless assembly reagent to connect the pta upstream homologous arm, Op sod, and pta downstream homologous arm in sequence to obtain the Donor DNA of Op sod (pta-up-Op sod-pta-down).

[0303] 10.5. Integration of the Op sod gene and plasmid elimination

[0304] First, co-electroporate the above-mentioned Donor DNA of Op sod and pEcgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow out, perform PCR verification and sequencing analysis, and pick the correct transformants for plasmid elimination. Specifically: Culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 ul of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P8 strain.

[0305] 11. Integration of the Bm katA gene into the E. coli MG1655 genome:

[0306] 11.1. Amplify the pta upstream homologous arm with the M1-93 promoter

[0307] Primers: pta-L-up2: SEQ ID NO.20

[0308] Z1-M1-Uni-down: SEQ ID NO.21

[0309] Template: MG1655Δpta::M1-93-ftsZ.

[0310] 11.2. Amplify the homologous arm downstream of pta

[0311] Primer pta-R-up: SEQ ID NO.22

[0312] pta-R-down2: SEQ ID NO.23

[0313] Template: MG1655Δpta::M1-93-ftsZ.

[0314] 11.3. Amplify the Bm katA fragment

[0315] Primer: Bm katA-F(M1-93): SEQ ID NO.40

[0316] Bm katA-R(pta): SEQ ID NO.41

[0317] Template: Genome of Bacillus methanolicus, GenBank accession number GCA_000262755.1.

[0318] 11.4. Obtain the Donor DNA of Bm katA

[0319] Use the Beyotime seamless assembly reagent to ligate the pta upstream homologous arm, Op sod, and the pta downstream homologous arm in sequence to obtain the Donor DNA of Bm katA (pta-up-Bm katA-pta-down).

[0320] 11.5. Integration of the Bm katA gene and plasmid elimination

[0321] First, co-electroporate the above-mentioned Donor DNA of Bm katA and pEcgRNA-pta into E. coli MG1655 / pEcCas9. After the transformants grow out, perform PCR verification and sequencing analysis, and pick the correct transformants for plasmid elimination. Specifically: Culture in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to culture for ~2 h, spread 10 μl of the cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grow only on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, namely the M-P9 strain.

[0322] 12. Integration of the Pa katA gene into the genome of E. coli MG1655:

[0323] 12.1. Amplification of the upstream homologous arm of pta with the M1-93 promoter

[0324] Primer: pta-L-up2: SEQ ID NO.20

[0325] Z1-M1-Uni-down: SEQ ID NO.21

[0326] Template: MG1655Δpta::M1-93-ftsZ.

[0327] 12.2 Amplification of the downstream homologous arm of pta

[0328] Primer pta-R-up: SEQ ID NO.22

[0329] pta-R-down2: SEQ ID NO.23

[0330] Template: MG1655Δpta::M1-93-ftsZ.

[0331] 12.3. Amplification of the Pa katA fragment

[0332] Primer: Pa katA-F(M1-93): SEQ ID NO.42

[0333] Pa katA-R(pta): SEQ ID NO.43

[0334] Template: Genome of Pseudomonas aeruginosa, GenBank accession number GCA_000006765.1.

[0335] 12.4. Obtaining the Donor DNA of Pa katA

[0336] Use the Beyotime seamless assembly reagent to connect the upstream homologous arm of pta, Pa katA, and the downstream homologous arm of pta in sequence to obtain the Donor DNA of Pa katA (pta-up-Pa katA-pta-down).

[0337] 12.5. Integration of the Pa katA gene and plasmid elimination

[0338] First, the above-mentioned Donor DNA of Pa katA and pEcgRNA-pta were co-electroporated into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification and sequencing analysis were performed. The correct transformants were picked for plasmid curing, specifically: cultured in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, the cells were transferred to liquid LB medium without any antibiotics and continued to be cultured for ~2 h. 10 μl of the cells were spread and inoculated on an LB plate containing 10 g / L sucrose to isolate single colonies. The single colonies were picked and transferred to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen for colonies. The colonies that grew only on the LB plate were the positive engineering colonies that had cured pEcgRNA and pEcCas, namely the M-P10 strain.

[0339] 13. Construction of the control bacterium E. coli MG1655Δpta:

[0340] 13.1 Amplification of the upstream homologous arm of pta

[0341] Primer: pta-L-up2: SEQ ID NO.20

[0342] pta-L-down: SEQ ID NO.48

[0343] Template: MG1655Δpta::M1-93-ftsZ.

[0344] 13.2 Amplification of the downstream homologous arm of pta

[0345] Primer pta-R-up: SEQ ID NO.22

[0346] pta-R-down2: SEQ ID NO.23

[0347] Template: MG1655Δpta::M1-93-ftsZ.

[0348] 13.3 Obtaining of the pta knockout Donor DNA

[0349] The upstream homologous arm of pta and the downstream homologous arm of pta were ligated in sequence using the Beyotime seamless assembly reagent to obtain the pta knockout Donor DNA (pta-up-pta-down).

[0350] 13.4 pta gene knockout and plasmid curing

[0351] First, the above-mentioned Donor DNA of pta and pEcgRNA-pta were co-electroporated into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification was carried out, and the correct transformants were selected for plasmid curing. Specifically: Cultivate in liquid LB medium containing 10 mM rhamnose and 50 mg / L Kan for ~6 h, transfer the cells to liquid LB medium without any antibiotics, continue to cultivate for ~2 h, coat and inoculate 10 ul of cells on an LB plate containing 10 g / L sucrose, isolate single colonies, and pick single colonies and transfer them to LB plates, LB plates containing Kan, and LB plates containing Spe in sequence to screen colonies. The colonies that only grow on the LB plate are the positive engineering colonies that have eliminated pEcgRNA and pEcCas, that is, the M-P0 strain.

[0352] 14. Strain well plate tolerance test: The above-mentioned genomically integrated strains M-P1 to M-P10 and the control strain M-P0 were separately activated on rich 2xYT medium plates, then transferred to liquid 2xYT medium, and then transferred to the basic MOPS medium supplemented with 2% (wt / v) glucose at an initial OD of 0.1. Wait until the OD 600 reaches 1.5 - 2.0, and then transfer to a 96-well plate of the basic MOPS medium (2% (wt / v) glucose) supplemented with 0 mM or 1 mM formaldehyde at an initial OD of 0.1, and perform continuous kinetic analysis in a microplate reader to monitor its OD 600 . The results showed that the strains M-P1 and M-P10 grew the fastest. At 14 h, the OD 600 was 1.5 times and 3.9 times higher than that of the control strain respectively ( Figure 2 ), Figure 2 where A in Figure 2 is a superoxide dismutase SOD;

[0353] 15. Construction and characterization of SOD and CAT co-expression strains:

[0354] Since SOD and CAT catalyze consecutive reactions: SOD first converts O2 - into H2O2, and subsequently, CAT reduces H2O2 to H2O. Therefore, the above-mentioned best-performing SOD and CAT (Kp sodB, Pa katA) were co-expressed, and a ribosome binding site (RBS) library was designed to obtain a series of co-expression strains of Kp sodB and Pa katA with different RBS strengths.

[0355] Design steps of the RBS library: Using M-P1 as a template, amplify the pta-up-Kp sodB fragment with primers pta-L-up2 (SEQ ID NO.20) and Kp sodB-Pa katA-R (RBSL) (SEQ ID NO.44). Using M-P10 as a template, amplify the Pa katA-pta-down fragment with primers pta-R-down2 (SEQ ID NO.23) and Kp sodB-Pa katA-F (RBSL) (SEQ ID NO.45). Use the Beyotime seamless assembly reagent to connect the fragments pta-up-Kp sodB and Pa katA-pta-down in order from left to right, and transfer them together with pECgRNA-pta into E. coli MG1655 containing pEcCas9 to obtain a series of E. coli MG1655Δpta::Kp sodB-RBSL-Pa katA transformants. Randomly select 8 transformants for sequencing to obtain E. coli MG1655Δpta::Kp sodB-RBS1-Pa katA, E. coli MG1655Δpta::KpsodB-RBS2-Pa katA, E. coli MG1655Δpta::Kp sodB-RBS3-Pa katA, E. coli MG1655Δpta::Kp sodB-RBS4-Pa katA, E. coli MG1655Δpta::Kp sodB-RBS5-Pa katA, E. coliMG1655Δpta::Kp sodB-RBS6-Pa katA, E. coli MG1655Δpta::Kp sodB-RBS7-Pa katA, E. coli MG1655Δpta::Kp sodB-RBS8-Pa katA, and name these transformants SC1, SC2, SC3, SC4, SC5, SC6, SC7, and SC8 in sequence. Subsequently, perform tolerance analysis, in which strains SC4 and SC6 showed higher tolerance than the strains with single gene integration ( Figure 3 in B), and are used as the objects for further research. The primer sequences are shown in Table 2.

[0356] Among them:

[0357] Nucleotide sequence of Kp sodB-RBS1-Pa katA: SEQ ID NO.1

[0358] Nucleotide sequence of Kp sodB-RBS2-Pa katA: SEQ ID NO.2

[0359] Nucleotide sequence of Kp sodB-RBS3-Pa katA: SEQ ID NO.3

[0360] Nucleotide sequence of Kp sodB-RBS4-Pa katA: SEQ ID NO.4

[0361] Nucleotide sequence of Kp sodB-RBS5-Pa katA: SEQ ID NO.5

[0362] Nucleotide sequence of Kp sodB-RBS6-Pa katA: SEQ ID NO.6

[0363] Nucleotide sequence of Kp sodB-RBS7-Pa katA: SEQ ID NO.7

[0364] Nucleotide sequence of Kp sodB-RBS8-Pa katA: SEQ ID NO.8.

[0365] The nucleotide sequence of the said RBS1 is as shown in SEQ ID NO.11; the nucleotide sequence of the said RBS2 is as shown in SEQ ID NO.12; the nucleotide sequence of the said RBS3 is as shown in SEQ ID NO.13; the nucleotide sequence of the said RBS4 is as shown in SEQ ID NO.14; the nucleotide sequence of the said RBS5 is as shown in SEQ ID NO.15; the nucleotide sequence of the said RBS6 is as shown in SEQ ID NO.16; the nucleotide sequence of the said RBS7 is as shown in SEQ ID NO.17; the nucleotide sequence of the said RBS8 is as shown in SEQ ID NO.18.

[0366] 16. High-concentration formaldehyde tolerance test: The culture conditions of strains P-M0, SC4, and SC6 are the same as those in the above well plate formaldehyde tolerance test. During the test, they are transferred at an OD of 0.1 to test tubes in the MOPS (2% (wt / v) glucose) minimal medium supplemented with 0 mM or 1.2 mM formaldehyde and cultured for 28 h, and the OD is measured. 600 . Under the condition of 0 mM formaldehyde, the growth trends of all strains are the same, but under the condition of 1.2 mM formaldehyde, the OD of strain SC4 600 reaches 2.2, and the OD of strain SC6 600 reaches 2.4, which are 11 times and 12 times higher than that of the control strain Δpta (0.2) respectively ( Figure 3 in C), indicating that they still show excellent tolerance to high-concentration formaldehyde.

[0367] 17. ROS level test of formaldehyde-tolerant strains: Strains Δpta (M-P0), SC4, and SC6 were cultured in MOPS (2% (wt / v) glucose) minimal medium. When the strains grew to 1.5 - 2.0, 10 mM formaldehyde was added. Under the condition of no formaldehyde, all strains showed low ROS levels; under the condition of 10 mM formaldehyde, the control strain showed a high fluorescence value, that is, a high ROS level, while strains SC4 and SC6 showed ROS levels 13% and 52% lower than that of the control, respectively. It was verified that the introduction of the ROS scavenging system effectively reduced the intracellular ROS levels of SC4 and SC6, and the effect of SC6 was more obvious. Figure 3 in D).

[0368] Example 2 Reducing Cellular ROS Levels to Enhance Methanol Assimilation Ability

[0369] This example aims to verify the characteristics of the strains constructed by the gene editing method in Example 1 in terms of methanol assimilation ability, methanol tolerance, and growth conditions on different carbon sources.

[0370] 1. Construction of the Methanol Assimilation Basic Strain E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA

[0371] 1.1 Construction of E. coli MG1655(DE3)ΔfrmA / pECcas9

[0372] 1.1.1 To knockout the frmA gene, the pECgRNA-frmA plasmid was constructed.

[0373] The specific method was as follows: The cleavage sequence N20 (ACCGGGAGCAAATGCAACGG, SEQ ID NO.100) of the Cas protein of frmA in the E. coli MG1655 genome (GenBank accession number: GCA_904425475.1) was determined by the CHOPCHOP online tool. pECgRNA was amplified by whole plasmid PCR, and the N20 sequence was introduced into this plasmid. The amplification primers were pECgRNA-frmA-F (SEQ ID NO.53) and pECgRNA-frmA-R (SEQ ID NO.54); the pECgRNA-frmA plasmid was obtained.

[0374] 1.1.2 Construction of the Donor DNA for frmA Knockout

[0375] Specifically: Using the commercial E. coli MG1655(DE3) genome (Vazyme) as a template, the upstream homologous arm frmA-up and the downstream homologous arm frmA-down were amplified with primers frmA-L-up2 (SEQ ID NO.55), frmA-L-down (SEQ ID NO.56) and frmA-R-up (SEQ ID NO.57), frmA-R-down2 (SEQ ID NO.58) respectively. Then, the upstream and downstream homologous arms were assembled and ligated in sequence using Beyotimes seamless to obtain the frmA knockout Donor DNA.

[0376] 1.1.3 Construction of E. coli MG1655(DE3)ΔfrmA / pECcas9

[0377] pEcCas9 was electrotransformed into E. coli MG1655(DE3) to obtain E. coli MG1655(DE3) / pEcCas9, and competent cells were prepared. Then, the above-mentioned frmA Donor DNA and pEcgRNA-frmA were co-electrotransformed into E. coli MG1655 / pEcCas9. After the transformants grew out, PCR verification was carried out, and the correct transformants were selected to eliminate the pECgRNA-frmA plasmid, thus obtaining E. coli MG1655(DE3)ΔfrmA / pEcCas9.

[0378] 1.2 Construction of E. coli MG1655(DE3)ΔfrmAΔrpiA / pEcCas9

[0379] 1.2.1 To knockout the rpiA gene, construct the pECgRNA-rpiA plasmid

[0380] The specific method is as follows: The cleavage sequence N20 (GTGAAATGATCTGACGGGGG, SEQ ID NO.101) of the Cas protein of rpiA in the E. coli MG1655 genome (GenBank accession number: GCA_904425475.1) was determined by the CHOPCHOP online tool. pEcgRNA was amplified by whole plasmid PCR, and the N20 sequence was introduced into this plasmid. The amplification primers were pECgRNA-rpiA-F (SEQ ID NO.59) and pECgRNA-rpiA-R (SEQ ID NO.60); the pECgRNA-rpiA plasmid was obtained.

[0381] 1.2.2 Construction of the rpiA knockout Donor DNA

[0382] Specifically: Using the commercial E. coli MG1655(DE3) genome (Vazyme) as a template, the upstream homologous arm rpiA-up and the downstream homologous arm rpiA-down were amplified with primers rpiA-L-up2 (SEQ ID NO.61), rpiA-L-down (SEQ ID NO.62) and rpiA-R-up (SEQ ID NO.63), rpiA-R-down2 (SEQ ID NO.64) respectively. Then, the upstream and downstream homologous arms were assembled and ligated in sequence using Beyotimes seamless to obtain the Donor DNA with rpiA knocked out.

[0383] 1.2.3 Construction of E. coli MG1655(DE3)ΔfrmAΔrpiA / pECcas9

[0384] The above-mentioned Donor DNA of rpiA and pECgRNA-rpiA were co-electroporated into E. coli MG1655(DE3)ΔfrmA / pECcas9 in step 1.1.3. After the transformants grew out, PCR verification was carried out, and the correct transformants were picked to eliminate the pECgRNA-rpiA plasmid, thus obtaining E. coli MG1655(DE3)ΔfrmAΔrpiA / pECcas9.

[0385] 1.3 Construction of E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiB

[0386] 1.3.1 To knock out the rpiB gene, construct the pEcgRNA-rpiB plasmid

[0387] The specific method is as follows: Determine the cleavage sequence N20 (TGAACCAAAAGCCAGCACGT, SEQ ID NO.102) of the Cas protein of rpiB in the E. coli MG1655 genome (GenBank accession number: GCA_904425475.1) through the CHOPCHOP online tool. Amplify pECgRNA by whole plasmid PCR and introduce the N20 sequence into this plasmid. The amplification primers are pECgRNA-rpiB-F (SEQ ID NO.65) and pECgRNA-rpiB-R (SEQ ID NO.66); obtain the pECgRNA-rpiB plasmid.

[0388] 1.3.2 Construction of the Donor DNA with rpiB knocked out

[0389] Specifically: Using the commercial E. coli MG1655(DE3) genome (Vazyme) as a template, the upstream homologous arm rpiB-up and the downstream homologous arm rpiA-down were amplified with primers rpiB-L-up2 (SEQ ID NO.67), rpiB-L-down (SEQ ID NO.68) and rpiB-R-up (SEQ ID NO.69), rpiB-R-down2 (SEQ ID NO.70) respectively, and then the upstream and downstream homologous arms were assembled and ligated in sequence using Beyotimes seamless; the Donor DNA with rpiB knocked out was obtained.

[0390] 1.3.3 Construction of E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiB

[0391] The above-mentioned Donor DNA of rpiB and pECgRNA-rpiB were co-electroporated into E. coli MG1655(DE3)ΔfrmAΔrpiA / pECcas9. After the transformants grew out, PCR verification was carried out, and the correct transformants were picked to eliminate the pECgRNA-rpiB and pECcas9 plasmids, thus obtaining E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiB.

[0392] 1.4 Construction of E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA

[0393] To knockout cyaA, the Red homologous recombination method was adopted, specifically as follows: First, the commercial vector pKD46 was electrotransformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiB to prepare competent cells. Next, homologous recombination fragments were constructed. Using the commercial E. coli MG1655(DE3) genome (Vazyme) as a template, the upstream homologous arm cyaA-up and the downstream homologous arm cyaA-down were amplified with primers cyaA-L-up2 (SEQ ID NO.71), cyaA-L-down (SEQ ID NO.72) and cyaA-R-up (SEQ ID NO.73), cyaA-R-down2 (SEQ ID NO.74) respectively. Using the commercial vector pKD3 as a template, the FKF fragment with kan was amplified with primers FKF-up and FKF-down. cyaA-up, FKF and cyaA-down were ligated in sequence using Beyotime seamless and transformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiB / pKD46. Correct transformants were selected to eliminate the pKD46 plasmid, and thus E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA was obtained. The primer sequences are shown in Table 2 above.

[0394] 2. Construction of methanol-assimilating strains

[0395] Using E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA as the starting strain, the tolerance modules corresponding to SC4 and SC6 were integrated into this strain by the CRISPR method. The specific construction is as follows:

[0396] First, pECcas9 was electrotransformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA to obtain E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA / pECcas9. Then, using SC4 as a template, the pta-up-kp sodB-RBS4-Pa katA-pta-down fragment was amplified with primers pta-L-up2 and pta-R-down2, and together with pECgRNA-pta, it was electrotransformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA / pECcas9 to obtain strain A1. Using SC6 as a template, the pta-up-kp sodB-RBS6-Pa katA-pta-down fragment was amplified with primers pta-L-up2 (SEQ ID NO.20) and pta-R-down2 (SEQ ID NO.23), and together with pECgRNA-pta, it was electrotransformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA / pECcas9 to obtain strain A2.

[0397] The control strain A0 was constructed as follows: Using M-P0 as a template, the pta-up-pta-down fragment was amplified with primers pta-L-up2 (SEQ ID NO.20) and pta-R-down2 (SEQ ID NO.23), and together with pECgRNA-pta, it was electrotransformed into E. coli MG1655(DE3)ΔfrmAΔrpiAΔrpiBΔcyaA / pECcas9 to obtain strain A0.

[0398] Next, the methanol assimilation plasmid pCDF-RuMP ( Figure 4 in A, 4 in B) was separately transferred into strains A0, A1, and A2 to obtain strains AM0, AM1, and AM2.

[0399] The construction method of the methanol assimilation plasmid pCDF-RuMP is as follows: Using the Cupriavidus necator genome (GenBank accession number: AM260479.1) as a template, the mdh gene (GenBank accession number: AEI80320.1) was amplified with mdh-F (SEQ ID NO.49) and mdh-R (SEQ ID NO.50). Then, using the commercial vector pCDFduet-1 (Novagen) as a template, the whole plasmid was linearized by PCR with primers P1-F (SEQ ID NO.81) and P1-R (SEQ ID NO.82). The mdh gene was assembled with the linearized pCDFduet-1 vector using Beyotime seamless to obtain pCDF-P1-mdh. Then, using the Bacillus methanolicus genome (GenBank accession number: ASM72448v1) as a template, the hps-phi fragment (GenBank accession number: hps is WP_274854053.1, phi is WP_274854052.1, and the two genes are adjacent and amplified together) was amplified with primers hps-F (SEQ ID NO.51) and phi-R (SEQ ID NO.52). Then, using pCDF-P1-mdh as a template, the whole plasmid was linearized by PCR with primers P2-F (SEQ ID NO.83) and P2-R (SEQ ID NO.84). The hps-phi fragment was assembled with the linearized pCDF-P1-mdh vector using Beyotime seamless to obtain the plasmid pCDF-P1-mdh-P2-hps-phi (pCDF-RuMP). The primer sequences are shown in Table 2 above.

[0400] 3. Methanol assimilation experiment:

[0401] Strains AM1, AM2 and the control strain AM0 were activated in 2xYT medium and transferred to MOPS minimal medium containing 50 mM xylose, 2% (wt / v) casein hydrolysate and different concentrations of methanol at 0.1 OD. Under the condition of 300 mM methanol, after 8 days of culture, the optical density value OD of strain AM1 cells 600 reached 6.1, and that of strain AM2 OD 600 reached 5.9, which were 4.5 times and 4.4 times higher than those of the control strain AM0 (1.1) respectively ( Figure 4 in C); Strains AM1 and AM2 almost consumed all the xylose in the medium, while the control strain AM0 only consumed 4 mM; Strains AM1 and AM2 consumed 84 and 103 mM methanol respectively, which were 78% and 119% higher than those of the control strain AM0 (47 mM) respectively ( Figure 4In D), under the condition of 600 mM methanol, the OD values of strains AM1 and AM2 600 reached 5.3 and 5.8, which were 4.3 times and 4.7 times higher than those of the control strain AM0 (1.0) respectively ( Figure 4 in E); similarly, both strains AM1 and AM2 consumed up xylose, while strain AM0 only consumed 4 mM of xylose. Strains AM1 and AM2 consumed 106 and 149 mM of methanol respectively, which were 2.1 times and 3.4 times higher than those of the control strain AM0 (34 mM) respectively ( Figure 4 in F). Under the condition of 900 mM, the OD values of strains AM1 and AM2 600 reached 4.7 and 5.0 respectively, which were 2.0 times and 2.1 times higher than those of the control strain AM0 (1.6) ( Figure 4 in G); strains AM1 and AM2 consumed 46 and 48 mM of xylose respectively, which were 6.7 times and 7.0 times higher than those of the control strain AM0 (6 mM) respectively; in terms of methanol consumption, strains AM1 and AM2 consumed 106 and 149 mM of methanol and 97 and 84 mM of methanol respectively, which were 2.1 times and 1.7 times higher than those of the control strain AM0 (31 mM) respectively ( Figure 4 in H). The above results indicate that strains AM1 and AM2 have high-efficient methanol assimilation ability, and the methanol utilization ability of AM2 is stronger, which is consistent with the previous formaldehyde tolerance results, indicating that the improvement of the methanol assimilation ability of the strains is attributed to the improvement of the tolerance to the toxic intermediate metabolites of methanol assimilation.

[0402] 4. Methanol tolerance test:

[0403] To further test the methanol tolerance of the strains, the methanol concentration was increased to 1200 mM, and the culture conditions were the same as those in the above methanol assimilation experiment. After 8 days of culture, the OD value of strain AM1 600 reached 2.8, and the OD value of strain AM2 600 reached 4.2, while that of the control strain AM0 was only 0.7. It shows that the introduction of the ROS scavenging module also enhances the methanol tolerance of the strains.

[0404] 5. Test the growth status of the strains using glucose and xylose as carbon sources: Strains AM0, AM1 and AM2 were cultured in MOPS minimal medium containing 50 mM xylose, 2% (wt / v) glucose and 2% (wt / v) casein hydrolysate. After 8 days of culture, none of the strains showed a growth trend. In addition, in the medium containing only xylose, these strains still could not grow. It shows that these strains cannot use glucose and xylose or xylose alone as carbon sources, because the knockout of rpiAB blocks the conversion of ribulose-5-phosphate (Ru5P) to ribose-5-phosphate (R5P) in cell metabolism, and the cells lack R5P and cannot grow. This defect can be restored by adding methanol into the RuMP cycle to produce R5P.

[0405] Example 3: Scale-up culture further improves the methanol assimilation level of the strain

[0406] Methanol assimilation experiment in shake flasks: To better exploit the potential of the engineered strain for methanol utilization, the above-mentioned strains were scale-up cultured in shake flasks. Strains AM0, AM1, and AM2 were cultured in 250 ml baffled shake flasks under the same culture conditions as in Example 2. Since methanol is volatile, for the rigor of the test, no cells were inoculated, and only the blank medium BLANK containing MOPS + 2% (wt / v) casein hydrolysate with different concentrations of methanol was used as the negative control. The actual methanol consumption of all strains was the measured value minus the value of the BLANK at the corresponding concentration.

[0407] Under the condition of 300 mM, after 6 days of culture, the OD of strain AM1 600 reached 5.4, and the OD of strain AM2 600 reached 5.0, which were 4.4 times and 4.0 times that of the control strain (1.0), respectively ( Figure 5 A); Strains AM1 and AM2 almost completely consumed xylose, while the control strain AM0 only consumed 4 mM xylose. Strain AM1 consumed 86 mM methanol, and strain AM2 consumed 111 mM methanol, which were 2.0 times and 2.8 times higher than that of the control strain AM0 (29 mM), respectively ( Figure 5 in D).

[0408] Under the condition of 600 mM, the OD of strains AM1 and AM2 600 reached the highest point on the second day, which were 8.5 and 8.2, respectively, 20.3 times and 19.5 times higher than that of the control strain (0.4) ( Figure 5 in B); Strains AM1 and AM2 both consumed up xylose on the second day, while strain AM0 only consumed a small amount of xylose; Strain AM1 consumed 210 mM methanol, and strain AM2 consumed 238 mM methanol, which were 16.5 times and 18.8 times higher than that of the control strain (12 mM), respectively ( Figure 5 in E).

[0409] Under the condition of 900 mM methanol, the OD of strains AM1 and AM2 600 reached the highest point on the third day, which were 9.3 and 6.7, respectively, 30 times and 21.3 times higher than that of the control strain (0.3) ( Figure 5 in C); Strain AM2 consumed up xylose on the third day, while strain AM1 still had 6 mM left after 6 days of culture, and strain AM0 only consumed a trace amount of xylose; Strain AM2 showed a higher methanol assimilation level, consuming a total of 291 mM methanol, and strain AM1 consumed a total of 199 mM methanol, which were 31.3 times and 21.1 times higher than that of the control strain AM0 (9 mM), respectively ( Figure 5In (F). Although the growth of strain AM2 was weaker than that of AM1, its xylose and methanol consumption capabilities were stronger. Therefore, strain AM2 was used for the next step of research.

[0410] It was observed that under high concentrations of methanol (600 and 900 mM), the engineered strain AM2 consumed all the xylose at the early stage of cultivation, which also led to a decrease in the optical density value of the cells. Moreover, the methanol utilization ability of the strain was stronger under high-concentration methanol conditions. Therefore, an attempt was made to supplement xylose or methanol during the cultivation process to maintain the continuous and efficient methanol assimilation ability of the strain. The strain cultivation conditions were the same as those described above. Under the condition of 600 mM methanol, strain AM2 underwent 9 days of fed-batch cultivation (30 mM xylose was supplemented every day from the 2nd to the 8th day, and 100 mM methanol was supplemented on the 5th and 7th days respectively), consuming 159 mM xylose and 485 mM methanol respectively. The methanol:xylose consumption ratio was 3.1:1 ( Figure 6 In (A). Under the condition of 900 mM methanol, by supplementing xylose additionally (30 mM per day) from the 2nd to the 5th day, and 20 mM xylose on the 8th day, finally this strain consumed 164 mM xylose and 433 mM methanol, and the methanol:xylose consumption ratio was 2.6:1 ( Figure 6 In (B).

[0411] Example 4 Analysis of the Metabolic Environment and Mechanism of Methanol-Assimilating Strains

[0412] 1. C 13 - Methanol Labeling Experiment

[0413] To explore the metabolism of methanol incorporated into methanol-assimilating strains, a C 13 - methanol labeling experiment was carried out. The strain AM2 with the best methanol assimilation effect was cultured in MOPS minimal medium, supplemented with 50 mM xylose, 2% (wt / v) casein hydrolysate, and 120 mM C 13 -labeled methanol. After 6 days of cultivation, the cells were collected to analyze the C 13 -labeling situation of intracellular metabolites by methanol. These metabolites showed extensive labeling, with most containing three labeled carbon atoms and a small number of metabolites having all carbon atoms labeled, indicating that methanol was comprehensively integrated into the metabolic pathway of strain AM2. In the EMP pathway, 80.7% of glucose 6-phosphate (G6P), 63.5% of fructose 6-phosphate (F6P), and 70.1% of fructose 1,6-bisphosphate (F1,6-P) were detected with C 13 -labeling. In addition, 36.7% of 2-phosphoglycerate (2-PG), 35.7% of 3-phosphoglycerate (3-PG), 38.9% of phosphoenolpyruvate (PEP), and 48.3% of pyruvate (PYR) were also labeled. In the tricarboxylic acid (TCA) cycle, a considerable part of the metabolites showed C 13Labeling. Among them, 64.1% of citric acid, 41.8% of cis-aconitic acid, 53.4% of succinic acid, 49.3% of fumaric acid, and 54.2% of malic acid were labeled. In the pentose phosphate pathway (PPP), 41.4% of ribulose-5-phosphate (Ru5P) and 47.5% of sedoheptulose-7-phosphate (S7P) were labeled ( Figure 7 in A). These labeling results indicate that methanol was largely incorporated into the strain metabolism, that is, effective methanol utilization.

[0414] 2. Determination of ROS levels in methanol-assimilating strains

[0415] To confirm that the high-efficiency methanol assimilation ability of the strain is based on the introduction of the ROS module, the ROS levels of the cells of strains AM0, AM1, and AM2 were measured. In addition, in strains A0, A1, and A2, the empty vector pCDFduet-1 was transfected respectively, and the obtained strains AC0, AC1, and AC2 were used as negative controls. Since the control bacteria grew poorly or hardly grew in the methanol assimilation medium, the rich 2xYT medium was used for testing. These strains were first activated in the rich 2xYT medium, then transferred to the 2xYT liquid medium at 0.1 OD and cultured to the logarithmic phase, and then 3 M methanol was added. After 12 h, samples were taken to measure their ROS levels. The results showed that the control groups without methanol addition all showed low levels of ROS. After adding 3 M methanol, the ROS levels of strains AM1 and AM2 were 51.6% and 57.6% lower than that of the control strain AM0 respectively ( Figure 7 in B). In addition, since the methanol assimilation pathway was not introduced in strain AC0, after methanol treatment, the ROS level increased, but was lower than that of AM0 with the introduction of the methanol assimilation pathway, indicating that the increase in the ROS level of the strain was caused by the toxicity of methanol on the one hand and the conversion of methanol into more toxic formaldehyde on the other hand. For the control strains AM1 and AM2 without the introduction of the methanol assimilation pathway, due to the integration of the ROS scavenging module, they also showed low ROS levels.

[0416] 3. Determination of formaldehyde levels

[0417] The first step in the methanol assimilation process is the generation of formaldehyde, so the intracellular formaldehyde levels of the strains were measured. Strains AM0, AM1, AM2, AC0, AC1, and AC2 were all involved in the test. These strains were activated in the rich 2xYT medium, then transferred to the 2xYT liquid medium at 0.1 OD and cultured to the logarithmic phase, and then 600 mM methanol was added. After 3 days, samples were taken to measure their intracellular formaldehyde levels. The results showed that the intracellular formaldehyde concentrations of strains AM1 and AM2 were 44 and 42 μM / g DCW respectively, lower than that of the control strains introducing the RuMP pathway (26 μM / g DCW) ( Figure 7In C), it shows that the introduction of the ROS scavenging system improves the tolerance of cells to methanol and formaldehyde, thereby enhancing the methanol utilization ability. As a result, the intracellular formaldehyde level is higher. In contrast, the control strain without the formaldehyde assimilation pathway exhibits a lower intracellular formaldehyde level.

[0418] Example 5 Application of highly efficient methanol-assimilating strains in 3-HP and TAL fermentation

[0419] 1. Generation of 3-HP strains

[0420] Using the methanol-assimilating strain AM2 with the best effect as the chassis, since this strain cannot synthesize 3-HP by itself, a heterologous 3-HP pathway will be introduced.

[0421] The construction method of the 3-HP synthesis plasmid is as follows: Using the Chloroflexus aurantiacus genome (GenBank accession number: ASM1886v1) as a template, the MCR-N gene fragment (GenBank accession number: ABY35820.1) was amplified with primers MCR-N-pET-P1-up (SEQ ID NO.77) and MCR-N-pET-P1-down (SEQ ID NO.78). Using the Chloroflexus aurantiacus genome as a template, the MCR-C gene fragment was amplified with primers MCR-C-pET-P1-up (SEQ ID NO.79) and MCR-C-pET-P1-down (SEQ ID NO.80). Using the commercial vector pETduet-1 (Novagen) as a template, the vector was linearized with primers P1-F (SEQ ID NO.81) and P1-R (SEQ ID NO.82). Then, MCR-N and MCR-C were ligated to the linearized vector pETduet-1 using Beyotime seamless to obtain the 3-HP synthesis plasmid pET-P1-MCRN-MCRC, which was transferred into AM2 to obtain the strain AM2-H. The AM0-H obtained by transferring the 3-HP plasmid into AM0 was used as a control strain ( Figure 8 In A).

[0422] 3-HP fermentation: The strains AM0-H and AM2-H were cultured in a methanol assimilation medium (MOPS basal medium + 2% (wt / v) casein hydrolysate + 50 mM xylose + 600 mM methanol), and xylose was supplemented to the strain AM2-H (50 mM xylose was supplemented on the third and fourth days respectively). After 6 days of fermentation, the strain AM2-H produced a total of 778 mg / L of 3-HP, which was 30.5 times higher than the control strain AM0-H (25 mg / L). Figure 8In addition, strain AM0-H did not show a growth trend and only consumed 1 mM xylose and 4 mM methanol; strain AM2-H consumed a total of 104 mM xylose and 175 mM methanol during the entire cultivation period, and the OD 600 reached 6.4.

[0423] 2. Generation of TAL strains

[0424] Using AM2 as the chassis strain and transferring the TAL production plasmid (pTrc99a-bktB) into it, the TAL production strain AM2-T was obtained. The TAL plasmid was transferred into strain AM0 to obtain the control strain AM0-T ( Figure 8 in B).

[0425] The specific construction method of pTrc99a-bktB is as follows: Using the Cupriavidus necator genome (GenBank accession number: AM260479.1) as a template, the bktB gene fragment (GenBank accession number: AAC38322.1) was amplified with primers bktB-F (SEQ ID NO.87) and bktB-R (SEQ ID NO.88). Using the commercial pTrc99a vector (NovoPro) as a template, it was linearized with primers pTrc99a-F (SEQ ID NO.85) and pTrc99a-R (SEQ ID NO.86). Then, the pTrc99a linear vector and the bktB gene were assembled using Beyotimeseamles to obtain the pTrc99a-bktB vector.

[0426] TAL fermentation: Strains AM0-T and AM2-T were cultured in a methanol assimilation medium of MOPS minimal medium + 2% (wt / v) casein hydrolysate + 50 mM xylose + 600 mM methanol, and xylose was supplemented to strain AM2-T (50 mM xylose was supplemented on the third and fourth days, and 30 mM xylose on the fifth day). After 6 days of fermentation, strain AM2-T produced a total of 155 mg / L of TAL, which was 19.3 times higher than that of the control strain AM0-T (8 mg / L) ( Figure 8 in D). In addition, the optical density value of strain AM2-T reached 9.0, and it consumed a total of 142 mM xylose and 303 mM methanol, while the OD of the control strain AM0-T 600 was 1.7, and it only consumed 3 mM xylose and 26 mM methanol.

[0427] The present invention discloses an efficient methanol assimilation strategy based on the reactive oxygen species (ROS) scavenging system and its application, belonging to the fields of genetic engineering and metabolic engineering. Introducing SodB from Klebsiella pneumoniae and KatA from Pseudomonas aeruginosa into Escherichia coli significantly enhances the cell's tolerance to formaldehyde. Formaldehyde, as a toxic intermediate in methanol metabolism, poses a severe challenge to methanol research. Therefore, the introduction of the ROS scavenging system has great advantages in improving methanol assimilation ability. The engineered strains AM1 and AM2 with the introduced ROS scavenging system show significantly better methanol assimilation levels than the control strain. Under the culture conditions of 900 mM methanol, strains AM1 and AM2 consumed approximately 200 and 300 mM of methanol, respectively, which were 20 and 30 times higher than those of the control strain AM0 without the ROS scavenging system. In the highly efficient methanol assimilation strain AM2, the additional addition of xylose and methanol significantly promoted methanol consumption. Under the condition of 600 mM methanol, strain AM2 consumed 485 mM of methanol. Under the condition of 900 mM methanol, the strain consumed 433 mM of methanol, highlighting its efficient methanol assimilation level at high concentrations of methanol. The methanol assimilation strain AM2 is applied to the biosynthesis of 3-hydroxypropionic acid (3-HP) and triacetic acid lactone (TAL) due to its excellent methanol assimilation ability. The production performance of strain AM2 is significantly higher than that of the control strain, indicating its great potential in the industrial-scale biomanufacture of these high-value compounds.

[0428] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A formaldehyde tolerance module based on a reactive oxygen species (ROS) scavenging system, characterized in that: Includes one of the following three modules: A. Formaldehyde tolerance module I based on superoxide dismutase SOD, comprising at least one of the genes Bm sodA, Me sodB, Op sod, Yl sod2, and Kp sodB; B. Formaldehyde tolerance module II based on catalase CAT, comprising at least one of the genes Bm katA, Cn katG, Mt katG, CbkatA, and Pa katA; C. SOD-CAT combined formaldehyde tolerance module III, including at least one of the genes Bm sodA, Me sodB, Op sod, Yl sod2, KpsodB, and at least one of the genes Bm katA, Cn katG, Mt katG, Cb katA, Pa katA.

2. The formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system according to claim 1, characterized in that: The formaldehyde tolerance module I based on superoxide dismutase SOD or the formaldehyde tolerance module II based on catalase CAT is respectively integrated into the pta site of the Escherichia coli genome.

3. The formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system according to claim 1, characterized in that: The formaldehyde tolerance module I based on superoxide dismutase (SOD) includes genes Bm sodA, Me sodB, Op sod, Yl sod2, and KpsodB.

4. The formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system according to claim 1, characterized in that: The formaldehyde tolerance module II based on catalase CAT includes genes Bm katA, Cn katG, Mt katG, CbkatA, and Pa katA.

5. The formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system according to claim 1, characterized in that: The SOD-CAT combined formaldehyde tolerance module III includes genes Kp sodB and Pa katA, and ribosome binding site RBS sequences with different expression intensities, wherein the RBS sequence includes at least one of RB1, RBS2, RBS3, RBS4, RBS5, RBS6, RBS7, and RBS8.

6. A chassis strain with improved formaldehyde tolerance, characterized in that The formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system as described in any one of claims 1 to 5 is integrated into the Escherichia coli genome.

7. The chassis strain according to claim 6, characterized in that The integration site of the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system is the pta target; the nucleotide sequence of the pta is: SEQ ID NO.

10.

8. A methanol assimilating strain, characterized in that The method is prepared by knocking out frmA, rpiA, rpiB and cyaA on the genome of Escherichia coli, and integrating the formaldehyde tolerance module based on the reactive oxygen species (ROS) scavenging system described in any one of claims 1 to 5 at the pta site.

9. Use of the methanol assimilating strain as claimed in claim 8 in 3-HP synthesis.

10. A methanol assimilating strain for 3-HP synthesis, characterized in that: The methanol assimilating strain according to claim 8 is used as a chassis and a heterologous 3-HP pathway is introduced to obtain the obtained product.

11. Use of the methanol-assimilating strain according to claim 8 in the synthesis of triacetic acid lactone (TAL).

12. A methanol assimilating strain for TAL synthesis, characterized in that: The methanol assimilating strain according to claim 8 is used as a chassis and a heterologous TAL pathway is introduced to obtain the obtained product.

Images