Recombinant baculovirus transfer vector as well as preparation method and application thereof

Abstract

The invention discloses a recombinant baculovirus transfer vector as well as a preparation method and application thereof. The recombinant baculovirus transfer vector comprises an early promoter and a late promoter which are arranged in sequence, and the downstream of the early promoter and the downstream of the late promoter are independently and operably connected with a porcine circovirus type 2 Cap protein coding frame. According to the recombinant baculovirus transfer vector, the copy number of exogenous genes of a traditional insect vector is greatly increased, the upper limit of the yield of the exogenous genes expressed by the vector is greatly improved, and by carefully designing the arrangement direction and sequence of coding frames of the recombinant baculovirus transfer vector, matching and combination of promoters in the morning and later periods and the like, the yield of the exogenous genes is improved. The high expression of the porcine circovirus PCV2 Cap protein in insect cells is realized.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and particularly to a recombinant baculovirus transfer vector, a preparation method thereof, and an application thereof. Background Art

[0002] Circoviruses (Circovirus genus, Circoviridae) are small, non-enveloped icosahedral viruses composed of a circular ssDNA genome approximately 1600 - 2200 nt in length. Four porcine circoviruses have been identified to date, and among them, porcine circovirus type 2 (PCV2) induces diseases in its host species and is the main pathogen of postweaning multisystemic wasting syndrome (PMWS).

[0003] PCV2 infections present in diverse manifestations, including postweaning multisystemic wasting syndrome (PMWS), porcine respiratory disease complex, porcine dermatitis and nephropathy syndrome, and reproductive and enteric disease forms. PCV2 is most commonly diagnosed as a co-pathogen, including classical swine fever virus (CSFV), pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), and porcine parvovirus (PPV). Currently, PMWS has caused great economic losses to the global pig industry. Most pig farms are infected with porcine circovirus to varying degrees, resulting in high mortality rates of piglets, affecting the growth and development of pigs, increasing feed conversion ratios, causing reproductive disorders in sows, increasing abortion and stillbirth rates, increasing drug costs, and increasing production costs. At present, vaccination remains one of the most effective means of preventing this disease. Traditional inactivated vaccines, subunit vaccines, chimeric vaccines, and synthetic peptide vaccines have been developed and put into use one after another. At the same time, laboratories around the world are also committed to developing novel live vector vaccines, nucleic acid vaccines, etc. The use of commercial vaccines and the continuous optimization of laboratory vaccines have played an important role in preventing and controlling PCV2 infections and improving the growth performance of pig herds.

[0004] At present, most of the PCV2 commercial vaccines are whole-virus inactivated vaccines. However, due to the weak proliferation ability of the whole virus in vitro cells and the difficult cultivation, the virus production titer is low, and a stable and high-concentration virus antigen cannot be provided. Therefore, the genetically engineered subunit vaccine is gradually occupying the market of traditional PCV2 commercial vaccines. Among them, the PCV2 subunit vaccine expressed by the insect baculovirus expression system is increasingly recognized by the market. Its expression system is relatively simple and has complete eukaryotic modification ability, and is becoming a main force in the prevention and control of PCV2 epidemic. Most of the traditional transfer vectors used in the insect baculovirus expression system only contain one Cap expression reading frame. For example, some reports have disclosed the use of recombinant baculovirus to express the Cap protein encoded by the PCV2 ORF2 gene and used it to prepare PCV2 vaccines. Other reports have disclosed the use of recombinant baculovirus to express the Cap protein encoded by the PCV2 ORF2 gene and used it to prepare PCV2 vaccines. Among them, the described recombinant baculovirus vector contains two Cap expression reading frames. Usually, the low copy number of foreign genes also limits the upper limit of protein expression. In addition, most of these vectors will select very late promoters such as the Bombyx mori nuclear polyhedrosis virus p10 or the Autographa californica multiple nucleocapsid nuclear polyhedrosis virus pPolh. The expression of foreign gene proteins mediated by them often results in significant accumulation of protein products. Due to the very late expression activity of the polyhedrin promoter, the released viral proteases cause significant cytopathological characteristics in the host cells. The effects of these and many other speculated uncertain factors may cause the host cells to produce protein inclusion bodies, protein misfolding or low secretion efficiency, resulting in poor protein quality, unstable expression between batches, and the target protein is easily degraded by host proteases in the late stage of expression, thus affecting the final yield, high cost of seed virus preparation and high MOI required for infection and other negative effects, which limit its application as the productivity of emerging vaccine enterprises and affect the development of the entire industry.

[0005] Therefore, how to further improve the efficiency of expressing PCV2 Cap protein by insect baculovirus, improve the protein quality, enhance the expression stability of subunit vaccines, and reduce the preparation cost of vaccine production has become an urgent problem to be solved in the industry. Summary of the Invention

[0006] Based on this, it is necessary to provide a recombinant baculovirus transfer vector, its preparation method and application.

[0007] In the first aspect of the present application, a recombinant baculovirus transfer vector is provided. The recombinant baculovirus transfer vector includes an early promoter and a late promoter arranged in sequence, and the downstream of the early promoter and the downstream of the late promoter are each independently and operably linked to a porcine circovirus type 2 Cap protein coding frame;

[0008] Optionally, the similarity between the nucleotide sequences of the porcine circovirus type 2 Cap protein coding frames is less than or equal to 85%.

[0009] In some embodiments, the early promoter includes at least one of the ORF81 promoter and the IE-1 promoter, and / or, the late promoter includes at least one of the p10 promoter and the pPolh promoter;

[0010] Optionally, the ORF81 promoter is derived from Helicoverpa armigera nucleopolyhedrovirus;

[0011] Optionally, the IE-1 promoter is derived from Autographa californica multiple nucleopolyhedrovirus;

[0012] Optionally, the p10 promoter is derived from Bombyx mori nucleopolyhedrovirus;

[0013] Optionally, the pPolh promoter is derived from Autographa californica multiple nucleopolyhedrovirus.

[0014] In some embodiments, the p10 promoter and the ORF81 promoter are arranged in the same direction in sequence; and / or,

[0015] the pPolh promoter and the IE-1 promoter are arranged in the same direction in sequence; and / or,

[0016] the p10 promoter and the pPolh promoter are arranged in the reverse direction in sequence.

[0017] In some embodiments, the nucleotide sequences of the porcine circovirus type 2 Cap protein coding frames are respectively as shown in SEQ ID NO: 1-4;

[0018] Optionally, the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence as shown in SEQ ID NO: 1 is linked to the downstream of the ORF81 promoter; and / or,

[0019] the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence as shown in SEQ ID NO: 2 is linked to the downstream of the p10 promoter; and / or,

[0020] the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence as shown in SEQ ID NO: 3 is linked to the downstream of the pPolh promoter; and / or,

[0021] the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence as shown in SEQ ID NO: 4 is linked to the downstream of the IE-1 promoter.

[0022] In some embodiments, the basic backbone of the recombinant baculovirus transfer vector includes the pFastBac Dual vector.

[0023] The second aspect of the present application provides a method for preparing the recombinant baculovirus transfer vector described in the first aspect of the present application, including the following steps:

[0024] In the backbone vector, the coding frame of the porcine circovirus type 2 Cap protein is inserted downstream of the early promoter and the late promoter respectively to obtain the recombinant baculovirus transfer vector.

[0025] The third aspect of the present application provides a method for preparing a recombinant bacmid, which includes transforming the recombinant baculovirus transfer vector described in the first aspect of the present application into Escherichia coli competent DH10Bac containing the shuttle vector Bacmid to generate the recombinant bacmid.

[0026] The fourth aspect of the present application provides a method for preparing a recombinant baculovirus, including transfecting the recombinant bacmid prepared by the method described in the second aspect of the present application into insect cells to package the recombinant baculovirus.

[0027] In some embodiments, the insect cells are selected from one or more of Sf9 cells and H5 cells.

[0028] The fifth aspect of the present application provides a method for preparing porcine circovirus Cap protein, inoculating the recombinant baculovirus prepared by the method described in the fourth aspect of the present application into host cells and culturing; and separating the porcine circovirus Cap protein from the obtained culture.

[0029] In some embodiments, the host cells are one or more of Sf9 cells and H5 cells;

[0030] In some embodiments, the culture is carried out by one or more of batch culture method, fed-batch culture method, semi-continuous perfusion culture method and continuous perfusion culture method.

[0031] The sixth aspect of the present application provides a method for preparing a vaccine preparation, which includes mixing the porcine circovirus Cap protein prepared by the method described in the fifth aspect of the present application with an adjuvant to obtain the vaccine preparation.

[0032] In some embodiments, the adjuvant includes one or more of aluminum adjuvant, Freund's adjuvant, AS03 adjuvant and MF59 adjuvant.

[0033] The recombinant baculovirus transfer vector provided by the embodiments of the present application greatly increases the copy number of foreign genes in traditional insect vectors, greatly improves the upper limit of the yield of foreign genes expressed by the vector, and realizes the high expression of porcine circovirus PCV2 Cap protein in insect cells by carefully designing the arrangement direction and order of the coding frames of the recombinant baculovirus transfer vector, the combination of early and late promoters, etc. Exemplarily, the above improvements cooperate with the codon optimization of foreign genes to efficiently express a large amount of porcine circovirus PCV2 Cap protein in insect host cells. During the cultivation process, the porcine circovirus PCV2 Cap protein has good stability, high quality and is not easily degraded, strong stability between batches, and low requirement for the inoculation dose, greatly reducing the cost of industrial production of seed virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments and implementations of the present application and to more completely understand the present application and its beneficial effects, the following will briefly introduce the drawings required for the description of the embodiments or implementations. Obviously, the following drawings are only some embodiments of the present application, and those skilled in the art can obtain other drawings without creative efforts based on these drawings.

[0035] Figure 1 Schematic diagram of the plasmid map of the recombinant baculovirus transfer vector in an embodiment of the present application;

[0036] Figure 2 Electrophoresis detection result diagram of the restriction enzyme digestion identification of the double-copy recombinant porcine circovirus PCV2 baculovirus transfer vector pFastBac Dual-Cap2X constructed in an embodiment of the present application, where "Agarose" refers to agarose;

[0037] Figure 3 Electrophoresis detection result diagram of the restriction enzyme digestion identification of the quadruple-copy recombinant porcine circovirus PCV2 baculovirus transfer vector pFastBac Dual-Cap4X constructed in an embodiment of the present application, where "Agarose" refers to agarose;

[0038] Figure 4 SDS-PAGE identification diagram of the recombinant porcine circovirus PCV2 baculovirus F0 generation expressing Cap protein in an embodiment of the present application. Among them, Figure a is the protein electrophoresis diagram of the supernatant collected at 120h, Figure b is the protein electrophoresis diagram of the supernatant collected at 144h, and Figure c is the percentage statistical result of the gray value analysis of the target protein bands in Figures a and b. The gray value of the loading band of the 300mg / L standard product is set to 100%, and the percentages of other experimental groups are calculated;

[0039] Figure 5This is the SDS-PAGE identification diagram of the recombinant porcine circovirus PCV2 baculovirus F1, F2, and F3 representative expression of the Cap protein in an embodiment of this application. Among them, Figure a is the SDS-PAGE identification diagram of the F1 generation seed virus expression, Figure b is the SDS-PAGE identification diagram of the F2 and F3 generation seed virus expressions, and Figure c is the percentage statistical result of the gray value analysis of the target protein bands in Figures a and b. The gray value of the loading band of the 300mg / L standard product is set to 100%, and the percentages of other experimental groups are calculated. Detailed implementation mode

[0040] To facilitate the understanding of this application, the following will describe this application more comprehensively with reference to the relevant attached drawings. The preferred embodiments of this application are shown in the attached drawings. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of this application more thorough and comprehensive.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the description of this application in this specification are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0042] In this application, "optionally", "optional", "option" mean optional, that is, it means any one of the two parallel options of "yes" or "no". If "optional" appears in a technical solution in multiple places, without special instructions and without contradictions or mutual restrictions, each "optional" is independent of each other.

[0043] In this application, "preferred", "better", "more preferable", "it is advisable" are only used to describe the embodiments or examples with better effects. It should be understood that they do not constitute a limitation on the protection scope of this application.

[0044] The terms "have", "contain", "include" and "comprise" used in this application are synonyms, which are inclusive or open-ended and do not exclude additional, unmentioned members or features. Members or features such as materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features also include actions, conditions for the occurrence of actions, timing, states, etc.

[0045] In this application, in the technical features or technical solutions described in an open language, the closed technical features or technical solutions composed of the listed contents are also included, and the open technical features or technical solutions containing the listed contents are also included.

[0046] In this application, for units related to data ranges, if a unit is only attached after the right endpoint, it means that the units of the left and right endpoints are the same.

[0047] In this application, for method processes involving multiple steps, unless there are clear different descriptions in this article, the execution of these steps has no strict order restriction, and they can be executed in an order other than the described one. Moreover, any step can include multiple sub-steps or multiple stages. These sub-steps or stages do not necessarily need to be completed at the same moment, but can be executed at different moments, and their execution order does not necessarily have to be sequential, but can be executed alternately or simultaneously with other steps or a part of the sub-steps or stages of other steps.

[0048] In this application, for exemplary descriptions such as "in some embodiments" or "in one embodiment", it can cover but is not limited to the following meaning: These solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0049] In this application, in "the first aspect", "the second aspect", "the third aspect", etc., the terms "first", "second", "third", etc. are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0050] In this application, for numerical intervals (i.e., numerical ranges), unless otherwise specified, the distribution of the optional numerical values within this numerical interval is considered continuous, and it includes the two numerical endpoints of this numerical interval (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within this numerical interval, it includes the two endpoint integers of this numerical range, as well as each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be combined. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein. The "numerical value" in this numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. The "numerical interval" allows for a broad inclusion of numerical interval types such as percentage intervals, ratio intervals, and ratio value intervals.

[0051] Currently, most of the transfer vectors traditionally used in the insect baculovirus expression system choose very late promoters such as the Bombyx mori nucleopolyhedrovirus p10 or the Autographa californica multiple nucleopolyhedrovirus pPolh. The expression of foreign gene proteins mediated by them often results in significant accumulation of protein products. Due to the very late expression activity of the polyhedrin promoter, the released viral proteases cause significant cytopathological characteristics in host cells. The effects of these and many other speculated uncertainties may cause host cells to produce protein inclusion bodies, protein misfolding or low secretion efficiency, resulting in poor protein quality, unstable expression between batches, and the target protein being easily degraded by host proteases in the late stage of expression, thus affecting the final yield. There are also negative effects such as high cost of seed virus preparation and high MOI required for infection, which limit its application as the productivity of emerging vaccine enterprises and affect the development of the entire industry. Therefore, how to further improve the efficiency of expressing PCV2 Cap protein by insect baculovirus, improve the protein quality, enhance the expression stability of subunit vaccines, and reduce the preparation cost of vaccine production has become an urgent problem to be solved in the industry.

[0052] Based on this, at least one embodiment of the present application provides a recombinant baculovirus transfer vector and its preparation method and application.

[0053] The vector provided by the embodiment of the present application greatly increases the copy number of foreign genes in traditional insect vectors, and through the carefully designed arrangement direction and order of coding frames, the unique combination of early and late promoters, and the codon optimization synergistic effect of foreign genes, it can efficiently express a large amount of porcine circovirus PCV2 Cap protein in insect host cells, which is 1.5 to more than 2 times the yield of the traditional double-copy expression scheme. At the same time, during the batch culture process, the target protein has good stability, high quality and is not easily degraded, strong stability between batches, and low requirement for inoculation dose, greatly reducing the cost of industrial production of seed virus.

[0054] In some embodiments, a recombinant baculovirus transfer vector for efficiently expressing porcine circovirus PCV2 Cap protein is provided. The recombinant baculovirus transfer vector uses pFastBac Dual as the basic backbone; in the backbone of the recombinant baculovirus transfer vector, the Bombyx mori nucleopolyhedrovirus p10 promoter, the Helicoverpa armigera nucleopolyhedrovirus ORF81 promoter, the Autographa californica multiple nucleopolyhedrovirus pPolh promoter and the IE-1 promoter are inserted. After each promoter sequence, a PCV2 ORF2 Cap protein coding frame is carried; the PCV2 ORF2 Cap protein coding frame is characterized in that ORF2 is the complete and unmodified PCV2b ORF2.

[0055] Preferably, the p10 promoter and the ORF81 promoter of the recombinant baculovirus transfer vector are arranged in the same orientation.

[0056] Preferably, the pPolh promoter and the IE-1 promoter of the recombinant baculovirus transfer vector are arranged in the same orientation.

[0057] Preferably, the p10 promoter and the pPolh promoter of the recombinant baculovirus transfer vector are arranged in the opposite orientation.

[0058] Preferably, the codons of the coding gene ORF2 of the PCV2 Cap protein coding frame are optimized according to the anabolic preference of insect cells.

[0059] Preferably, the similarity of the ORF2 nucleotide sequences within the 4 coding frames of the PCV2 Cap protein is less than 85%.

[0060] Preferably, the ORF2 nucleotide sequences within the 4 coding frames of the PCV2 Cap protein are the sequences shown in SEQ ID NO: 1 to 4.

[0061] In some embodiments, a method for constructing a recombinant baculovirus transfer vector for highly expressing porcine circovirus PCV2 Cap protein is provided. The construction method includes the following steps:

[0062] (1) Synthesize two sequences such as SEQ ID NO: 5 and SEQ ID NO: 6 in vitro, wherein SEQ ID NO: 5 specifically includes the PCV2 ORF2 Cap coding frame gene sequence, polyA, IE-1 promoter, and PCV2 ORF2 Cap coding frame gene sequence in sequence; SEQ ID NO: 6 specifically includes the PCV2 ORF2 Cap coding frame gene sequence, polyA, ORF81 promoter, and PCV2 ORF2 Cap coding frame gene sequence in sequence;

[0063] (2) Double-digest the commercial recombinant baculovirus transfer empty vector pFastBacDual and the sequence SEQ ID NO: 5 with the restriction endonucleases BamHI and HindIII respectively;

[0064] (3) Ligate the two fragments recovered after digestion in step (2) under the mediation of T4 ligase, and transform the DH5ɑ competent cells to obtain the positive recombinant vector pFastBac Dual-Cap2X;

[0065] (4) Double-digest the positive recombinant vector pFastBac Dual-Cap2X vector generated in step (3) and the sequence SEQ ID NO: 6 with the restriction endonucleases XhoI and KpnI respectively;

[0066] (5) Ligate the two fragments recovered after digestion in step (4) under the mediation of T4 ligase, and transform competent DH5ɑ to obtain the final recombinant baculovirus transfer vector pFastBac Dual-Cap4X that highly expresses porcine circovirus PCV2 Cap protein.

[0067] In some embodiments, an application of a recombinant baculovirus transfer vector that highly expresses porcine circovirus PCV2 Cap protein is provided, and the application includes the following steps:

[0068] (1) Transform the recombinant baculovirus transfer vector pFastBac Dual-Cap4X that highly expresses porcine circovirus PCV2 Cap protein into competent Escherichia coli DH10Bac containing the shuttle vector Bacmid by heat shock, and generate recombinant baculovirus bacmid DNA through homologous recombination;

[0069] (2) Transfect Sf9 cells chemically with the recombinant baculovirus bacmid DNA generated in step (1) to package recombinant baculovirus;

[0070] (3) Use the recombinant baculovirus generated in step (2) to infect healthy insect expression host cells;

[0071] (4) Wait until all host cells are lysed, and harvest the supernatant virus suspension;

[0072] (5) Further isolate and purify the recombinant PCV2 Cap protein from the virus suspension, and mix it with an adjuvant to prepare a subunit vaccine.

[0073] Preferably, the insect expression host cell is H5 cell.

[0074] Preferably, the insect expression host cell is Sf9 cell.

[0075] Preferably, the container for culturing host cells and using for virus infection culture in step (3) is a bioreactor.

[0076] Preferably, the virus culture adopts any one or combination of batch culture method, fed-batch culture method, semi-continuous perfusion culture method or continuous perfusion culture method.

[0077] In the first aspect of the present application, a recombinant baculovirus transfer vector is provided, which includes an early promoter and a late promoter arranged in sequence, and the downstream of the early promoter and the downstream of the late promoter are each independently and operably linked to the coding frame of porcine circovirus type 2 Cap protein.

[0078] In this application, unless otherwise specified, "arranged in sequence" means that the early promoter and the late promoter are distributed in a specific sequential direction on the DNA sequence of the transfer vector, including co-directional arrangement in sequence and reverse arrangement in sequence.

[0079] In this application, unless otherwise specified, "operably linked" refers to the functional relationship between the coding frame of the Porcine circovirus type 2 Cap protein and the early promoter and the late promoter, wherein the coding frame of the Porcine circovirus type 2 Cap protein is linked downstream of the early promoter and the late promoter to generate a recombinant baculovirus transfer vector.

[0080] In this application, unless otherwise specified, the "coding frame of the Porcine circovirus type 2 Cap protein" refers to the open reading frame (ORF2) in the genome of Porcine circovirus type 2 that encodes the major structural protein Cap.

[0081] The recombinant baculovirus transfer vector provided in the embodiments of this application greatly increases the copy number of foreign genes of traditional insect vectors, greatly improves the upper limit of the yield of the vector expressing foreign genes, and realizes the high expression of Porcine circovirus PCV2 Cap protein in insect cells by carefully designing the arrangement direction and sequence of the coding frame of the recombinant baculovirus transfer vector, the combination of early and late promoters, etc.

[0082] In some embodiments, the codons of the coding frame of the Porcine circovirus type 2 Cap protein are optimized, and the similarity between the nucleotide sequences of the coding frame of the Porcine circovirus type 2 Cap protein is less than or equal to 85% (such as 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, etc.).

[0083] Exemplarily, through the coordinated cooperation of the arrangement direction and sequence of the coding frame, the combination of early and late promoters, and the codon optimization of foreign genes, the Porcine circovirus PCV2 Cap protein can be efficiently expressed in large quantities in insect host cells. During the culture process, the Porcine circovirus PCV2 Cap protein has good stability, high quality and is not easily degraded, strong stability between batches, and low requirement for the inoculation dose, greatly reducing the cost of industrial production of seed virus.

[0084] In some embodiments, the early promoter includes at least one of the ORF81 promoter and the IE-1 promoter, and / or, the late promoter includes at least one of the p10 promoter and the pPolh promoter.

[0085] In some embodiments, the ORF81 promoter is derived from Helicoverpa armigera nuclear polyhedrosis virus.

[0086] In some embodiments, the IE-1 promoter is derived from Autographa californica multiple nucleocapsid nuclear polyhedrosis virus.

[0087] In some embodiments, the p10 promoter is derived from Bombyx mori nucleopolyhedrovirus.

[0088] In some embodiments, the pPolh promoter is derived from Autographa californica multiple nucleopolyhedrovirus.

[0089] In some embodiments, the early promoter and the late promoter are arranged in the same direction; the late promoters are arranged in the reverse direction.

[0090] In some embodiments, the p10 promoter and the ORF81 promoter are arranged in the same direction.

[0091] In some embodiments, the pPolh promoter and the IE-1 promoter are arranged in the same direction.

[0092] In some embodiments, the p10 promoter and the pPolh promoter are arranged in the reverse direction.

[0093] It should be noted that the combination of the early promoter and the late promoter in the embodiments of the present application is not limited to the above, and the combination of different early promoters and late promoters can achieve the technical effects of the present application.

[0094] In some embodiments, the nucleotide sequences of the optimized porcine circovirus type 2 Cap protein coding frames are shown in SEQ ID NOs: 1 to 4 respectively.

[0095] In some embodiments, the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence shown in SEQ ID NO: 1 is linked to the downstream of the ORF81 promoter.

[0096] In some embodiments, the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence shown in SEQ ID NO: 2 is linked to the downstream of the p10 promoter.

[0097] In some embodiments, the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence shown in SEQ ID NO: 3 is linked to the downstream of the pPolh promoter.

[0098] In some embodiments, the porcine circovirus type 2 Cap protein coding frame with the nucleotide sequence shown in SEQ ID NO: 4 is linked to the downstream of the IE-1 promoter.

[0099] It should be noted that the position of the porcine circovirus type 2 Cap protein coding frame in the embodiments of the present application is not limited to the above, and the combination of different porcine circovirus type 2 Cap protein coding frames and promoters can also achieve the technical effects of the present application.

[0100] In some embodiments, the basic backbone of the recombinant baculovirus transfer vector comprises the pFastBac Dual vector.

[0101] In a second aspect of the present application, there is provided a method for preparing the recombinant baculovirus transfer vector of the first aspect of the present application, comprising the following steps:

[0102] In the backbone vector, the coding frame of the porcine circovirus type 2 Cap protein is inserted downstream of the early promoter and the late promoter respectively to obtain the recombinant baculovirus transfer vector.

[0103] In a third aspect of the present application, there is provided a method for preparing a recombinant bacmid, which comprises transforming the recombinant baculovirus transfer vector of the first aspect of the present application into Escherichia coli competent DH10Bac containing the shuttle vector Bacmid to generate the recombinant bacmid.

[0104] In a fourth aspect of the present application, there is provided a method for preparing a recombinant baculovirus, which comprises transfecting the recombinant bacmid of the third aspect of the present application into insect cells to package and obtain the recombinant baculovirus.

[0105] In the present application, unless otherwise specified, "packaging" means that within insect cells, using the baculovirus genome in the recombinant bacmid as a template, various components of the virus are synthesized, and these components are assembled into infectious recombinant baculovirus particles.

[0106] In some embodiments, the insect cells are selected from one or more of Sf9 cells and H5 cells.

[0107] In a fifth aspect of the present application, there is provided a method for preparing porcine circovirus Cap protein, which comprises inoculating the recombinant baculovirus prepared by the method of the fourth aspect of the present application into host cells and culturing; and separating the porcine circovirus Cap protein from the obtained culture.

[0108] In some embodiments, the host cells are one or more of Sf9 cells and H5 cells.

[0109] In some embodiments, the culturing adopts one or more of batch culture method, fed-batch culture method, semi-continuous perfusion culture method and continuous perfusion culture method.

[0110] In a sixth aspect of the present application, there is provided a method for preparing a vaccine preparation, which comprises mixing the porcine circovirus Cap protein prepared by the method of the fifth aspect of the present application with an adjuvant to obtain the vaccine preparation.

[0111] In the present application, unless otherwise specified, an "adjuvant" refers to a substance that, when added to an immunogenic agent such as an antigen, non-specifically enhances or potentiates the immune response to the immunogenic agent in an individual subject exposed to the mixture.

[0112] In some embodiments, the adjuvant includes one or more of an aluminum adjuvant, Freund's adjuvant, AS03 adjuvant, and MF59 adjuvant.

[0113] Some examples are provided below.

[0114] The embodiments of the present application will be described in detail below in conjunction with the examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specified conditions in the following examples, the guidance given in the present application is preferably referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturers, or by referring to the experimental methods known in the art.

[0115] In the following examples, for the measurement parameters of the raw material components, unless otherwise specified, there may be slight deviations within the weighing accuracy range. For the temperature and time parameters, acceptable deviations caused by the instrument test accuracy or operation accuracy are allowed.

[0116] The information of the sequences involved in the following examples is provided in Table 1 below.

[0117] Table 1

[0118]

[0119] SEQ ID NO: 1: gagctcatgacctacccaagacgcagatacagacgcagaagacaccgcccacgctcccatctgggtcagattttgagacgcagaccttggctggtgcaccctagacaccgctacagatggagacgcaagaatggaatcttcaacacccgcttgtctcgcacttttggttacaccatcaagagaactactgtgagaactccatcctgggctgtggacatgatgagattcaacatcaacgacttcttgccacctggtggtggttccaacccacgctccgtcccattcgagtattaccgcatcagaaaggtgaaagtggagttttggccatgttccccaatcactcaaggtgatagaggagtgggttcctccgctgtgatcttggacgacaactttgtgactaaggctactgctctgacttacgatccatacgtgaattattcttctcgccatactatcactcagccattctcctatcactcccgctatttcactccaaagcctgtcctggactctactatcgactactttcagccaaataataagcgcaaccaactgtggttgagattgcagaccgccggtaacgtggaccacgtgggtctgggtactgctttcgaaaactccatctacgaccaagagtacaatatcagagtgaccatgtatgtgcagttcagagagttcaacctgaaagaccctccactgaatccataaggtaccgggagatgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatga。

[0120] SEQ ID NO: 2: atgacttatccaagaagacgctaccgcagacgccgccacagacctagatctcacctgggtcagatcctgcgcagaagaccatggctggtccacccacgccacagatacagatggagaagaaagaacggaattttcaacactagactgtcccgcaccttcggatacaccattaagagaaccactgtgagaaccccatcctgggctgtggacatgatgcgcttcaatattaacgacttcttgcctcctggtggtggttccaaccctagatccgtgcctttcgagtactacagaatccgcaaggtgaaggtcgagttctggccatgctccccaattactcaaggtgaccgcggtgtgggttcctccgccgtcattctggacgacaattttgtgactaaggctactgctctgacttacgacccttatgtgaactactcctctcgccatactatcactcagcctttctcctaccactcccgctactttactccaaagcctgtgctggactccactatcgactattttcagccaaacaacaagagaaaccaactgtggttgagactgcaaaccgccggaaacgtggaccatgtgggtttgggaactgccttcgagaactccatctatgaccaagagtacaacatcagagtcactatgtacgtgcagtttcgcgaatttaacctgaaagacccaccactgaacccataa。

[0121] SEQ ID NO: 3: atgacttaccctcgcagaagatacagacgcagaagacacagaccaagatcccacctgggtcaaatcctgagacgcagaccatggctggtgcacccacgccaccgctatcgctggcgcagaaagaacggtattttcaatactagactgtcccgcactttcggttacactatcaagcgcactactgtgagaactccttcttgggctgtggatatgatgagatttaatatcaacgacttcttgcctcctggtggaggttctaatccaagatccgtgcctttcgagtactacagaatcagaaaagtgaaggtggagttctggccatgctccccaattactcaaggtgatagaggtgtgggttcttccgccgtcatcttggacgacaacttcgtcaccaaggctactgccctgacttacgacccttacgtgaactactcctctcgccacaccatcactcagcctttctcctaccattcccgctacttcactcctaagcctgtgctggattctactatcgactactttcagcctaacaacaagagaaatcagctgtggttgcgcttgcagactgccggaaacgtggaccacgtgggtctgggaaccgctttcgaaaactccatctacgaccaagagtataacatcagagtcaccatgtacgtgcagttcagagagttcaatctgaaggaccctccactgaacccataa。

[0122] SEQ ID NO: 4: atgacctacccaagacgcagatatagacgcagaagacatagaccacgctcccatctgggtcagatcctgagacgcagaccttggttggtgcatcctagacaccgctacagatggagaagaaagaacggaatcttcaacactagactgtctcgcacttttggttatactatcaagagaactaccgtgagaactccatcctgggctgtggacatgatgagattcaacattaacgacttcctgccacctggtggtggttccaatcctagatccgtcccatttgagtactatagaattagaaaggtgaaggtggagttctggccttgttctcctattactcaaggtgacagaggtgtgggatcttctgctgtgatcctggacgacaattttgtgaccaaggccaccgctctgacttacgatccatacgtgaactattcttcccgccacactatcactcaaccattctcttaccactcccgctatttcactccaaagcctgtcctggactccactattgactattttcagccaaacaataagagaaatcagctgtggctgagattgcagactgctggtaacgtcgatcacgtcggattgggtactgccttcgagaactctatttatgaccaagagtacaatatcagagtgactatgtacgtgcaattccgcgagttcaacctgaaggacccaccattgaacccataa。

[0123]

[0124]

[0125] Unless otherwise specified, the molecular biology experimental methods used in this application are basically carried out with reference to the methods described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and FM Ausubel et al., Compiled Molecular Biology Laboratory Manual, 3rd Edition, John Wiley & Sons, Inc., 1995. It is known to those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of protection claimed in this application.

[0126] Example 1

[0127] 1. Construction of recombinant porcine circovirus PCV2 Cap baculovirus transfer vector.

[0128] In this example, the commercial vector pFastBac Dual was selected as the basic construction framework. In brief, the nucleotide sequences of two expression units were first synthesized in vitro, each of which contained two PCV2b ORF2 Cap protein reading frames, restriction sites, promoters, and polyA sequences. Then, the two sequences were sequentially inserted into the multiple cloning site of pFastBac Dual by restriction enzyme ligation to generate a recombinant porcine circovirus PCV2 Cap baculovirus transfer vector with four promoters and four PCV2b ORF2 reading frames, such as Figure 1 shown.

[0129] The specific steps are as follows:

[0130] 1. Obtaining the target gene and synthesizing the target sequence

[0131] According to the nucleotide sequence of the porcine circovirus PCV2b ORF2 gene (NCBI accession number EU340257.1) published by GENEBANK, the amino acid sequence of its Cap CDS region (NCBI accession number ABY56251.1) was selected as the object of this embodiment. The amino acid sequence was entrusted to Suzhou Jinweizhi Biological Outsourcing Service to optimize the 4 corresponding Cap nucleotide sequences according to the codon preference of insect cells, and ensure that the similarity between any two of the 4 Cap nucleotide sequences is less than or equal to 85%. The optimized Cap nucleotide sequence is shown in SEQ ID NO: 1~4. The 4 Cap nucleotide sequences were divided into two groups for sequence design, and the two Cap nucleotides in each group were arranged in the same direction in the 5'~3' order, and the heads and tails were connected by adding additional promoters and polyA sequences to form two synthetic sequences for insertion into the recombinant vector as shown in SEQ ID NO: 5~6, and submitted to Suzhou Jinweizhi Biological Outsourcing Service for synthesis.

[0132] 2. Cloning and Insertion of the Target Sequence

[0133] Extract the intermediate plasmid DNA containing SEQ ID NO: 5-6 sequences delivered by Genewiz Suzhou.

[0134] Use BamHI and HindIII endonucleases to perform double digestion on SEQ ID NO: 5 and the commercial vector pFastBac Dual respectively, and recover the digestion products; ligate the digestion products from the previous step with T4 ligase and transform DH5ɑ competent cells. Pick positive clones on the Amp + resistance plate, extract plasmid DNA, and perform BamHI and HindIII double digestion identification. The identification results after separation by agarose gel electrophoresis are as Figure 2 shown. pFastBac Dual-Cap2X clones 4, 5, and 6 all showed positive bands at approximately 2000bp. Therefore, select clone 6 to excise the target 2000bp band, send it to Genewiz Suzhou for gene sequencing, save the clones with correct sequencing results, and name them pFastBac Dual-Cap2X.

[0135] Use XhoI and KpnI endonucleases to perform double digestion on SEQ ID NO.6 and pFastBac Dual-Cap2X plasmid DNA respectively, and recover the digestion products; ligate the digestion products from the previous step with T4 ligase and transform DH5ɑ competent cells. Pick positive clones on the Amp + resistance plate, extract plasmid DNA, and perform XhoI and KpnI double digestion identification. The identification results after separation by agarose gel electrophoresis are as Figure 3 shown. pFastBac Dual-Cap4X clone 8 showed a positive band at approximately 1800bp. Therefore, select clone 8 to excise the target-sized band, send it to Genewiz Suzhou for gene sequencing, save the clones with correct sequencing results, and name them pFastBac Dual-Cap4X.

[0136] II. Expression and Identification of Recombinant Viral Proteins

[0137] According to the standard procedure of the Bac-to-Bac system, the recombinant baculovirus was packaged and prepared. Briefly, the recombinant transfer vectors pFastBac Dual-Cap2X and pFastBac Dual-Cap4X constructed in Step 1 were respectively transformed into Escherichia coli DH10Bac. After screening on a triple-antibody blue-white screening plate, the recombinant bacmid-Cap2X with two copies of the ORF2 Cap coding gene inserted and the recombinant plasmid bacmid-Cap4X with two copies of the ORF2 Cap coding gene inserted were obtained. The above recombinant bacmids bacmid-Cap2X and bacmid-Cap4X were chemically transfected into the insect host cell Sf9 for virus packaging. After co-culture, the cell lysate supernatant was harvested, and finally, the F0 generation recombinant baculoviruses rBacPCV2-Cap2X and rBacPCV2-Cap4X seed viruses were obtained respectively.

[0138] The insect H5 host cells were cultured in suspension using the commercial serum-free medium Insect SFM 1407 from Jianshun Biotech. The cells were passaged at a seeding density of 0.5×10 6 cells / mL, and the passage frequency was once every 2 days. When the cell density reached 5×10 6 cells / mL stably on Day 2 and the cell viability was greater than 95%, virus infection was carried out. Briefly, the H5 cells to be inoculated with the virus were resuspended with fresh Insect SFM 1407 medium, and the inoculated cell density was uniformly adjusted to 2.5×10 6 cells / mL. The recombinant baculoviruses rBacPCV2-Cap2X and rBacPCV2-Cap4X were inoculated into the resuspended cell suspension, and the multiplicity of infection (MOI) was 0.01. The culture conditions were pH 6.0 - 6.5, temperature 27°C, humidity 80%, and 90 - 120 rpm@50mm orbital diameter (rotating orbital diameter).

[0139] After all the cells were lysed, the culture was terminated, and the cell lysate supernatant was harvested. 20 µL of the supernatant was mixed with Loading Buffer to prepare the loading sample, and then SDS-PAGE was performed to compare the expression levels of the target protein in different samples. The SDS-PAGE electrophoresis results are as Figure 4As shown, after 120 h of virus inoculation and infection, the recombinant baculovirus rBacPCV2-Cap4X can express a large amount of Cap protein. The protein electrophoresis pattern was analyzed for band gray values. In the examples of this application, the yield of the recombinant virus with a four-copy design was approximately 50% higher than that of the traditional two-copy virus. After 144 h of virus inoculation and infection, this yield advantage could be expanded to 68%. Additionally, during the preparation process, the yields of Cap protein expressed by the rBacPCV2-Cap4X parallel groups packaged from different bacmid clones were very stable ( Figure 4 Figure a in Figure 4 and Figure c in Figure 4 Figure b in Figure 4 and Figure c in

[0140] Example 2

[0141] Using the F0 generation recombinant baculoviruses rBacPCV2-Cap2X and rBacPCV2-Cap4X in Example 1 as seed viruses, after infecting Sf9 cells, co-culture was carried out. After all the cells were lysed, the supernatant was harvested, which was the F1 generation seed virus. The F1 generation seed virus was used to continue infect healthy Sf9 cells to harvest the F2 generation, and so on, to harvest the F3 generation seed virus.

[0142] Using the commercial serum-free medium Insect SFM 1407 from Jianshun Biotech, the insect H5 host cells were cultured in suspension. Subculture was carried out at a cell seeding density of 0.5×10 6 cells / mL, and the subculture frequency was once every 2 days. When the cell density reached 5×10 6 cells / mL stably on Day 2 and the viability was greater than 95%, virus infection was carried out. Briefly, the H5 cells to be inoculated with virus were resuspended with fresh Insect SFM 1407 medium, and the inoculated cell density was uniformly adjusted to 2.5×10 6 cells / mL. The F1 generation or F2 generation or F3 generation recombinant baculoviruses rBacPCV2-Cap2X and rBacPCV2-Cap4X seed viruses were inoculated into the resuspended cell suspension, and the multiplicity of infection (MOI) was 0.01. The culture conditions were pH 6.0 - 6.5, temperature 27°C, humidity 80%, and 90 - 120 rpm@50 mm orbital diameter.

[0143] After all the cells were lysed, the culture was terminated and the cell lysate supernatant was harvested. 20 µL of the supernatant was taken and mixed with Loading Buffer to prepare the loading sample, and then SDS-PAGE was performed to compare the expression levels of the target protein in different samples. The SDS-PAGE electrophoresis results are as Figure 5 shown. The protein yield of the recombinant baculovirus rBacPCV2-Cap4X was significantly higher than that of rBacPCV2-Cap2X under the same conditions in different generations. Among them, the seed virus yield of rBacPCV2-Cap4X F1 generation was about 60% higher than that of rBacPCV2-Cap2X F1 generation on average, the seed virus yield of F2 generation was about 87% higher year-on-year on average, and the seed virus yield of F3 generation was about 83% higher year-on-year on average ( Figure 5 Figure a in Figure 5 and Figure 5 Figure b in). The recombinant baculovirus rBacPCV2-Cap4X still had a protein expression level of about 150 mg / L in the F3 generation, while the traditional double-copy rBacPCV2-Cap2X could only maintain 80 mg / L (

[0144] Figure c in). The above results prove that the four-copy vector in the embodiments of the present application has great advantages in the application field of expressing porcine circovirus PCV2 recombinant baculovirus, can provide strong seed virus resources for the industrial vaccine production industry, greatly reduces the production cost of enterprises in the seed virus preparation link, improves the protein yield at the same time, meets the supply demand of porcine circovirus subunit vaccines in the market, and effectively helps the prevention and control of veterinary breeding epidemics. In summary, the embodiments of the present application creatively provide a vector, a construction method and an application for efficiently expressing porcine circovirus PCV2 Cap protein. The vector provided by the embodiments of the present application greatly increases the number of foreign gene copies of the traditional insect vector, so it greatly improves the upper limit of the vector to express the yield of foreign genes. The vector provided by the embodiments of the present application contains a total of four Cap protein coding reading frames, and each reading frame has an independent and different promoter to initiate transcription and expression. The four Cap protein coding reading frames are carefully designed in the arrangement direction and order. The four sets of expression units are divided into two groups, and the two groups of units are distributed back to back to reduce the cross influence of upstream and downstream sequences. Each group of expression units contains a combination of an early promoter and a very late promoter, which can have a stable protein expression ability throughout the virus infection cycle and relieve the late-stage cell metabolic pressure. At the same time, the codons of foreign genes are carefully optimized for insect cells, which can effectively reduce the gene sequence similarity of the four Cap protein expression reading frames, reduce the difficulty of vector construction, and maintain the transcriptional and translational stability of protein expression. Therefore, the present application improves the efficiency of expressing PCV2 Cap protein by insect baculovirus, improves the protein quality, enhances the expression stability of subunit vaccines, reduces the preparation cost of vaccine production, and also provides a powerful expression scheme for expressing foreign proteins by insect baculovirus expression system, with broad commercial application prospects.

[0145] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.

[0146] The above-described embodiments only represent several implementation manners of the present application, and the description thereof is relatively specific and detailed. However, it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims, and the specification and the drawings can be used to explain the scope of the claims.

Claims

1. A recombinant baculovirus transfer vector, characterized in that: The recombinant baculovirus transfer vector comprises an early promoter and a late promoter arranged in sequence, and the downstream of the early promoter and the downstream of the late promoter are independently and operably connected to the porcine circovirus type 2 Cap protein coding frame; Optionally, the similarity between the nucleotide sequences of the porcine circovirus type 2 Cap protein coding frames is less than or equal to 85%.

2. The recombinant baculovirus transfer vector according to claim 1, characterized in that The early promoter includes at least one of an ORF81 promoter and an IE-1 promoter, or / and the late promoter includes at least one of a p10 promoter and a pPolh promoter; Optionally, the ORF81 promoter is derived from Helicoverpa armigera nuclear polyhedrosis virus; Optionally, the IE-1 promoter is derived from Autographa californica multinucleocapsid nuclear polyhedrosis virus; Optionally, the p10 promoter is derived from Bombyx mori nuclear polyhedrosis virus; Optionally, the pPolh promoter is derived from Autographa californica multinucleocapsid nuclear polyhedrosis virus.

3. The recombinant baculovirus transfer vector according to claim 2, characterized in that The p10 promoter and the ORF81 promoter are arranged in the same direction; or / and, The pPolh promoter and the IE-1 promoter are arranged in the same direction; or / and, The p10 promoter and the pPolh promoter are arranged in reverse order.

4. The recombinant baculovirus transfer vector according to claim 3, characterized in that The nucleotide sequences of the porcine circovirus type 2 Cap protein coding frames are shown in SEQ ID NOs: 1 to 4, respectively; Optionally, the nucleotide sequence is as shown in SEQ ID NO: 1, the porcine circovirus type 2 Cap protein coding frame is connected to the downstream of ORF81 promoter; or / and, The nucleotide sequence is as shown in SEQ ID NO: 2, wherein the porcine circovirus type 2 Cap protein coding frame is connected to the downstream of the p10 promoter; or / and, The nucleotide sequence is as shown in SEQ ID NO: 3, wherein the porcine circovirus type 2 Cap protein coding frame is connected to the downstream of the pPolh promoter; or / and, The porcine circovirus type 2 Cap protein coding frame of the nucleotide sequence as shown in SEQ ID NO: 4 is connected to the downstream of the IE-1 promoter.

5. The recombinant baculovirus transfer vector according to any one of claims 1 to 4, characterized in that The basic framework of the recombinant baculovirus transfer vector includes the pFastBac Dual vector.

6. A method for preparing the recombinant baculovirus transfer vector according to any one of claims 1 to 5, characterized in that: The steps include: In the backbone vector, the porcine circovirus type 2 Cap protein coding frame is respectively inserted into the downstream of the early promoter and the late promoter to prepare the recombinant baculovirus transfer vector.

7. A method for preparing a recombinant bacmid, characterized in that: The method comprises transforming the recombinant baculovirus transfer vector according to any one of claims 1 to 5 into the competent Escherichia coli DH10Bac containing the shuttle vector Bacmid to produce the recombinant bacmid.

8. A method for preparing a recombinant baculovirus, characterized in that: The method comprises transfecting the recombinant bacmid prepared by the method of claim 7 into insect cells to package the recombinant baculovirus; Optionally, the insect cells are selected from one or more of Sf9 cells and H5 cells.

9. A method for preparing porcine circovirus Cap protein, characterized in that: The method comprises inoculating host cells with the recombinant baculovirus prepared by the method according to claim 8 and culturing the cells; and isolating the porcine circovirus Cap protein from the obtained culture; Optionally, the host cell is one or more of Sf9 cells and H5 cells; Optionally, the culturing adopts one or more of a batch culture method, a fed-batch culture method, a semi-continuous perfusion culture method and a continuous perfusion culture method.

10. A method for preparing a vaccine preparation, characterized in that: The method comprises mixing the porcine circovirus Cap protein prepared by the method according to claim 9 with an adjuvant to obtain the vaccine preparation; Optionally, the adjuvant includes one or more of aluminum adjuvant, Freund's adjuvant, AS03 adjuvant and MF59 adjuvant.

Images