MC1R gene molecular marker related to meat quality traits of broiler chickens and application of MC1R gene molecular marker

Abstract

The invention discloses an MC1R gene molecular marker related to meat quality traits of broilers and application, and belongs to the technical field of molecular markers. The molecular marker is composed of SNP1-SNP4, and SNP1 represents that Cgt exists in the 169th basic group of the sequence as shown in SEQ ID NO: 1, and SNP4 represents that Cgt exists in the 169th basic group of the sequence as shown in SEQ ID NO: 2; t mutation; sNP2 is the 231st basic group of the sequence as shown in SEQ ID NO: 1, and the 231st basic group has Agt; g mutation; sNP3 is that Ggt exists in the 336th basic group of the sequence as shown in SEQ ID NO: 1; t mutation; sNP4 is that Tgt exists in the 337th basic group of the sequence as shown in SEQ ID NO: 1; g mutation. The four molecular markers provided by the invention can accurately identify the meat quality traits of the broiler chickens, and provide a new SNP molecular marker for molecular marker-assisted selection, thereby providing a scientific basis for chicken breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly to an MC1R gene molecular marker related to broiler meat quality traits and its application. Background Art

[0002] The poultry industry has broad development prospects. Market demand will continue to rise with population growth and consumption upgrading. Technological innovation will promote production efficiency improvement and cost reduction. However, it also faces challenges such as disease prevention and control and breakthroughs in breeding technology. In production, meat quality traits such as breast muscle L value, breast muscle a value, and breast muscle pH value are regarded as important indicators affecting the economic value of the chicken industry.

[0003] The MC1R gene is a gene encoding a receptor protein located on the cell membrane surface, belonging to the G protein-coupled receptor family. It is expressed in melanocytes and plays a key regulatory role in melanin synthesis. The melanin synthesis pathway involved by the MC1R gene may interact with other physiological metabolic pathways in animals. Some signaling molecules and regulatory mechanisms in the melanin synthesis process may affect basic physiological processes such as animal growth, development, and metabolism, thereby indirectly affecting meat quality traits. For example, the activation or inhibition of the MC1R gene may affect the secretion or signal transduction of certain hormones in animals, and further affect meat quality trait indicators such as animal muscle development and fat deposition.

[0004] Currently, research on the association between the MC1R gene and meat quality traits mainly focuses on pig models, and its mechanism of action in regulating chicken meat quality traits lacks systematic research. Given the important role of the MC1R gene in metabolic regulation, developing molecular markers related to chicken meat quality traits based on this gene not only helps to clarify the biological function of the MC1R gene in poultry, but also provides new molecular breeding targets for the breeding of high-quality broiler varieties, which has important theoretical and application values for improving the economic benefits of the poultry breeding industry. Summary of the Invention

[0005] The object of the present invention is to provide an MC1R gene molecular marker related to broiler meat quality traits and its application to solve the problems existing in the above-mentioned prior art. The four molecular markers provided by the present invention can accurately identify broiler meat quality traits, provide new SNP molecular markers for marker-assisted selection, and thus provide a scientific basis for the breeding of chickens.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a molecular marker related to the meat quality traits of broiler chickens. The molecular marker consists of SNP1 - SNP4. Among them, for SNP1, there is a C>T mutation at the 169th base of the sequence shown in SEQ ID NO:1; for SNP2, there is an A>G mutation at the 231st base of the sequence shown in SEQ ID NO:1; for SNP3, there is a G>T mutation at the 336th base of the sequence shown in SEQ ID NO:1; for SNP4, there is a T>G mutation at the 337th base of the sequence shown in SEQ ID NO:1;

[0008] The meat quality traits refer to the L value of breast muscle, a value of breast muscle, b value of breast muscle, shear force of breast muscle, pH value of breast muscle and pH value of leg muscle;

[0009] Among them, SNP1 is related to the L value of breast muscle, shear force of breast muscle, pH value of breast muscle and pH value of leg muscle; SNP2 is related to the L value of breast muscle, a value of breast muscle and pH value of leg muscle; SNP3 is related to the L value of breast muscle, a value of breast muscle and pH value of breast muscle; SNP4 is related to the b value of breast muscle.

[0010] Optionally, for SNP1, the genotypes are CC, CT and TT; for SNP2, the genotypes are AA, AG and GG; for SNP3, the genotypes are GG and GT; for SNP4, the genotypes are TT and TG.

[0011] The present invention also provides a method for identifying the meat quality traits of broiler chickens according to the above - mentioned molecular marker, including the following steps:

[0012] Using the genomic DNA of the chicken to be tested as a template, primers are used to amplify the gene fragment including the molecular marker to obtain an amplification product;

[0013] Sequencing the amplification product, detecting the genotypes of the corresponding single - nucleotide polymorphism sites, and judging the meat quality traits of the chicken to be tested according to the detected genotypes;

[0014] The meat quality traits refer to the L value of breast muscle, a value of breast muscle, b value of breast muscle, shear force of breast muscle, pH value of breast muscle and pH value of leg muscle;

[0015] Among them, in SNP1, individuals with the TT genotype show the highest L value of breast muscle, shear force of breast muscle, pH value of breast muscle and pH value of leg muscle; in SNP2, individuals with the AA genotype show the highest L value of breast muscle and pH value of leg muscle and the lowest a value of breast muscle; in SNP3, individuals with the GG genotype show relatively high L value of breast muscle and pH value of breast muscle, and individuals with the GT genotype show relatively high a value of breast muscle; in SNP4, individuals with the TT genotype show relatively high b value of breast muscle.

[0016] Optionally, the primers include an upstream primer with the sequence shown in SEQ ID NO:2 and a downstream primer with the sequence shown in SEQ ID NO:3.

[0017] Optionally, the amplification reaction system for the amplification is as follows: 2 μL of template DNA, 15 μL of 2×Rapid Taq Master Mix, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

[0018] Optionally, the amplification reaction program for the amplification is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, for 34 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0019] The present invention also provides the application of the molecular marker according to the above in the breeding of broiler meat quality traits, where the meat quality traits refer to the L value of breast muscle, a value of breast muscle, b value of breast muscle, breast muscle shear force, breast muscle pH value, and leg muscle pH value; among them, in SNP1, individuals with the TT genotype show the highest L value of breast muscle, breast muscle shear force, breast muscle pH value, and leg muscle pH value; in SNP2, individuals with the AA genotype show the highest L value of breast muscle and leg muscle pH value, and the lowest a value of breast muscle; in SNP3, individuals with the GG genotype show relatively high L value of breast muscle and breast muscle pH value, and individuals with the GT genotype show relatively high a value of breast muscle; in SNP4, individuals with the TT genotype show relatively high b value of breast muscle.

[0020] The present invention discloses the following technical effects:

[0021] By analyzing the MC1R gene, the present invention found that there are multiple SNP sites significantly related to broiler meat quality traits in this gene. At the same time, through experimental verification, it was found that the molecular marker NC_052542.1:g.18488051C>T is significantly related to the L value of breast muscle, breast muscle shear force, breast muscle pH, and leg muscle pH (p<0.05), the molecular marker NC_052542.1:g.18488113A>G is significantly related to the L value of breast muscle, leg muscle pH, and a value of breast muscle (p<0.05), the molecular marker NC_052542.1:g.18488218G>T is significantly related to the L value of breast muscle, breast muscle pH value, and a value of breast muscle (p<0.05), and the molecular marker NC_052542.1:g.18488219T>G is significantly related to the b value of leg muscle (p<0.05). The above 4 molecular markers can accurately identify broiler meat quality traits, provide new SNP molecular markers for marker-assisted selection, and thus provide a scientific basis for the breeding of chickens. Description of the Drawings

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required for the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0023] Figure 1 It is a schematic diagram of the primer pairing positions and product lengths of MC1R;

[0024] Figure 2 It is a genotype typing diagram of SNP sites in the MC1R gene sequence. Detailed implementation manners

[0025] Now, the various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0026] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are also obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.

[0029] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0030] Embodiment

[0031] I. Materials and Methods

[0032] 1. Animal Samples

[0033] A total of 336 small white - feather broilers, slow - growing yellow - feather broilers, and fast - growing white - feather broilers at 49 days of age were selected. 2 mL of subcutaneous venous blood was collected and stored at - 80 °C for use as DNA extraction samples. Traits such as breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, and leg muscle b value of the selected population were recorded.

[0034] 2. Main Reagents

[0035] Blood sample DNA extraction kit (Brand: OMEGA; Catalog number: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2xRapidTaq Master Mix (Dye) (Brand: Novoprotein; Catalog number: P222 - 01; Nanjing Novoprotein Biotechnology Co., Ltd.), DNAmarker (Brand: TransGen Biotech; Catalog number: BM101 - 01; Beijing TransGen Biotech Co., Ltd.), high - purity low - electroendosmosis agarose (Brand: Tsingke; Catalog number: TSJ001; Beijing Tsingke Biotechnology Co., Ltd.).

[0036] 3. Experimental Methods

[0037] 3.1 Primer Design

[0038] According to the sequence of the red junglefowl (Gallus) MC1R gene (NC_052542.1) published by NCBI (National Center for Biotechnology Information Search database), primers were designed using Primer Premier5, and primer synthesis services were provided by Guangzhou Tsingke Biotechnology Co., Ltd. The relevant information of the primer sequences is shown in Table 1, and the pairing positions of the primers on the MC1R gene are as Figure 1 shown.

[0039] Table 1 PCR amplification primer sequences

[0040]

[0041] 3.2 Blood Sample DNA Extraction

[0042] Extract blood sample DNA with reference to the operation manual of the blood sample DNA extraction kit.

[0043] 3.3 PCR Amplification of Partial Sequence of MC1R Gene

[0044] Using the genomic DNA of the above 336 chicken blood samples as a template, the following reaction system was followed: 2 μL of template DNA, 15 μL of 2×Rapid Taq Master Mix, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

[0045] Reaction program: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, 34 cycles; final extension at 72°C for 5 min; storage at 4°C. The PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger first-generation sequencing.

[0046] 3.4 SNP determination and genotyping

[0047] The SeqMan tool of DNAstar software was used to analyze the sequence peak maps of the Sanger sequencing results of the PCR products to determine potential SNP sites, and the sequencing data of each sample was compared by this tool for genotyping.

[0048] 3.5 Association analysis of genotype and meat quality traits

[0049] The meat quality trait data of the individuals corresponding to the SNP sites and genotypes were analyzed by SPSS 27.0 for association analysis.

[0050] II. Results

[0051] 1. PCR amplification of MC1R gene sequence and SNP screening

[0052] The above 336 chicken individuals were selected, and PCR amplification was performed using the blood DNA of each individual as a template. The obtained PCR products (nucleotide sequence shown in SEQ ID NO:1) were subjected to Sanger sequencing, and the sequenced peak maps were compared and analyzed. A total of 4 SNP sites were detected, namely: NC_052542.1:g.18488051C>T, NC_052542.1:g.18488113A>G, NC_052542.1:g.18488218G>T, NC_052542.1:g.18488219T>G, as Figure 2 shown.

[0053] SEQ ID NO:1

[0054] ACGCCAGTGAGGGCAACCAGAGCAATGCCACGGCCGGGGCCGGAGGTGCCTGGTGCCAGGGGCTGGACATCCCCAATGAGCTCTTCCTGACGCTGGGGCTGGTGAGCCTGGTGGAGAACCTGCTGGTGGTGGCCGCCATCCTCAAGAACAGGAATCTGCACTCGCCCA C GTACTACTTCATCTGCTGCCTGGCCGTCTCCGACATGCTGGTGAGCGTCAGCAACCTGGCC A AGACGCTCTTCATGCTGCTGATGGAGCACGGCGTGCTGGTGATCCGCGCCAGCATCGTCCGCCACATGGACAATGTCATCGACATGCTCATCTGCAGCTCCGTC GT GTCCTCCCT。

[0055] In the sequence shown in SEQ ID NO:1, the 169th position is SNP1, and the polymorphism at this site is C / T; the 231st position is SNP2, and the polymorphism at this site is A / G; the 336th position is SNP3, and the polymorphism at this site is G / T; the 337th position is SNP4, and the polymorphism at this site is T / G.

[0056] 2. Association analysis of SNP sites in the MC1R gene sequence and meat quality traits

[0057] Association analysis was performed on the above 4 SNP sites and traits (pectoral muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, pectoral muscle pH value, leg muscle pH value, pectoral muscle L value, pectoral muscle a value, pectoral muscle b value, leg muscle L value, leg muscle a value, leg muscle b value), and the results are shown in Tables 2 to 5.

[0058] Table 2 Association of the NC_052542.1:g.18488051C>T locus with meat quality traits

[0059]

[0060] Table 3 Association of the NC_052542.1:g.18488113A>G locus with meat quality traits

[0061]

[0062] Table 4 Association of the NC_052542.1:g.18488218G>T locus with meat quality traits

[0063]

[0064] Table 5 Association between the locus NC_052542.1:g.18488219T>G and meat quality traits

[0065]

[0066] As shown in Table 2, the results showed that there were significant correlations between the molecular marker NC_052542.1:g.18488051C>T locus and the L value of pectoralis major muscle, the shear force N of pectoralis major muscle, the pH of pectoralis major muscle, and the pH of leg muscle (p<0.05). Among them, the L value of pectoralis major muscle and the shear force N of pectoralis major muscle of individuals with the TT mutant homozygous genotype were significantly higher than those of individuals with the CT mutant heterozygous genotype (p<0.05), but there were no significant differences between CC and TT, CT (p>0.05). The pH of pectoralis major muscle and the pH of leg muscle of individuals with the TT mutant homozygous genotype were significantly higher than those of individuals with the CT mutant heterozygous genotype and CC wild homozygous individuals (p<0.05). But there was no significant difference between CC and CT (p>0.05).

[0067] As shown in Table 3, the results showed that there were significant correlations between the molecular marker NC_052542.1:g.18488113A>G locus and the L value of pectoralis major muscle, the pH of leg muscle, and the a value of pectoralis major muscle in broilers (p<0.05). Among them, the L value of pectoralis major muscle and the pH of leg muscle of individuals with the AA wild homozygous genotype were significantly higher than those of individuals with the GG mutant homozygous genotype and the AG mutant heterozygous genotype (p<0.05). But there was no significant difference between GG and AG (p>0.05). The a value of pectoralis major muscle of individuals with the AA wild homozygous genotype was significantly lower than that of individuals with the AG mutant heterozygous genotype and the GG mutant homozygous genotype (p<0.05). But there was no significant difference between GG and AG (p>0.05).

[0068] As shown in Table 4, the molecular marker NC_052542.1:g.18488218G>T locus was significantly correlated with the L value of pectoralis major muscle, the pH value of pectoralis major muscle, and the a value of pectoralis major muscle in broilers (p<0.05). Among them, the L value of pectoralis major muscle and the pH value of pectoralis major muscle of individuals with the GG wild homozygous genotype were significantly higher than those of individuals with the GT mutant heterozygous genotype (p<0.05). The a value of pectoralis major muscle of individuals with the GT mutant heterozygous genotype was significantly higher than that of individuals with the GG wild homozygous genotype (p<0.05).

[0069] As shown in Table 5, the molecular marker NC_052542.1:g.18488219T>G locus was significantly correlated with the b value of leg muscle (p<0.05). The b value of pectoralis major muscle of individuals with the TT wild homozygous genotype was significantly higher than that of individuals with the TG mutant heterozygous genotype (p<0.05).

[0070] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker associated with broiler meat quality traits, characterized in that: The molecular markers consist of SNP1-SNP4, wherein SNP1 is a C>T mutation at the 169th base of the sequence shown in SEQ ID NO: 1; SNP2 is an A>G mutation at the 231st base of the sequence shown in SEQ ID NO: 1; SNP3 is a G>T mutation at the 336th base of the sequence shown in SEQ ID NO: 1; SNP4 is a T>G mutation at the 337th base of the sequence shown in SEQ ID NO: 1; The meat quality traits refer to breast muscle L value, breast muscle a value, breast muscle b value, breast muscle shear force, breast muscle pH value and leg muscle pH value; Among them, SNP1 was associated with pectoral muscle L value, pectoral muscle shear force, pectoral muscle pH value and leg muscle pH value; SNP2 was associated with pectoral muscle L value, pectoral muscle a value and leg muscle pH value; SNP3 was associated with pectoral muscle L value, pectoral muscle a value and pectoral muscle pH value; SNP4 was associated with pectoral muscle b value.

2. The molecular marker according to claim 1, characterized in that SNP1 has genotypes CC, CT and TT; SNP2 has genotypes AA, AG and GG; SNP3 has genotypes GG and GT; SNP4 has genotypes TT and TG.

3. A method for identifying broiler meat quality traits using molecular markers according to claim 1 or 2, characterized in that: The following steps are involved: Using the chicken genomic DNA to be tested as a template, using primers to amplify the gene fragment including the molecular marker according to claim 1 or 2 to obtain an amplified product; Sequencing the amplified product, detecting the genotype of the corresponding single nucleotide polymorphism site, and determining the meat quality trait of the tested chicken according to the detected genotype; The meat quality traits refer to breast muscle L value, breast muscle a value, breast muscle b value, breast muscle shear force, breast muscle pH value and leg muscle pH value; Among them, in SNP1, individuals with TT genotype showed the highest pectoral muscle L value, pectoral muscle shear force, pectoral muscle pH value and leg muscle pH value; in SNP2, individuals with AA genotype showed the highest pectoral muscle L value and leg muscle pH value, and the lowest pectoral muscle a value; in SNP3, individuals with GG genotype showed higher pectoral muscle L value and pectoral muscle pH value, and individuals with GT genotype showed higher pectoral muscle a value; in SNP4, individuals with TT genotype showed higher pectoral muscle b value.

4. The method according to claim 3, characterized in that The primers include an upstream primer with a sequence as shown in SEQ ID NO:2 and a downstream primer with a sequence as shown in SEQ ID NO:

3.

5. The method according to claim 3, characterized in that: The amplification reaction system of the amplification is: 2 μL of template DNA, 15 μL of 2×Rapid Taq Master Mix, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

6. The method according to claim 3, characterized in that The amplification reaction procedure of the amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 15 seconds, 34 cycles; final extension at 72°C for 5 minutes; and storage at 4°C.

7. The use of the molecular marker according to claim 1 or 2 in the selection of broiler meat quality traits, characterized in that: The meat quality traits refer to breast muscle L value, breast muscle a value, breast muscle b value, breast muscle shear force, breast muscle pH value and leg muscle pH value; wherein, in SNP1, individuals with TT genotype show the highest breast muscle L value, breast muscle shear force, breast muscle pH value and leg muscle pH value; In SNP2, individuals with the AA genotype showed the highest pectoral muscle L value and leg muscle pH value, and the lowest pectoral muscle a value; in SNP3, individuals with the GG genotype showed higher pectoral muscle L value and pectoral muscle pH value, and individuals with the GT genotype showed higher pectoral muscle a value; in SNP4, individuals with the TT genotype showed higher pectoral muscle b value.

Images