Method for auxiliary identification of pig feed conversion ratio and molecular marker thereof

Abstract

The invention discloses a method for assisting in identifying the feed conversion ratio of pigs and a molecular marker thereof, and belongs to the technical field of biology. The method comprises the following steps: detecting the genotype of an SNP (Single Nucleotide Polymorphism) site in a pig genome to be detected, and according to the feed conversion ratio of the genotype pig, the SNP site is located at the 3714623rd site of a No.17 chromosome in a pig reference genome (Susscrofa.Sscrofa11.1), and the No.17 chromosome in the pig reference genome (Susscrofa.Sscrofa11.1) is shown as SEQ ID NO: 1. The method is of great significance to selection of pig breeds with low feed conversion ratio.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for assisting in identifying the feed conversion ratio of pigs and its molecular markers. Background Art

[0002] The feed conversion ratio (FCR) is a measure of the feed utilization efficiency of pigs, which refers to the amount of feed consumed per unit of weight gain, generally calculated by dividing feed intake by weight gain. Its heritability is between 0.31 and 0.39. The lower the value, the more feed is saved (Homma et al. 2021, Reference: Homma C, Hirose K, Ito T, Kamikawa M, Toma S, Nikaido S, Satoh M, Uemoto Y. Estimation of genetic parameter for feed efficiency and resilience traits in three pig breeds. Animal. 2021 Nov;15(11):100384.). Since the feed cost accounts for about 70% of the pig breeding cost, currently, each breeding company attaches more and more importance to the selection of the FCR trait. For example, in the breeding goal of Danbred, the importance of FCR exceeds 30%.

[0003] However, since the determination of FCR traits requires not only specialized equipment but also a relatively long time span, its determination not only greatly increases the breeding cost but also poses great difficulties in implementation. The rapid development of molecular biotechnology and the development of pig genome-wide association analysis technology have provided methods for the discovery and development of FCR molecular markers, and also made it possible to carry out more accurate and rapid breeding selection for quantitative traits such as FCR. At present, some studies have explored genes related to FCR. For example, Miao et al. (2021, reference: Miao, Y., Q. Mei, C. Fu, M. Liao, Y. Liu, X. Xu, X. Li, S. Zhao, and T. Xiang. 2021. Genome-wide association and transcriptome studies identify candidate genes and pathways for feed conversion ratio in pigs. BMC Genomics. 22:294) conducted a genome-wide association study (GWAS) on the FCR trait of pigs and found that the GRIP1 gene may affect FCR through glutamatergic and GABAergic signaling pathways; the research by Maria et al. (2025, reference: Silva MRGD, Veroneze R, Marques DBD, Silva DAD, Machado II, Brito LF, Lopes PS. A meta-analysis of genome-wide association studies to identify candidate genes associated with feed efficiency traits in pigs. J Anim Sci. 2025 Jan 4;103:skaf010.) showed that the MED18, PHACTR4, ABCC2, TRHDE, FRS2, FAR2, and FIS1 genes are candidate genes for FCR. However, since FCR is a trait controlled by multiple genes, the molecular markers related to its breeding selection need to be further developed. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a method for assisting in the identification of the feed conversion ratio of pigs. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0005] To solve the above technical problems, the present invention provides the following technical solutions: The present invention provides the use of a substance for detecting the polymorphism or genotype of SNP sites in the porcine genome in any of the following: A1) Feed conversion ratio (FCR) of pigs; A2) Identifying, assisting in identifying or improving the trait of feed utilization efficiency in pigs; A3) Pig breeding; A4) Preparing a product for screening the feed conversion ratio of pigs; A5) Preparing a product for identifying, assisting in identifying or improving the trait of feed utilization efficiency in pigs; A6) Preparing a product for pig breeding; A7) Detecting or assisting in detecting the polymorphism or genotype of SNPs; A8) Preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNPs; The SNP site is an SNP in the porcine genome, which is the 165th nucleotide of SEQ ID NO:1, and its nucleotide type is A or T.

[0006] The feed conversion ratio (FCR) of pigs described herein is a representation of the feed utilization efficiency of pigs, referring to the amount of feed consumed per unit of weight gain. Specifically, it can be the feed conversion ratio of the pigs to be tested in the body weight stage of 30 kg - 120 kg.

[0007] The purpose of the above-mentioned pig breeding method is to breed breeding pigs with a smaller feed conversion ratio.

[0008] The SNP is located at position 3714623 on chromosome 17 in the reference genome (Sus_scrofa.Sscrofa11.1).

[0009] Those skilled in the art know that SEQ ID NO:1 is composed of the SNP site (the 165th nucleotide of SEQ ID NO:1) and the nucleotide sequences nearby. The number of nucleotide sequences near the SNP site should not be used as a limiting factor for the protection scope of the present invention. It can be 25 bp, 35 bp, 45 bp, 65 bp, 85 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 17 of the porcine reference genome.

[0010] The front and back described herein should be defined as the front or back in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0011] The identification, auxiliary identification or improvement of pig feed utilization efficiency traits described in this article include, but are not limited to, identifying or assisting in identifying pigs to be tested with the aforementioned SNP genotype of AA for feeding or breeding.

[0012] The present invention also provides a method for detecting or assisting in detecting the feed conversion ratio of pigs, comprising the following steps: detecting the genotype of the aforementioned SNP locus in the pigs to be tested, and detecting or assisting in detecting the feed conversion ratio of pigs according to the genotype.

[0013] In the above method for detecting or assisting in detecting the feed conversion ratio of pigs, the feed conversion ratio of pigs to be tested with the genotype of TT or the genotype of AT of the SNP is higher than or candidate higher than that of pigs to be tested with the genotype of AA of the SNP.

[0014] In the above method, a partial region containing the aforementioned SNP in the pig genome can be amplified by PCR. For example, sequencing the PCR product containing SEQ ID NO:1 to detect the type of the 165th deoxyribonucleotide of SEQ ID NO:1, so as to detect the genotype of the SNP locus in the genome of pigs to be tested.

[0015] The present invention also provides a method for pig breeding, the method comprising detecting the genotype of the SNP locus in the genome of pigs to be tested, and selecting pigs to be tested with the genotype of AA of the SNP locus as parents for breeding, where AA is the homozygous type of the SNP locus being A.

[0016] The application of the above method in pig breeding also belongs to the protection scope of the present invention.

[0017] The present invention also provides a product, the product containing the aforementioned substance, and the product is any one of the following: B1) A product for detecting or assisting in detecting the feed conversion ratio of pigs; B2) A product for identifying, assisting in identifying or improving pig feed utilization efficiency; B3) A product for pig breeding; B4) A product for detecting or assisting in detecting the polymorphism or genotype of SNP.

[0018] In the above product, the substance is any one of the following: C1) The substance is a primer composition for amplifying a pig genomic DNA fragment including the SNP locus; C2) The substance is a PCR reagent containing the primer composition in C1); C3) The substance is a kit containing the primer composition in C1) or the PCR reagent in C2).

[0019] In the above product, the primer composition is F1) or F2) or F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO:2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO:3 in the sequence listing; F2), a primer set consisting of the single-stranded DNA with the nucleotide sequence of positions 1-19 of SEQ ID NO:1 in the sequence listing and the single-stranded DNA with the nucleotide sequence of positions 221-244 of SEQ ID NO:1 in the sequence listing; F3), a primer set consisting of the single-stranded DNA obtained by substituting and / or deleting and / or adding one or several nucleotides to SEQ ID NO:2 and having the same function as SEQ ID NO:2 and the single-stranded DNA obtained by substituting and / or deleting and / or adding one or several nucleotides to SEQ ID NO:3 and having the same function as SEQ ID NO:3.

[0020] The present invention also provides the application of the foregoing product in pig breeding.

[0021] The present invention also provides a DNA molecule, one strand of which is SEQ ID NO:1.

[0022] The present invention also provides an application of the foregoing DNA molecule in any one of the following: D1) Feed conversion ratio of pigs; D2) Identifying, assisting in identifying or improving the trait of pig feed utilization efficiency; D3) Pig breeding; D4) Preparing a product for screening the feed conversion ratio of pigs; D5) Preparing a product for identifying, assisting in identifying or improving the trait of pig feed utilization efficiency; D6) Preparing a product for pig breeding; D7) Detecting or assisting in detecting the polymorphism or genotype of SNP; D8) Preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNP.

[0023] The present invention proves through experiments that the A / T site at position 3714623 on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1) has a significant effect on the feed conversion ratio of pigs, and provides a method for the feed conversion ratio of pigs based on this SNP site, which is of great significance for selecting excellent pig breeds. Detailed implementation manners

[0024] The present invention will be further described in detail below in combination with the specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0025] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0026] The following examples use SAS 9.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and are tested by One-way ANOVA. P < 0.05 (*) indicates significant difference.

[0027] All animals in the following examples are from Shanghai Xinong Technology Co., Ltd.

[0028] The feed-to-gain ratio of pigs in the following examples is the feed-to-gain ratio during the stage from when the pigs reach 30 kg body weight to 120 kg body weight.

[0029] Example 1: Determination of SNP loci on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1) The inventors previously performed whole-genome sequencing on 321 Large White pig individuals and a genome-wide association analysis study on the feed-to-gain ratio trait. The results found three SNP loci significantly associated with the feed-to-gain ratio (not published). The inventors designed primers to amplify in the 200 bp range upstream and downstream of each of the three loci respectively, and found that only the sequence at one locus on chromosome 17 could obtain a good amplification effect.

[0030] After amplification, Seqman software was used for alignment to obtain a differential locus (SNP locus), named the A3714623T locus, which is located at the 3,714,623rd nucleotide on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1, website: https: / / genome-asia.ucsc.edu / cgi-bin / hgGateway?redirect=manual&source=genome.ucsc.edu) (i.e., the 165th position of SEQ ID NO:1). The nucleotide type of the A3714623T locus is A or T, and the genotypes are AA, TT, or AT. The AA genotype is a homozygote with the nucleotide of the A3714623T locus being A. The TT genotype is a homozygote with the nucleotide of the A3714623T locus being T. The AT genotype is a heterozygote with the nucleotides of the A3714623T locus being T and A.

[0031] Example 2: Correlation analysis of the A3714623T locus on chromosome 17 in the porcine reference genome (Sus_scrofa.Sscrofa11.1) with the feed conversion ratio of pigs To determine whether the A3714623T locus on chromosome 17 in the porcine reference genome (Sus_scrofa.Sscrofa11.1) is correlated with the feed conversion ratio of pigs, 2103 Large White pig individuals were used as experimental materials. The genotypes of the SNP loci in Example 1 for each individual and the individual feed conversion ratio were measured, and a correlation analysis was performed.

[0032] I. Genotype identification 1. PCR amplification According to the SNP information on chromosome 17 in the porcine reference genome (Sus_scrofa.Sscrofa11.1), a pair of primers was designed as follows: Forward primer F: 5'-GCAGGGCTTTGGGAGGTAA-3' (SEQ ID NO:2); Reverse primer R: 5'-GGAGGTATAGAGGAGGTGTCTTAA-3' (SEQ ID NO:3).

[0033] Using the genomic DNA of each Large White pig as a template, PCR amplification was performed with the above primers to obtain PCR products.

[0034] 2. Cloning, sequencing and sequence analysis The PCR products of each individual were respectively recovered and purified using an agarose gel recovery kit (Tiangen Biochemical Technology Co., Ltd.). After the recovered DNA fragments were ligated to the vector pGEM-T (Promega Corporation), the ligation products were transformed into Escherichia coli DH5α competent cells (Tomorrow Bio (Beijing) Technology Co., Ltd.). Positive clones were screened according to the carbenicillin resistance marker on the vector to obtain recombinant plasmids containing the recovered fragments. Nucleotide sequence determination was performed on it using the T7 and SP6 promoter sequences on the recombinant plasmid vector as primers (Invitrogen (Shanghai) Trading Co., Ltd.).

[0035] The genotypes of the pigs to be tested were respectively: AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R only contains a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is A, and does not contain a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is T, then the genotype of the aforementioned SNP (A3714623T locus on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1)) of the pig to be tested is AA.

[0036] TT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is A, and only contains a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is T, then the genotype of the aforementioned SNP (A3714623T locus on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1)) of the pig to be tested is TT.

[0037] AT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is A, and a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 165th nucleotide of SEQ ID NO:1 is T, then the genotype of the aforementioned SNP (A3714623T locus on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1)) of the pig to be tested is AT.

[0038] As shown in Tables 1 and 3, the genotype detection results of the A3714623T locus in 2103 Large White pig individuals showed that: 356 were of AA genotype, 570 were of TT genotype, and 1177 were of AT genotype. The genotype frequencies and allele frequencies of the A3714623T locus in the tested pig population are shown in Table 1: It can be seen from Table 1 that the genotype frequency of the TT homozygous type is significantly higher than that of the AA homozygous type, and the T allele is the dominant gene.

[0039] Table 1. Genotype Frequencies and Allele Frequencies of the A3714623T Locus in the Tested Pig Population

[0040] II. Association Analysis between Pig Genotype and Pig Feed Conversion Ratio The Osborne automatic measurement equipment was used to measure the feed conversion ratio of pigs in the body weight range of 30 kg - 120 kg. The SAS software was used for the correlation analysis between genotype and phenotype. Duncan's multiple test was used for significance test (P < 0.05). The data was expressed as mean ± standard error, and P < 0.05 was determined as significantly different.

[0041] As shown in Table 2, the SNP (A3714623T) locus had a significant effect on the feed conversion ratio of pigs. The feed conversion ratio of pigs with the AA genotype was significantly lower than that of pigs with the TT genotype (P < 0.05). The feed conversion ratio of pigs with the TT genotype was higher than that of pigs with the AT genotype, and the feed conversion ratio of pigs with the AA genotype was significantly lower than that of pigs with the AT genotype. Therefore, in actual pig breeding, the feed conversion ratio can be assisted in selection according to the genotyping results of the SNP (A3714623T) locus.

[0042] Table 2. Correlation analysis between single nucleotide polymorphisms on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1) and feed conversion ratio

[0043] Note: Different lowercase letters in the table indicate significant differences (P < 0.05), and the same letters indicate no significant differences (P > 0.05). The values are expressed as mean ± standard error.

[0044] Table 3. Feed conversion ratio of individuals with the A3714623T genotype

[0045]

[0046] In summary, the feed conversion ratio of pigs can be assisted by determining the genotype of the A3714623T locus on chromosome 17 in the pig reference genome (Sus_scrofa.Sscrofa11.1): the feed conversion ratio of pigs with the AA genotype is less than that of pigs with the TT genotype, and the feed conversion ratio of pigs with the TT genotype is greater than that of pigs with the AT genotype. In actual breeding work, pigs to be tested with the SNP (A3714623T) locus genotype of AA can be selected as parents for breeding.

[0047] SEQ ID NO:1 5'-GCAGGGCTTTGGGAGGTAATTAGGTTTAGGTGAGATCATAACGGAGGGGGGTCTTCATGATGGCATGACTGTCCTTATAAGAAGACAAAGGGGCCCCAGAACTGCTCTCTCTTCCCTGTGAAGACACAGTGAGAAGGTGGCGTTTATAAGCCAGAAAAGAAATCWTACCAGGAACTGCAGTTGCTAGGCACCATCCTAGATATGTGAGAAATATTGTCTGTTAAGACACCTCCTCTATACCTCC-3'.

[0048] Wherein W is A or T.

[0049] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. Use of a substance for detecting polymorphism or genotype of a SNP site in a pig genome in any of the following: A1) Detect or assist in detecting the feed-to-meat ratio of pigs; A2) Identify, assist in identifying or improve feed efficiency traits in pigs; A3) Pig breeding; A4) Detect or assist in detecting the polymorphism or genotype of SNP; A5) Prepare products for testing or assisting in testing pig feed-to-meat ratio; A6) Preparation of products for identifying, assisting in identifying or improving feed efficiency traits in pigs; A7) Preparation of products for pig breeding; A8) Preparation of products for detecting or assisting in detecting the polymorphism or genotype of SNPs; The SNP site is a SNP in the pig genome, which is the 165th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or T.

2. A method for detecting or assisting in detecting pig feed-to-meat ratio, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the pig to be tested, and detecting or assisting in detecting the pig feed-meat ratio according to the genotype.

3. A method for pig breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is AA as a parent for breeding, wherein AA is the homozygous type of the SNP site A.

4. Application, characterized in that, The application is the application of the method according to claim 2 in pig breeding.

5. The product, characterized in that The product contains the substance described in claim 1, and the product is any of the following: B1) Products used to detect or assist in detecting the feed-to-meat ratio of pigs; B2) Products used to identify, assist in identifying or improve feed efficiency traits in pigs; B3) Products for pig breeding; B4) Products used to detect or assist in detecting the polymorphism or genotype of SNPs.

6. The use according to claim 1 or the product according to claim 5, characterized in that: The substance is any of the following: C1) the substance is a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) the substance is a PCR reagent containing the primer combination described in C1); C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

7. The use or product according to claim 6, characterized in that: The primer composition is F1) or F2) or F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence list and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence list; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 19 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 221 to 244 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or several nucleotides are substituted and / or deleted and / or added, and a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 3 after one or several nucleotides are substituted and / or deleted and / or added.

8. Use of the product described in any one of claims 5 to 7 in pig breeding.

9. A DNA molecule, characterized in that One strand of the DNA molecule is SEQ ID NO:

1.

10. Application, characterized in that, Use of the DNA molecule according to claim 9 in any of the following: D1) Detect or assist in detecting the pig feed-to-meat ratio; D2) Identify, assist in identifying or improve feed efficiency traits in pigs; D3) Pig breeding; D4) Detect or assist in detecting the polymorphism or genotype of SNP; D5) Prepare products for testing or assisting in testing pig feed-to-meat ratio; D6) Preparation of products for identifying, assisting in identifying or improving feed efficiency traits in pigs; D7) Preparation of pig breeding products; D8) Prepare products for detecting or assisting in detecting the polymorphism or genotype of SNPs.

Images