Structural variation molecular marker related to per-average feed intake of chicken and application of structural variation molecular marker

Abstract

The invention belongs to the technical field of livestock and poultry genetic markers and animal genetic breeding, and particularly relates to a structural variation molecular marker related to chicken secondary average feed intake and application of the structural variation molecular marker. The nucleotide sequence of the structural variation molecular marker provided by the invention is as shown in SEQ ID NO: 1, the structural variation molecular marker is located at 14th, 881, 990-14th, 882 and 295bp of a chicken chromosome 12, and the structural variation molecular marker is a deletion marker. The key genetic marker related to the chicken feeding behavior is provided, important information is provided for genetic breeding of the broiler chicken, meanwhile, broiler chicken varieties with different feeding behavior habits can be bred according to different markets and feeding environments, refined feeding management measures are formulated, and therefore the production efficiency and the feed utilization rate are improved, and the economic benefit is increased. And the economic benefit of the broiler industry is improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of livestock and poultry genetic markers and animal genetic breeding, and specifically relates to a structural variation molecular marker related to the average feed intake per visit of chickens and its application. Background Art

[0002] Feeding behavior usually has moderate heritability, and the specific level varies depending on the breed and feeding conditions. Selecting for feeding behavior is expected to improve poultry production management and increase feeding efficiency. For example, a high-density feeding system is more suitable for groups that eat more but less frequently each time to reduce food competition. However, in tropical regions, the heat stress generated by feeding will significantly affect production performance, so groups with a lower average feed intake per visit will have better adaptability.

[0003] Due to technical limitations, there has been little research on chicken feeding behavior before, lacking research on molecular markers of chicken feeding behavior, especially lacking research on its structural variation sites. Currently, structural variation (SV) molecular markers are mostly used to identify the intestinal barrier function of chickens, detect the feather color and body weight of chickens, and there is insufficient excavation of genetic markers related to specific feeding behavior traits such as the average feed intake per visit (Feeding Intake per Visit, FIV, g / visit) trait in the study of chicken feeding behavior traits, resulting in a lack of precise guidance in breeding chicken breeds with excellent feeding behavior traits, and also being unable to provide more theoretical support and effective genetic markers for broiler genetic breeding, restricting the precise development of broiler genetic breeding work, being difficult to meet the demand for improving the production efficiency of high-quality broiler breeds, and affecting the production efficiency and economic benefits of the broiler industry.

[0004] The purpose of the present invention is to solve this problem, accurately identify the structural variation molecular marker related to the FIV trait, and provide strong support for broiler genetic breeding. Summary of the Invention

[0005] The technical problem to be solved by the present invention is: to provide a structural variation molecular marker related to the average feed intake per visit of chickens and its application.

[0006] To solve the above technical problem, the present invention provides a structural variation molecular marker related to the average feed intake per visit of chickens, and the nucleotide sequence of the structural variation molecular marker is as shown in SEQ ID NO:1.

[0007] The structural variation molecular marker is located in the LRIG1 intron region within the gene (ENSGALG00000007483) on chicken chromosome 12.

[0008] The structural variation molecular marker is located at positions 14,881,990 - 14,882,295 bp on chicken chromosome 12.

[0009] The structural variation molecular marker is a deletion marker.

[0010] The present invention provides a structural variation molecular marker related to the average feed intake per time of chickens. The average feed intake per time of chickens lacking the nucleotide sequence of the structural variation molecular marker in the genome is lower than that of chickens containing the nucleotide sequence of the structural variation molecular marker.

[0011] The present invention provides a structural variation molecular marker related to the average feed intake per time of chickens. The region of the structural variation molecular marker is predicted to be an enhancer element in multiple tissues such as the brain, internal organs, and intestines of chickens. The enhancer element may be related to LRIG1 the expression of genes. The LRIG1 genes are expressed in many tissues. Among them, compared with other tissues, the expression levels of the LRIG1 genes are higher in the testis, pituitary gland, brain, hypothalamus, and skin of chickens.

[0012] The present invention provides an application of a structural variation molecular marker related to the average feed intake per time of chickens. The application includes any one of the following applications: 1) Assisted breeding of broiler chicken breeds; 2) Distinguishing broiler chicken breeds with different average feed intakes per time.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention has successfully identified a structural variation (SV) molecular marker and candidate genes related to the trait of average feed intake per time (FIV, g / time) in chicken feeding behavior, providing key genetic information for broiler chicken genetic breeding. The SV molecular marker can be typed at low cost and efficiently through PCR or high-throughput sequencing, which helps to breed broiler chicken breeds with different average feed intakes per time for different markets and feeding environments. By screening and utilizing this molecular marker, it is expected to accurately select individuals with excellent FIV traits during the broiler chicken breeding process, thereby improving production efficiency and feed utilization rate, and further enhancing the economic benefits of the broiler chicken industry. At the same time, this molecular marker provides an example for analyzing the "structural variation - phenotype" mechanism of animal complex traits, promoting the leapfrog upgrade of livestock and poultry breeding from SNP to SV molecular markers. Description of the Drawings

[0014] Figure 1 It is the Manhattan plot and QQ plot of SVs-GWAS for the FIV trait of chickens in the present invention; A is the Manhattan plot of SVs-GWAS for the FIV trait of chickens, and B is the QQ plot of SVs-GWAS analysis for the FIV trait of chickens.

[0015] Figure 2 It is the genotyping of potential significant sites of the SV molecular marker for the FIV trait of chickens in the present invention and the gene where the SV molecular marker is locatedLRIG1 Regulatory element prediction map; A is the genotyping box plot of potential significant sites of SV molecular markers for chicken FIV traits, and B is LRIG1 Regulatory element prediction map of the gene and schematic diagram of corresponding colors for each regulatory element type.

[0016] Figure 3 For the present invention LRIG1 Distribution map of the expression levels of the gene in different tissues of chickens. Specific implementation manners

[0017] The technical solutions of a structural variation molecular marker related to the average feed intake per chicken and its application in the present invention are further described below through specific examples.

[0018] Example 1

[0019] 1. Test population and feeding management Select 205 healthy yellow - feather broilers of the same batch, raise them on the ground in a semi - open chicken house of the same building, lay fresh wood chips in the fence, and use a corn - soybean meal - based diet without using antibiotics. The chickens are equipped with radio - frequency identification (RFID) chip leg rings, and the feeders are equipped with radio - frequency identification chip antennas to automatically record data such as individual information, the time of entering and leaving the feeder, and the weight change of the feed trough. The test period is from 56 to 76 days old.

[0020] 2. Sample collection At the time of slaughter at 76 days old, aseptically collect about 1 mL of whole blood from the wing vein under the chicken wing into a centrifuge tube containing ACD anticoagulant, mix well and store it at - 20°C for subsequent genomic DNA extraction. At the same time, collect fecal samples, and anatomically obtain intestinal content samples from the duodenum, jejunum, ileum, and cecum, quickly put them into liquid nitrogen for freezing, and then transfer them to an - 80°C refrigerator.

[0021] 3. DNA extraction and sequencing The host genomic DNA is extracted by using the TIANGEN Blood Genomic DNA Extraction Kit (DP318). After a series of steps of treatment, the DNA concentration and quality are evaluated by NanoDrop. When constructing the library, the DNA sample undergoes steps such as ultrasonic fragmentation and end repair, and is sequenced with paired - end 150 bp using the Illumina HiSeq 2500 system, and the sequencing depth is above 10×.

[0022] 4. Genetic variation detection The sequencing data were aligned with the sixth generation chicken reference genome (Galgal6) as the reference genome to obtain a bam file. Structural variation detection was identified using Manta v.1.6.0 and DELLY v.0.8.7. Structural variations including deletion, inversion, duplication and translocation were detected by Read pair and Split read analysis methods. Finally, the SURVIVOR tool was used to merge the SVs molecular marker sites detected by Manta and DELLY, retaining the SVs molecular marker set with consistent variation type and direction and length greater than 50bp, and the merged SVs molecular marker data were quality controlled (the quality control of SVs molecular markers used parameters -maf 0.01 -geno 0.05 --min 0.05) to ensure that the detected SVs molecular marker data had high credibility. SV annotation was performed using SnpEff software.

[0023] 5. Genome-wide association analysis of FIV traits The univariate linear mixed model (ULMM) in GEMMA v.0.98.5 software was used for genome-wide association analysis. The feeding behavior trait average feed intake per time (FIV, g / time) was used as the research object, and the model was y = Wα + xβ + u + , y is the FIV phenotype vector of broiler chickens, W is the covariate matrix, x is the genotype, β is the gene effect size, u is the random effect, is the error. Since the association matrix constructed based on SVs molecular markers has a low similarity with the two types of association matrices of SNPs and INDELs, the kinship matrix was constructed based on SNPs, and the first four principal components (PCs) based on SNPs data were selected as covariates to be included in this model correction. The whole genome significance threshold was adjusted by Bonferroni to -log10(0.05 / 13,303) = 5.425, and the potential significance threshold was -log10(1 / 13,303) = 4.184. After the significant or potential significant variant sites associated with the FIV trait were identified through GWAS analysis, SnpEff was used for annotation and candidate genes were mined in combination with the reference genome file of chicken, and the regulatory elements and candidate gene expression levels involved in the variant sites were analyzed in combination with the UCSC genome browser and the ChickenGTEx website data.

[0024] 6. Test results (1) Detection of significant loci and candidate genes of SV molecular markers related to chicken FIV traits The SVs-GWAS Manhattan plot and QQ plot of chicken FIV trait are shown inFigure 1 As shown in (A and B). Based on the SVs molecular marker, FIV-GWAS analysis detected a potential significant locus at position 14,881,990 on chicken chromosome 12, with a 305-bp deletion (located at 14,881,990 - 14,882,295, reverse strand). Its nucleotide sequence (labeled as the SV molecular marker related to the FIV trait) is as follows: SEQ ID NO:1: TGAAGAGAGTCATATAAGGCAGTCCTCCAAACAGACTGCCAGAAAACACATGGCTCTGCATTGCCTATCTGGATGGGGTCATGGGCACAGCACAGCCTCTTTGAAGGGGCTCAATCAGCACTTAAAAGGGGTCATTCAGTTGCAGTTGCTAGAAGATGACAGGTCAGTGTTTTTATGCTATACACCTTATGTCTTTGGTCTGCCTTTGTCTCTTGCTCCAATAGTTGTTTTTCCTCATGCATTTTTACCTCAAGGGCTATTTTTCTTGCTGCTGATATCTACCAGCCAAATTCAATTCTCAATCA Figure 1 A shows the results of genome-wide association analysis based on SVs molecular markers. The abscissa is the chromosome position, and the ordinate is the -log10( p ) value, visually presenting the significance distribution of the significant loci of SV molecular markers related to the FIV trait within the whole genome, and quickly locating the potential significant locus on chromosome 12. This potential significant locus is located LRIG1 within the gene. Figure 1 B shows the QQ plot based on SVs-GWAS analysis. The horizontal axis is the theoretical expected distribution of p values, and the vertical axis is the actual observed values. p The observed value region of the Figure 1 values fits the theoretical distribution, indicating that the model correction is effective and verifying the robustness of the analysis method in A of

[0025] The experimental results show that the SV molecular marker related to the FIV trait in chicken feeding behavior is located at 14,881,990 - 14,882,295 bp on chicken chromosome 12, and its candidate gene is LRIG1 gene.

[0026] (2) Genotyping of the potential significant locus of the SV molecular marker of chicken FIV trait and LRIG1 prediction of the regulatory elements of the Genotyping and characterization of potential significant loci of SV molecular markers for FIV traits in chickens LRIG1 Gene regulatory element prediction Figure 2 (A and B). Figure 2 A is a genotyping box plot of the potential significant loci of the SV molecular marker for the FIV trait in chickens. The x-axis represents different genotype groups, the y-axis represents the FIV value (unit: g / time), the horizontal line in the center of the colored box represents the median FIV value of the corresponding genotype group, and the red dot represents the average FIV value of the corresponding genotype group.

[0027] The results of population analysis showed that the number of wild-type populations (n ​​= 196) accounted for a larger proportion of the sample population (n = 205), the FIV value of the wild-type population was significantly higher than that of the deletion population, and the difference in FIV values ​​between the wild-type and deletion types was extremely significant ( p <0.001). This figure visually compares the differences in FIV values ​​among different genotype groups, and also illustrates the association between genotype and FIV traits.

[0028] The above experimental results show that the SV molecular marker located at 14,881,990-14,882,295 bp on chicken chromosome 12 is associated with the chicken FIV trait. Specifically, the average feed intake per feed of chickens lacking the SV molecular marker in the genome is lower, and the average feed intake per feed of chickens lacking the SV molecular marker in the genome is significantly lower than that of chickens containing the SV molecular marker.

[0029] LRIG1 The predicted map of gene regulatory elements and the color diagram representing each regulatory element type are shown in the figure below. Figure 2 As shown in B. Figure 2 B shows LRIG1 Distribution of regulatory elements in the gene region. The elongated red box marks the target deletion region. The map can distinguish different elements based on different colors. Figure 2 B shows that the SV molecular marker is located at LRIG1 The intron region within the gene, combined with the yellow color representing the enhancer region, was analyzed based on the prediction of chicken regulatory elements in the annotation results of the UCSC website (http: / / genome.ucsc.edu / s / zhypan / galGal6_FAANG_V1). The experimental results showed that the SV molecular marker was predicted to be an enhancer element in multiple tissues of the chicken, including the brain, internal organs and intestines.

[0030] LRIG1 Gene (ENSGALG00000007483) in chicken ( Gallus gallus ) The expression distribution in different tissues is shown in Figure 3 This box plot is arranged in descending order according to the median expression level (TPM), showingLRIG1 Tissue-specific expression pattern of the gene. (Data source: chickenGTEx-Portal database, http: / / chickengtex.farmgtex.org / ). By viewing the expression of the gene on the ChickenGTEx website, the results show that LRIG1 the gene is expressed in many tissues of chickens. Among them, compared with other tissues, the gene LRIG1 has a higher expression level in the testis, pituitary gland, brain, hypothalamus and skin of chickens.

[0031] Figure 2 B provides direct support for the functional mechanism of the SV molecular marker. Combining with Figure 3 in LRIG1 the distribution map of the expression levels of the gene in different tissues of chickens, the results show that LRIG1 the gene is expressed in many tissues of chickens, and it has a relatively high expression in the nervous system (brain, hypothalamus) and the endocrine system (such as the pituitary gland). Therefore, this SV molecular marker may regulate LRIG1 the expression of the gene, thereby affecting the neural network or hormone signal of chickens, and ultimately regulating the feeding behavior (FIV) of chickens.

[0032] By using the SV molecular marker, the present invention can successfully distinguish individuals with different average feed intakes.

[0033] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A structural variation molecular marker associated with average feed intake per chicken, characterized in that: The nucleotide sequence of the structural variation molecular marker is shown in SEQ ID NO:

1.

2. The structural variation molecular marker associated with average feed intake per chicken according to claim 1, characterized in that: The structural variation molecular marker is located on chicken chromosome 12 LRIG1 Introns are regions within genes.

3. The structural variation molecular marker associated with average feed intake per chicken according to claim 2, characterized in that: The structural variation molecular marker is located at 14,881,990-14,882,295 bp of chicken chromosome 12.

4. The structural variation molecular marker associated with average feed intake per chicken according to claim 1, characterized in that: The structural variation molecular marker is a deletion marker.

5. The use of a structural variation molecular marker related to average feed intake per chicken according to claim 1, characterized in that: The application includes any of the following applications: 1) Assisted breeding of broiler breeds; 2) Differentiate between broiler breeds with different average feed intake per feed intake.

Images