D / Yama2019 genetic evolution pedigree influenza delta virus reverse genetic manipulation system

Abstract

The invention discloses a D / Yama2019 genetic evolution pedigree influenza delta virus reverse genetic operating system. According to the invention, DNA fragments corresponding to segments of PB2, PB1, P3, HEF, NP, M and NS of a full-length genome of D / JY3002 are amplified by using seven pairs of designed primers, the DNA fragments are seamlessly cloned to a pHW2000 vector and a pCC1-DualPro vector to construct plasmids, the plasmids are co-transfected to a cell line, and the artificially rescued D / Yama2019 genetic evolution pedigree influenza delta virus rD / JY3002 is obtained; the genomic sequence of the rD / JY3002 is completely consistent with the genomic sequence of a naturally separated strain D / JY3002, the infection ability is equivalent, and the rD / JY3002 can be stably subcultured for at least five generations. According to the present invention, the constructed unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 is adopted to obtain the artificially rescued recombinant influenza delta virus rD / JY3002-GFP carrying the green fluorescence reporter gene, and after the host cell is infected, the GFP expression quantity is high and stable; the invention establishes an efficient and stable D / Yama2019 genetic evolution pedigree influenza delta virus reverse genetic operating system which can be used for developing an influenza delta virus vector presenting exogenous gene.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a reverse genetic operating system for influenza D virus of D / Yama2019 genetic evolutionary lineage. Background Art

[0002] Influenza D virus is a new member of the Orthomyxoviridae family and was first isolated from pigs with respiratory symptoms in the United States in 2011. Nevertheless, a large number of epidemiological studies have shown that cattle are the main natural hosts of this virus. Influenza D virus is widely spread among cattle herds in nearly 30 countries and can cause mild to moderate respiratory diseases in cattle. In addition, specific antibodies have also been found in the sera of pigs, sheep, goats, horses, camels, deer, dogs and humans, suggesting that influenza D virus may have multiple animal hosts and there is a potential risk of human infection.

[0003] The genome of influenza D virus consists of seven negative-strand RNA segments, namely PB2, PB1, P3, HEF, NP, M and NS segments. Among them, the three longest genome segments encode the subunits PB2, PB1 and P3 of the viral polymerase complex, which catalyze the transcription and replication of viral genomic RNA (vRNA); the fourth longest genome segment encodes the main surface glycoprotein of the virus, that is, hemagglutinin-esterase-fusion protein (HEF), which is responsible for virus invasion, fusion and release; the fifth longest genome segment encodes the viral nucleoprotein (NP), which together with vRNA and the polymerase complex forms the viral replication core unit - genomic ribonucleoprotein complex (vRNP); the sixth longest genome segment encodes the viral matrix proteins DM1 and DM2; the shortest genome segment encodes the viral non-structural proteins NS1 and NS2.

[0004] According to the sequence of the HEF genome segment of the virus, influenza D virus is at least divided into five genetic evolutionary lineages, namely D / OK, D / 660, D / Yama2016, D / Yama2019 and D / CA2019. Influenza D viruses of D / OK and D / 660 genetic evolutionary lineages are mainly prevalent in cattle herds in European and American countries; influenza D viruses of D / Yama2019 genetic evolutionary lineage have so far only been found and isolated in cattle herds in Asian countries such as China, Japan, South Korea, etc.; influenza D viruses of D / Yama2016 and D / CA2019 genetic evolutionary lineages have only been found and reported in cattle herds in Japan and the United States respectively.

[0005] The reverse genetic operating system is one of the most important tools for influenza virus biological research. Negative-sense and segmented are two key features of the influenza virus genome. To establish an influenza virus reverse genetic operating system completely based on exogenous plasmids, the focus is on constructing seven or eight bidirectional expression plasmids to simultaneously generate vRNA and mRNA for all viral genome segments, or constructing eleven or twelve unidirectional expression plasmids to separately generate vRNA for all viral genome segments and mRNA for four viral replication core unit proteins. The above strategies are also the most commonly used methods for currently establishing reverse genetic operating systems for influenza viruses of different types, different subtypes (or different genetic evolution lineages), and different strains.

[0006] Influenza D virus of the D / Yama2019 genetic evolution lineage is the main influenza D virus prevalent in cattle herds in Asian countries. More importantly, studies have shown that influenza D virus of this genetic evolution lineage is stronger than other genetic evolution lineages of influenza D virus in terms of replication and pathogenesis, but the specific mechanism remains unclear. The lack of a reverse genetic operating system for influenza D virus of the D / Yama2019 genetic evolution lineage has brought great obstacles to many studies on influenza D virus of this genetic evolution lineage, such as studies on the replication and transmission laws of the virus, exploration of the pathogenesis mechanism, and vaccine development. Summary of the Invention

[0007] Currently, the technical difficulties in establishing a reverse genetic operating system for influenza D virus of the D / Yama2019 genetic evolution lineage are mainly reflected in the following aspects: First, obtaining the complete genome sequence of the influenza D virus strain of the D / Yama2019 genetic evolution lineage, especially the accurate sequences at both ends of the viral genome; Second, constructing bidirectional expression plasmids containing DNA fragments corresponding to the genome segments of the influenza D virus strain of the D / Yama2019 genetic evolution lineage, especially the DNA fragment corresponding to the unstable HEF genome segment; Third, establishing a suitable and effective reverse genetic operation method and procedure for influenza D virus.

[0008] In view of the above deficiencies in the prior art, the present invention provides a reverse genetic operating system for influenza D virus of the D / Yama2019 genetic evolution lineage (strain name: D / bovine / CHN / JY3002 / 2022 (D / JY3002)), including primers, plasmids, methods for constructing this reverse genetic operating system, and their applications.

[0009] The first object of the present invention is to provide a set of primers for amplifying the full-length DNA fragments corresponding to the genomic segments of influenza D virus of the D / Yama2019 genetic evolutionary lineage, which includes primers with nucleotide sequences shown in SEQ ID NO.1-14. Among them, the nucleotide sequence of the primer for amplifying the PB2 segment of the influenza D virus strain D / JY3002 genome is shown in SEQ ID NO.1-2, the nucleotide sequence of the primer for amplifying the PB1 segment is shown in SEQ ID NO.3-4, the nucleotide sequence of the primer for amplifying the P3 segment is shown in SEQ ID NO.5-6, the nucleotide sequence of the primer for amplifying the HEF segment is shown in SEQ ID NO.7-8, the nucleotide sequence of the primer for amplifying the NP segment is shown in SEQ ID NO.9-10, the nucleotide sequence of the primer for amplifying the M segment is shown in SEQ ID NO.11-12, and the nucleotide sequence of the primer for amplifying the NS segment is shown in SEQ ID NO.13-14.

[0010] The second object of the present invention is to provide a set of primers for amplifying a linearized vector for seamless cloning, which includes a universal upstream primer with a nucleotide sequence shown in SEQ ID NO.15 and segment-specific downstream primers with nucleotide sequences shown in SEQ ID NO.16-22.

[0011] The third object of the present invention is to provide a pCC1-DualPro vector, whose nucleotide sequence is shown in SEQ ID NO.30. This vector can be used to clone a bidirectional expression plasmid of the DNA fragment corresponding to the HEF genomic segment of influenza D virus D / JY3002. The bidirectional expression plasmid pHW2000 is a high-copy plasmid commonly used for constructing the influenza virus reverse genetic operation system. However, when attempting to clone and insert the DNA fragment corresponding to the HEF genomic segment of influenza D virus into the pHW2000 plasmid, a phenomenon of partial deletion of the inserted DNA fragment occurs. To solve this technical problem, the present invention constructs a bidirectional expression plasmid pCC1-DualPro with controllable copy number, and the DNA fragment corresponding to the HEF genomic segment of influenza D virus can be stably cloned and inserted into the pCC1-DualPro plasmid.

[0012] The fourth object of the present invention is to provide a unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 carrying a green fluorescent reporter gene and a packaging signal of the D / Yama2019 genetic evolutionary lineage influenza D virus, and its nucleotide sequence is as shown in SEQ ID NO.31. This plasmid contains the GFP gene and DNA fragments corresponding to the sequences at both ends of the PB1 genomic segment of the influenza D virus D / JY3002. The sequences at both ends of the PB1 genomic segment can serve as packaging signal sequences to control the transcription, replication, and packaging of the corresponding genomic segments. The unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 can be transcribed to form mutant recombinant vRNA containing the GFP gene. All the bidirectional expression plasmids containing DNA fragments corresponding to the genomic segments of the influenza D virus D / JY3002 constructed and this unidirectional expression plasmid are co-transfected into a cell line, and a recombinant influenza D virus rD / JY3002-GFP carrying a green fluorescent reporter gene is rescued. When rD / JY3002-GFP infects the cell line, it can be observed under a fluorescence microscope that the infected cells express green fluorescent protein.

[0013] The fifth object of the present invention is to provide a method for constructing a reverse genetic operating system of the D / Yama2019 genetic evolutionary lineage influenza D virus, comprising the following steps:

[0014] The DNA fragments corresponding to the PB2, PB1, P3, NP, M, and NS segments are respectively seamlessly cloned into the pHW2000 vector, and the DNA fragment corresponding to the HEF segment is seamlessly cloned into the pCC1-DualPro vector to obtain seven bidirectional expression plasmids, and then they are co-transfected into a cell line to obtain an artificially rescued D / Yama2019 genetic evolutionary lineage influenza D virus;

[0015] The nucleotide sequences of the DNA fragments corresponding to the PB2, PB1, P3, NP, M, and NS segments are successively as shown in SEQ ID NO.23-25 and SEQ ID NO.27-29, the nucleotide sequence of the DNA fragment corresponding to the HEF segment is as shown in SEQ ID NO.26; the nucleotide sequence of the pCC1-DualPro vector is as shown in SEQ ID NO.30.

[0016] Preferably, in the method, when co-transfecting, the seven bidirectional expression plasmids and the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 are co-transfected into a cell line; the nucleotide sequence of the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 is as shown in SEQ ID NO.31.

[0017] Preferably, the co-transfection into the cell line includes the following steps:

[0018] S1. One day before transfection, seed 293T cells and MDCK cells in a six-well cell culture plate at a ratio of 3:1 for co-culture. The culture conditions are 5% CO2 and 37°C. When the cell density reaches 75%, start preparing for transfection. Before transfection, replace the old culture medium with 1.5 mL of DMEM culture medium containing 10% fetal bovine serum but no antibiotics.

[0019] S2. Take 1 μg each of the seven bidirectional expression plasmids or the seven bidirectional expression plasmids and the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240, then add 200 μL of Opti-MEM and mix well. Drop in 20 μL of PEI-25K transfection reagent, mix well to obtain a mixed solution, and let it stand for 25 min. Add the mixed solution to the six-well cell culture plate in step S1 and culture at 37°C for 6 - 9 h.

[0020] S3. Replace the old culture medium with 1.7 mL of DMEM culture medium containing 100 U / mL penicillin and 100 μg / mL streptomycin but no fetal bovine serum, culture at 37°C for 36 - 42 h, then supplement 500 μL of DMEM culture medium containing 100 U / mL penicillin, 100 μg / mL streptomycin, and 1 μg / mL TPCK-trypsin, and continue to culture for 3 - 4 d. Appropriately supplement 200 - 400 μL of DMEM culture medium containing 100 U / mL penicillin, 100 μg / mL streptomycin, and 0.1 μg / mL TPCK-trypsin.

[0021] S4. When the HA titer in the cell supernatant reaches 2 3 -2 6 HA units / 25 μL, collect the cell supernatant to obtain the artificially rescued D / Yama2019 genetic evolution lineage type D influenza virus.

[0022] The co-transfection reverse genetic operation steps of the present invention are different from those of other types of influenza viruses and are operation steps improved and optimized according to the replication characteristics of type D influenza virus. Since the time for the rescued virus of type D influenza virus to produce virus is significantly later than that of type A and type B influenza viruses, usually 72 hours, while the latter is generally between 24 - 48 hours, it is necessary to ensure that the cells after transfection with the plasmid have a good state to support the rescue of type D influenza virus. The purpose of replacing the culture medium with DMEM culture medium containing antibiotics but no fetal bovine serum 6 - 9 hours after transfection with the plasmid, and supplementing TPCK-trypsin 36 - 42 hours after culture is to ensure that the cells have a good growth state. However, when rescuing type A and type B influenza viruses, the culture medium at the time of transfection with the plasmid is the culture medium without fetal bovine serum, and the culture medium is changed to the culture medium containing TPCK-trypsin 6 - 9 hours later.

[0023] The sixth object of the present invention is to provide an artificially rescued D / Yama2019 genetic evolutionary lineage influenza D virus constructed by using the construction method of the reverse genetic operating system of D / Yama2019 genetic evolutionary lineage influenza D virus described above.

[0024] The seventh object of the present invention is to provide a reagent set for the reverse genetic operating system of D / Yama2019 genetic evolutionary lineage influenza D virus, which comprises the primer set for amplifying the full-length DNA fragments of the genomic segments of D / Yama2019 genetic evolutionary lineage influenza D virus, the primer set for amplifying the linearized vector for seamless cloning, the pCC1-DualPro vector, and the single-direction expression plasmid pPolI-D / JY3002-PB1-240-GFP-240.

[0025] Using the cDNA reverse transcribed from viral RNA as a template, seven pairs of designed primers were used to amplify the DNA fragments corresponding to the PB2, PB1, P3, HEF, NP, M, and NS segments of the full-length genome of D / JY3002, and after seamless cloning into the pHW2000 vector and the pCC1-DualPro vector, the plasmids pHW2000-D / JY3002-PB2, pHW2000-D / JY3002-PB1, pHW2000-D / JY3002-P3, pCC1-DualPro-D / JY3002-HEF, pHW2000-D / JY3002-NP, pHW2000-D / JY3002-M, and pHW2000-D / JY3002-NS were constructed. They were co-transfected into a cell line to obtain the artificially rescued D / Yama2019 genetic evolutionary lineage influenza D virus rD / JY3002. The whole-genome sequencing results showed that the genomic sequence of rD / JY3002 was completely identical to the genomic sequence of the naturally isolated strain D / JY3002. Infection and passage experiments showed that the artificially rescued influenza D virus had the same infectivity as the naturally isolated influenza D virus, and the artificially rescued influenza D virus could be stably passaged for at least five generations. Using the constructed single-direction expression plasmid pPolI-D / JY3002-PB1-240-GFP-240, the artificially rescued recombinant influenza D virus rD / JY3002-GFP carrying the green fluorescent reporter gene was obtained. After infecting host cells, the GFP expression level was high and stable. The present invention established an efficient and stable reverse genetic operating system for D / Yama2019 genetic evolutionary lineage influenza D virus and can be used to develop influenza D virus vectors for presenting foreign genes. Description of the Drawings

[0026] Figure 1Obtain the terminal sequences at both ends of each genomic segment of the accurate hepatitis D virus strain D / JY3002 through high-depth high-throughput sequencing; among them, Figures A-G are the 100bp sequences at the 5' end and 3' end of the genomic segments of PB2, PB1, P3, HEF, NP, M, and NS of hepatitis D virus in different genetic evolution lineages (D / OK, D / 660, and D / Yama2019) respectively. The sequences shown in the third row of the sequence alignment diagram are the publicly available but incomplete terminal sequences of the genomic segments of hepatitis D virus strain D / JY3002, and the fourth row is the complete terminal sequences of the genomic segments of hepatitis D virus strain D / JY3002 obtained in Example 1. The red-framed part in the figure is the non-coding region sequence at both ends of the genomic segments of hepatitis D virus strain D / JY3002.

[0027] Figure 2 It is the electrophoresis result of the products of amplifying the DNA fragments (PB2, PB1, P3, HEF, NP, M, and NS) corresponding to the genomic segments of hepatitis D virus D / JY3002 with seven groups of primer sequences (SEQ ID NO.1-14) designed and synthesized; "M" in the rightmost lane represents Marker, which is used to indicate the size of the DNA fragment.

[0028] Figure 3 It is the electrophoresis diagram of colony PCR identification; among them, A is the electrophoresis diagram of PCR identification of the colonies obtained after seamlessly cloning the DNA fragment corresponding to the HEF genomic segment of D / JY3002 into the pHW2000 vector, where lanes 1-7 represent 7 different colony samples; B is the electrophoresis diagram of PCR identification of the colonies obtained after seamlessly cloning the DNA fragment corresponding to the HEF genomic segment of D / JY3002 into the pCC1-DualPro vector, where lanes 1-2 represent 2 different colony samples; "M" represents Marker, which is used to indicate the size of the DNA fragment.

[0029] Figure 4It is the map of the bidirectional expression plasmid pCC1-DualPro; the bidirectional expression plasmid pCC1-DualPro is a low-copy plasmid with controllable copy number, containing the CMV promoter (Human cytomegalovirus immediate early promoter) and the BGH poly A terminator (Bovine growth hormone polyadenylation signal), which are used for transcribing the corresponding viral mRNA; the Human Pol I promoter (Human RNA polymerase I promoter) and the Murine Pol I terminator (Murine RNA polymerase I termination signal) are embedded in the reverse direction, which are used for transcribing the corresponding viral vRNA.

[0030] Figure 5 It is the map of the bidirectional expression plasmid containing the DNA fragment corresponding to the genomic segment of influenza D virus D / JY3002; A is the map of pHW2000-D / JY3002-PB2, B is the map of pHW2000-D / JY3002-PB1, C is the map of pHW2000-D / JY3002-P3, D is the map of pCC1-DualPro-D / JY3002-HEF, E is the map of pHW2000-D / JY3002-NP, F is the map of pHW2000-D / JY3002-M, and G is the map of pHW2000-D / JY3002-NS.

[0031] Figure 6 It shows the infection titers of the artificially rescued influenza D virus rD / JY3002 and the infection titers of different passages; among them, A is the infection titer (TCID 50 ) of the artificially rescued influenza D virus rD / JY3002 and the naturally isolated influenza D virus D / JY3002; B is the infection titer of the artificially rescued influenza D virus (rD / JY3002-P1 to P5) of different passages; "ns" indicates no significant difference.

[0032] Figure 7It is the map of the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240; the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 contains DNA fragments corresponding to 240bp sequences at both the 5' and 3' ends of the D / JY3002 PB1 genomic segment of influenza D virus, embedded between the Human Pol I promoter (Human RNA polymerase I promoter) in the reverse direction and the Murine Pol I terminator (Murine RNA polymerase I termination signal, abbreviated as PolI Ter. in the figure). This plasmid can transcribe to form mutant recombinant vRNA containing the GFP gene.

[0033] Figure 8 It is the expression and infection of the artificially rescued recombinant influenza D virus rD / JY3002-GFP; A shows that after the recombinant influenza D viruses rD / JY3002-GFP-P0 and rD / JY3002-GFP-P1 infect MDCK cells, green fluorescent protein is expressed in the infected cells observed under a fluorescence microscope; B shows the infection titers of rD / JY3002-GFP-P0 and rD / JY3002-GFP-P1. Specific implementation manners

[0034] The following examples further illustrate the present invention, rather than limiting the present invention.

[0035] Example 1

[0036] 1. Amplification of the full-length genomic sequence of influenza D virus D / JY3002 and DNA fragments corresponding to each genomic segment

[0037] Previously, we have published the incomplete genomic sequence of influenza D virus D / JY3002 on GenBank (https: / / www.ncbi.nlm.nih.gov / nuccore / ?term=influenza%20D%20virus%20D / bovine / CHN / JY3002) (accession number: OR685126-OR685132). To establish a reverse genetic operating system for D / JY3002, in this example, the full-length genomic sequence of the influenza D virus strain D / bovine / CHN / JY3002 / 2022 (D / JY3002) of the D / Yama2019 genetic evolutionary lineage was obtained by high-throughput sequencing, especially the sequences at both ends of the genomic segments were accurately obtained. Then, according to the full-length genomic sequence of D / JY3002, seven pairs of primers (SEQ ID NO.1-NO.14) were designed, and the DNA fragments corresponding to the full-length genomic segments PB2, PB1, P3, HEF, NP, M, and NS of D / JY3002 were amplified.

[0038] 1.1 Obtaining the full-length genomic sequence of influenza D virus D / JY3002 by high-throughput sequencing

[0039] The influenza D virus D / JY3002 was propagated in MDCK (Madin Darby Canine Kidney, ATCC: CCL-34) cells, and 9.6 mL of virus supernatant sample (HA titer was 2 8 HA units / 25 μL) was collected. The cell debris was removed by centrifugation at 12,000 rpm for 10 minutes. The sample was first filtered through a 0.45 μm needle filter, and then concentrated to 0.3 mL using a 100 kDa centrifugal concentrator filter. The viral RNA was extracted by the TRIzol method, and a high-throughput sequencing library was prepared according to the instructions of the BGI MGIEasy respiratory microbial genome amplification kit. Finally, high-throughput sequencing was completed using the BGI G99 sequencer to obtain the full-length genomic sequence of the D / JY3002 virus strain, especially the sequences at both ends of the genomic segments were accurately obtained ( Figure 1 ). The nucleotide sequences of the full-length genomic segments PB2, PB1, P3, HEF, NP, M, and NS of D / JY3002 are shown in SEQ ID NO.23-29, respectively.

[0040] 1.2 Amplifying the DNA fragments corresponding to the genomic segments of D / JY3002

[0041] The viral RNA extracted above was reverse-transcribed into cDNA using a reverse transcription kit (Vazyme HiScript III 1st Strand cDNA Synthesis kit) as a template for amplifying the DNA fragment corresponding to the genomic segment of D / JY3002. Then, using the seven pairs of primers designed (SEQ ID NO.1-14), the full-length fragments of the corresponding genomic segments were amplified using a high-fidelity DNA polymerase ( Figure 2 ). Among them, the nucleotide sequences of the primers for amplifying the PB2 segment of the genomic segment of influenza D virus strain D / JY3002 are shown in SEQ ID NO.1-2, the nucleotide sequences of the primers for amplifying the PB1 segment are shown in SEQ ID NO.3-4, the nucleotide sequences of the primers for amplifying the P3 segment are shown in SEQ ID NO.5-6, the nucleotide sequences of the primers for amplifying the HEF segment are shown in SEQ ID NO.7-8, the nucleotide sequences of the primers for amplifying the NP segment are shown in SEQ ID NO.9-10, the nucleotide sequences of the primers for amplifying the M segment are shown in SEQ ID NO.11-12, and the nucleotide sequences of the primers for amplifying the NS segment are shown in SEQ IDNO.13-14.

[0042] The primer sequences are as follows:

[0043] SEQ ID NO.1: 5’-AGCATAAGCAGAGGATGTCACTACTATTAACGC-3’,

[0044] SEQ ID NO.2: 5’-CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTTCAATGTG-3’;

[0045] SEQ ID NO.3: 5’-GGAGCATAAGCAGAGGATTTTATAACAATGGA-3’,

[0046] SEQ ID NO.4: 5’-CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTC-3’;

[0047] SEQ ID NO.5: 5’-AGCATAAGCAGGAGATTTAGAAATGTCTAGTAT-3’,

[0048] SEQ ID NO.6: 5’-CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTAA-3’;

[0049] SEQ ID NO.7: 5’-AGCATAAGCAGGAGATTTTCAAAGATGTTTTTG-3’

[0050] SEQ ID NO.8: 5’-CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTTCTAAGAT-3’

[0051] SEQ ID NO.9: 5’-AGCATAAGCAGGAGATTATTAAGCAATATGGAC-3’

[0052] SEQ ID NO.10: 5’-CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTTGTTAAAT-3’

[0053] SEQ ID NO.11: 5’-GGAGCATAAGCAGAGGATATTTTTGACGCAATG-3’

[0054] SEQ ID NO.12: 5’-CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTTCGCGA-3’

[0055] SEQ ID NO.13: 5’-GGAGCATAAGCAGGGGTGTACAATTTCAATATG-3’

[0056] SEQ ID NO.14: 5’-CCGCCGGGTTATTAGCAGTAGCAAGGGGTTTTTTCATACT-3’

[0057] The PCR amplification products were electrophoretically separated on 1% agarose gel( Figure 2 ), and the DNA fragment sizes were consistent with the expected sizes. The agarose gel containing the target DNA fragment was cut out and purified using a Gel DNA Recovery Kit (Omega). After measuring the DNA concentration, it was stored in a 4°C refrigerator and used as the target insertion gene for subsequent seamless cloning and ligation into the corresponding plasmid vector.

[0058] 2. Construction of a bidirectional expression plasmid containing the DNA fragment corresponding to the D / JY3002 genomic segment

[0059] By PCR amplification, the bidirectional expression plasmids pHW2000 and pCC1-DualPro were linearized, and the PCR products were purified and recovered using a Gel DNA Recovery Kit (Omega).

[0060] A universal upstream primer (SEQ ID NO.15) and genome segment corresponding specific downstream primers (SEQ ID NO.16 - 22) were designed and used. Using the bidirectional expression plasmids pHW2000 or pCC1 - DualPro as templates, PCR reactions were respectively carried out using high - fidelity DNA polymerase to obtain linearized pHW2000 and pCC1 - DualPro.

[0061] The primer sequences are as follows:

[0062] SEQ ID NO.15: 5’ - TACTGCTAATAACCCGGCGGCCCAAAATGCCG - 3’;

[0063] SEQ ID NO.16 (PB2): 5’ - TGACATCCTCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’,

[0064] SEQ ID NO.17 (PB1): 5’ - AAATCCTCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’,

[0065] SEQ ID NO.18 (P3): 5’ - CTAAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’,

[0066] SEQ ID NO.19 (HEF): 5’ - GAAAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’,

[0067] SEQ ID NO.20 (NP): 5’ - AATAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’, SEQ ID NO.21 (M): 5’ - ATATCCTCTGCTTATGCTCCCCCCCAAACTTCGGAGGTCGA - 3’, SEQ ID NO.22 (NS): 5’ - TACACCCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA - 3’.

[0068] To improve the ligation efficiency, overcome the restriction of restriction enzyme sites, and avoid the insertion of foreign sequences, in this example, homologous recombination enzymes (Sangon seamless cloning kit, Seamless Cloning Kit) were used to ligate the DNA fragments corresponding to the D / JY3002 genomic segment and the linearized bidirectional expression plasmid. The ligation product was transformed into DH5α competent cells, and the bacterial solution was spread onto an LB culture plate containing ampicillin (or chloramphenicol) and cultured overnight at 37°C in an inverted position. Single colonies were picked and inoculated into 5 mL of LB liquid medium containing antibiotics and cultured overnight at 37°C on a shaker. Colony PCR verification was performed using specific primers (SEQ ID NO.1-14).

[0069] When attempting to seamlessly clone the DNA fragment corresponding to the D / JY3002 HEF genomic segment into the pHW2000 vector, and then performing PCR verification and Sanger sequencing on the obtained colonies, it was found that the DNA fragment corresponding to the HEF genomic segment ligated into pHW2000 was deleted, as shown in Figure 3 A in. Lanes 1-7 in the figure are 7 randomly selected colonies. No specific DNA bands were detected in lanes 1-2, indicating that colonies 1-2 were negative colonies; while DNA bands were detected in lanes 3-7, but the size was significantly smaller than the size of the complete HEF gene band (such as Figure 3 lanes 1-2 in B in the figure), indicating that the HEF gene cloned into colonies 3-7 was deleted. Sanger sequencing further verified this result. To solve this problem, considering the instability of the DNA fragment corresponding to the HEF genomic segment in high-copy plasmids, the low yield of single-copy or low-copy plasmids, and the requirement for bidirectional expression characteristics, in this example, a new bidirectional expression vector pCC1-DualPro with controllable copy number (which will transform from a low-copy plasmid to a high-copy plasmid after adding an inducer) was newly modified and optimized, and the DNA fragment corresponding to the D / JY3002 HEF genomic segment was seamlessly cloned into this vector( Figure 4 ), and its nucleotide sequence is as shown in SEQ ID NO.30. Then, PCR verification and Sanger sequencing were performed on the obtained colonies, and it was found that the DNA fragment corresponding to the HEF genomic segment ligated into pCC1-DualPro was complete and correct( Figure 3B in lane 1-2), the copy number of the reconstructed bidirectional expression plasmid pCC1-DualPro is controllable, and the DNA fragment corresponding to the HEF genomic segment can be stably cloned and inserted into the pCC1-DualPro plasmid. The DNA fragments corresponding to other genomic segments of D / JY3002 were respectively seamlessly cloned into the pHW2000 vector, and the obtained colonies were verified by PCR and Sanger sequenced. Finally, bidirectional expression plasmids containing DNA fragments corresponding to each genomic segment of D / JY3002 were obtained. The constructed plasmids were named pHW2000-D / JY3002-PB2, pHW2000-D / JY3002-PB1, pHW2000-D / JY3002-P3, pCC1-DualPro-D / JY3002-HEF, pHW2000-D / JY3002-NP, pHW2000-D / JY3002-M, and pHW2000-D / JY3002-NS( Figure 5 ).

[0070] 3. Artificial rescue of influenza D virus and virus infection and passage

[0071] 3.1 Artificial rescue of influenza D virus

[0072] (1) One day before transfection, 293T cells and MDCK cells were seeded in a six-well cell culture plate at a ratio of 3:1 and co-cultured in an incubator at 5% CO2 and 37 °C. When the cell density reached 75%, transfection was started to be prepared.

[0073] (2) Before transfection, the required reagents were placed at room temperature to make their temperature consistent with room temperature, and the old cell culture medium was replaced with 1.5 mL of DMEM medium containing 10% fetal bovine serum but no antibiotics (this step is one of the key steps and is crucial for maintaining good cell status after transfection).

[0074] (3) Take 1 μg of each of the seven plasmids constructed above, and then add 200 μL of Opti-MEM and mix well.

[0075] (4) Slowly drop 20 μL of PEI-25K transfection reagent into the tube, gently pipette 6 times, and place it at room temperature for 25 min.

[0076] (5) Gently add the above-mentioned mixed solution into a six-well cell culture plate and culture it in an incubator at 37 °C for 6 - 9 h. (6) Replace the old culture medium with 1.7 mL of DMEM culture medium containing antibiotics (100 U / mL penicillin and 100 μg / mL streptomycin, the same below) and without fetal bovine serum, and after culturing at 37 °C for 36 - 42 h, supplement 500 μL of DMEM culture medium containing antibiotics and 1 μg / mL TPCK-trypsin (this step is different from the reverse genetic operation steps of other types of influenza viruses and is an operation step optimized according to the replication characteristics of influenza D virus).

[0077] (7) After continuing to culture at 37 °C for 3 - 4 d, detect the virus in the cell supernatant by hemagglutination assay. If the medium turns yellow during the process, 200 - 400 μL of DMEM culture medium containing antibiotics and 0.1 μg / mL TPCK-trypsin can be appropriately supplemented. Usually, the HA titer of the cell supernatant can reach 2 3 -2 6 HA units / 25 μL. In this example, the HA titer of the cell supernatant after 5 days of transfection is 2 6 HA units / 25 μL.

[0078] (8) Collect this cell supernatant, label it as the P0 generation virus, name it rD / JY3002, and thus obtain the artificially rescued influenza D virus rD / JY3002.

[0079] 3.2 Infection and passage of rD / JY3002

[0080] The whole-genome sequencing results show that the genomic sequence of rD / JY3002 is completely identical to that of the naturally isolated strain D / JY3002.

[0081] To confirm the successful rescue of the influenza D virus rD / JY3002, the infectivity and passage ability of rD / JY3002 were further verified. Inoculate 600 μL / well of the P0 generation virus into MDCK cells (six-well plate), incubate in an incubator at 37 °C for 1.5 - 2 hours, and then discard the inoculum and replace it with virus culture medium (DMEM culture medium containing antibiotics and 0.5 μg / mL TPCK-trypsin). Five days after inoculation, the virus titer in the cell supernatant was measured. The Reed-Muench method was used to determine the infectious dose of rD / JY3002 in the cell supernatant, which was 5.01x 10 6 TCID 50 / mL (TCID 50 : 50% Tissue Culture Infectious Dose, median cell culture infectious dose) ( Figure 6in A). Then, collect this cell supernatant, label it as the virus of passage P1, and name it rD / JY3002-P1. Inoculate 0.01 MOI of rD / JY3002-P1 into MDCK cells (six-well plate). Five days after inoculation, collect the cell supernatant, label it as the virus of passage P2, and name it rD / JY3002-P2, and measure its infectious titer. And so on, artificial rescued hepatitis D viruses of different passages were harvested successively as follows: rD / JY3002-P1, rD / JY3002-P2 (6.76x10 6 TCID 50 / mL), rD / JY3002-P3 (1.08x 10 6 TCID 50 / mL), rD / JY3002-P4 (5.01x 10 6 TCID 50 / mL) and rD / JY3002-P5 (5.25x 10 6 TCID 50 / mL) ( Figure 6 in B). By comparison, it was found that under the same inoculated virus amount of 0.01 MOI (Multiplicity of infection) and the same culture conditions, the infectious titer of rD / JY3002-P2 had no significant difference from that of the naturally isolated strain D / JY3002 (1.00x 10 7 TCID 50 / mL) ( Figure 6 in A), suggesting that the artificial rescue and the naturally isolated hepatitis D virus had comparable infectivity; there was also no significant difference in the infectious titers of artificially rescued hepatitis D viruses of different passages ( Figure 6 in B), suggesting that the artificially rescued hepatitis D virus could be stably passaged for at least five generations. The above results confirmed that in this example, a reverse genetic operating system for hepatitis D virus D / JY3002 of the D / Yama2019 genetic evolution lineage was successfully established.

[0082] 4. Artificial rescue of recombinant hepatitis D virus rD / JY3002-GFP carrying a green fluorescent reporter gene

[0083] 4.1 Design and synthesize the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240

[0084] The sequences at both ends of the influenza virus genome segment, including the non-coding region sequences and partial coding region sequences at both ends, can serve as the packaging signal sequences of the virus, controlling the transcription, replication, and packaging of the corresponding genome segment. Accordingly, when the exogenous gene is added with influenza virus packaging signal sequences at both ends to form an artificially modified genome segment, this genome segment can also be packaged into virus particles, thereby generating recombinant influenza virus. The recombinant influenza virus can infect host cells and express the exogenous gene in the host cells. In this example, 60bp, 120bp, 180bp, 240bp, or 300bp of the 5' and 3' ends of the D / JY3002 PB1 genome segment of influenza D virus were selected as the putative packaging signal sequences, and the green fluorescent reporter gene GFP was inserted between the putative packaging signal sequences at both ends. Then, the DNA fragment corresponding to this artificially modified genome segment was embedded between the HumanPol I promoter and the Murine Pol I terminator in the reverse direction, and a series of unidirectional expression plasmids were designed. The results showed that when 240bp sequences of the 5' and 3' ends of the D / JY3002 PB1 genome segment of influenza D virus were selected as the putative packaging signal sequences to construct the unidirectional expression plasmid, after the recombinant influenza virus obtained by using it infected the host cells, the GFP expression level was high and the most stable. This unidirectional expression plasmid was named pPolI-D / JY3002-PB1-240-GFP-240( Figure 7 ), and its nucleotide sequence is shown in SEQ ID NO.31.

[0085] 4.2 Artificial rescue of recombinant influenza D virus rD / JY3002-GFP

[0086] According to the operation steps in 3.1, seven bidirectional expression plasmids containing the corresponding DNA fragments of the D / JY3002 genome segment and the above unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 were co-transfected into cells. Five days after transfection, the HA titer of the cell supernatant reached 2 6 HA units / 25μL. This cell supernatant was collected, labeled as the P0 generation virus, named rD / JY3002-GFP, and its infection titer was measured to be 7.94x 10 4 TCID 50 / mL( Figure 8 B in). After infecting MDCK cells (six-well plate) with 0.05 MOI of rD / JY3002-GFP for 48 hours, green fluorescent protein expression could be observed in the infected cells under a fluorescence microscope( Figure 8 A in). Five days after infection, the cell supernatant was collected, labeled as the P1 generation virus, named rD / JY3002-GFP-P1, and its infection titer was measured to be 3.16x 10 6 TCID 50 / mL( Figure 8 B). After inoculating 0.05 MOI of rD / JY3002-GFP-P1 into new MDCK cells (six-well plate) for 48 hours, it was still possible to observe that the infected cells expressed green fluorescent protein under a fluorescence microscope ( Figure 8 A) in the above figure. The above results further confirmed that in this example, a reverse genetic operating system for D / Yama2019 genetically evolved lineage influenza D virus was successfully established and could be used to develop an influenza D virus vector for presenting foreign genes.

Claims

1. A set of primers for amplifying the full-length DNA fragment corresponding to the genome segment of influenza virus type D of the D / Yama2019 genetic evolution lineage, characterized in that: The primers contain nucleotide sequences as shown in SEQ ID NO.1-14.

2. A primer set for amplifying a linearized vector for seamless cloning, characterized in that: It comprises a universal upstream primer with a nucleotide sequence as shown in SEQ ID NO.15 and segment-specific downstream primers with nucleotide sequences as shown in SEQ ID NO.16-22.

3. A pCC1-DualPro vector, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

30.

4. A unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 carrying a green fluorescent reporter gene and a D / Yama2019 genetic evolution lineage influenza virus packaging signal, characterized in that: The nucleotide sequence is shown as SEQ ID NO.

31.

5. A method for constructing a reverse genetic operating system for influenza virus type D of the D / Yama2019 genetic evolution lineage, characterized in that: The following steps are involved: The DNA fragments corresponding to the PB2, PB1, P3, NP, M and NS segments were seamlessly cloned into the pHW2000 vector, and the DNA fragment corresponding to the HEF segment was seamlessly cloned into the pCC1-DualPro vector to obtain seven bidirectional expression plasmids, which were then co-transfected into cell lines to obtain artificially rescued D / Yama2019 genetic evolution lineage influenza D virus; The nucleotide sequences of the DNA fragments corresponding to the PB2, PB1, P3, NP, M and NS segments are shown in SEQ ID NO.23-25 ​​and SEQ ID NO.27-29 respectively, the nucleotide sequence of the DNA fragment corresponding to the HEF segment is shown in SEQ ID NO.26; the nucleotide sequence of the pCC1-DualPro vector is shown in SEQ ID NO.

30.

6. The method according to claim 5, characterized in that During co-transfection, seven bidirectional expression plasmids and the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 were co-transfected into the cell line; the nucleotide sequence of the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 is shown in SEQ ID NO.

31.

7. The method according to claim 5 or 6, characterized in that: The co-transfection into the cell line comprises the following steps: S1. One day before transfection, 293T cells and MDCK cells were plated in a 3:1 ratio in a six-well cell culture plate and co-cultured under the conditions of 5% CO2 and 37°C. When the cell density reached 75%, transfection was prepared. Before transfection, the old culture medium was replaced with 1.5 mL of DMEM culture medium containing 10% fetal bovine serum but without antibiotics. S2. Take 1 μg of each of the seven bidirectional expression plasmids described in claim 5 or the seven bidirectional expression plasmids described in claim 6 and the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240, then add 200 μL Opti-MEM and mix thoroughly, drop 20 μL PEI-25K transfection reagent, mix the mixture and let it stand for 25 minutes, add the mixture to the six-well cell culture plate in step S1, and culture at 37°C for 6-9 hours; S3. Replace the old culture medium with 1.7 mL of DMEM culture medium containing 100 U / mL penicillin and 100 μg / mL streptomycin and without fetal bovine serum. After culturing at 37°C for 36-42 h, supplement with 500 μL of DMEM culture medium containing 100 U / mL penicillin, 100 μg / mL streptomycin and 1 μg / mL TPCK-trypsin. Continue culturing for 3-4 days, and supplement with 200-400 μL of DMEM culture medium containing 100 U / mL penicillin, 100 μg / mL streptomycin and 0.1 μg / mL TPCK-trypsin when appropriate. S4. Wait until the HA titer of the cell supernatant reaches 2 3 -2 6 HA units / 25μL, collect the cell supernatant, and obtain the artificially rescued D / Yama2019 genetic evolution lineage type D influenza virus.

8. An artificially rescued D / Yama2019 genetic evolutionary lineage influenza virus constructed using the method described in any one of claims 5-7.

9. A D / Yama2019 genetic evolution lineage influenza virus reverse genetic operating system reagent set, characterized in that: It comprises the primer set according to claim 1, the primer set according to claim 2, the pCC1-DualPro vector according to claim 3 and the unidirectional expression plasmid pPolI-D / JY3002-PB1-240-GFP-240 according to claim 4.

Images