Bacillus licheniformis and use thereof

By using biological agents prepared from Bacillus licheniformis, the problems of pesticide resistance and environmental pollution caused by chemical pesticides have been solved. This has enabled broad-spectrum control of various plant diseases and promotion of crop growth, with particularly significant effects on the control of anthracnose in pumpkins, thus improving crop yield and quality.

CN120249148BActive Publication Date: 2026-06-09BEIJING EVOLYZER CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510740389.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-05
Publication Date
2026-06-09
Estimated Expiration
2045-06-05

Smart Images

  • Figure CN120249148B_ABST
    Figure CN120249148B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of bio-agriculture, and relates to a bacillus licheniformis and application thereof. The strain has good broad-spectrum bacteriostatic effect, and has good inhibitory effect on various plant fungal pathogens and bacterial pathogens causing plant diseases, especially has good prevention and treatment effect on pumpkin anthracnose. The prevention and treatment effect of 10 million cfu / mL of the bacterial agent diluent on pumpkin anthracnose reaches more than 95%, and the prevention and treatment effect is remarkable. The strain and the biological bacterial agent containing the strain can effectively overcome the single defect of the prevention and treatment effect of the existing product, and can further promote the growth of crop plants. Moreover, the bacillus licheniformis is collected from a natural environment, is safe, environment-friendly and pollution-free, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of bio-agricultural technology, and in particular relates to a Bacillus licheniformis and its uses. Background Technology

[0002] Since the 20th century, global population growth has created significant demands for stable agricultural output and quality. While the widespread use of chemical fertilizers and pesticides has greatly increased global food production, diseases caused by plant pathogens remain a major threat to stable yields. Taking potatoes (Solanum tuberosum L.) as an example, Fusarium wilt (FW) and Fusarium dry rot (FDR), induced by Fusarium, are widespread in potato-growing areas. FW can lead to 30-50% yield loss and reduced tuber quality; while FDR is a common post-harvest fungal disease during potato storage, potentially causing yield reductions of up to 50-60%. FW and FDR are among the most serious problems in modern agriculture and the food industry.

[0003] Currently, chemical pesticides are widely used to prevent diseases. However, the overuse of these pesticides has led to drug resistance in pathogenic fungi, and the resulting food safety and environmental pollution problems are becoming increasingly prominent. Therefore, seeking new, efficient, and pollution-free disease control measures has become an urgent need for global food security. Biological control, represented by microorganisms such as Bacillus, Streptomyces, and Trichoderma, has shown initial success, and the "using microorganisms to control microorganisms" biological prevention strategy is receiving increasing attention and recognition from industry and academia.

[0004] As common endophytic fungi in crops, Bacillus microorganisms have a broad-spectrum inhibitory effect on a variety of plant pathogens, such as Rhizoctonia solani, Glomerella cingulata, Sclerotium rolfsii, and Botrytiscinerea. Their bactericidal effect is higher than or close to that of chemically synthesized fungicides. They can eliminate brown leaf spots, effectively inhibit rice blast, inhibit Aspergillus flavus fungi, and reduce the aflatoxin content in legumes.

[0005] Studies have shown that different biocontrol strains possess unique antibacterial spectra, with most strains targeting only a few or specific plant diseases. Broad-spectrum strains are rare, necessitating the development of products that combine multiple strains. To improve the efficacy of microbial agents and simplify product development processes, continuously searching for new strains with broad-spectrum control effects against various plant diseases and promoting plant growth will remain a key focus of ongoing research in this field. Summary of the Invention

[0006] The purpose of this application is to provide a Bacillus licheniformis and its application, wherein the Bacillus licheniformis has dual functions: it can both broadly resist and prevent plant diseases, and promote crop growth and improve crop quality.

[0007] Specifically, this application relates to the following aspects:

[0008] 1. A type of Bacillus licheniformis ( Bacillus licheniformis The Bacillus licheniformis described herein is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 29258.

[0009] 2. A biological agent comprising Bacillus licheniformis as described in item 1.

[0010] 3. The biological agent according to claim 2, wherein the biological agent further comprises agriculturally acceptable adjuvants.

[0011] 4. The biological agent according to item 2 or 3, wherein the dosage form of the biological agent is a wettable powder, water-dispersible granule, granule, liquid, powder, water emulsion, suspension, microemulsion, capsule, tablet or biofilm.

[0012] 5. The biological agent according to item 2 or 3, wherein the concentration of Bacillus licheniformis in the biological agent is 100,000 CFU / mL to 50,000,000 CFU / mL.

[0013] 6. The use of Bacillus licheniformis as described in item 1 or any of the biological agents described in items 2-5 in the prevention and control of plant diseases.

[0014] 7. According to the use described in item 6, wherein the plant disease is selected from one or more of the following: pumpkin anthracnose, pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant stem base rot, pepper stem base rot, cucumber stem base rot, strawberry stem base rot, wheat stem base rot, corn stem base rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rapeseed wilt. Sclerotinia stem rot, sunflower sclerotinia stem rot, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger wilt, pear fire blight, apple fire blight, celery soft rot, cabbage soft rot, tomato soft rot, cucumber soft rot, scallion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial spot, citrus canker, kiwi canker, tomato canker, rice bacterial leaf blight, banana bacterial leaf blight, rapeseed black rot, cabbage black rot.

[0015] 8. According to the use described in item 6 or 7, said plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, cabbage, rapeseed, celery, kale, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwi, wheat, corn, barley,

[0016] 9. Use of Bacillus licheniformis as described in item 1 or any of the biological agents described in items 2-5 in promoting plant growth.

[0017] 10. According to the use described in item 9, the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, cabbage, rapeseed, celery, kale, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwi, wheat, corn, barley, sorghum, rice, soybean, cotton, sunflower, ginger, and scallion.

[0018] Beneficial effects of this application

[0019] The strain described in this application has a good broad-spectrum antibacterial effect, and it has a good inhibitory effect on a variety of plant fungal pathogens and bacterial pathogens that cause plant diseases. In particular, it has a good control effect on anthracnose of pumpkin. Using a 10 million CFU / mL inoculant dilution, the control effect on anthracnose of pumpkin reaches more than 95%, and the control efficacy is significant.

[0020] The strain and the biological agent containing this strain can effectively overcome the shortcomings of existing products with only one protective effect, and can further promote crop growth. Moreover, the Bacillus licheniformis described herein is collected from the natural environment, is safe, environmentally friendly and pollution-free, and has broad application prospects. Attached Figure Description

[0021] Figure 1 This is a diagram of the colony morphology of Bacillus licheniformis.

[0022] Figure 2 This is a schematic diagram comparing the growth of pumpkin stems treated with the aforementioned Bacillus licheniformis (treatment 2) with those treated with conventional methods.

[0023] Figure 3 This is a schematic diagram comparing the yield of a single eggplant plant treated with the aforementioned Bacillus licheniformis (treatment 2) with that treated with conventional methods. Detailed Implementation

[0024] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0025] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0026] definition

[0027] As used herein, "broad spectrum" means a wide range of applications that are effective on most objects. In this application, it means that it can be used on a variety of plants and has a control effect on a variety of plants.

[0028] For example, in some embodiments, the Bacillus licheniformis of this application can be used to control a variety of plant diseases, including but not limited to anthracnose of pumpkin, anthracnose of pepper, anthracnose of tomato, anthracnose of watermelon, anthracnose of mango, stem base rot of eggplant, stem base rot of pepper, stem base rot of cucumber, stem base rot of strawberry, stem base rot of wheat, stem base rot of corn, gray mold of tomato, gray mold of cucumber, gray mold of strawberry, gray mold of grape, early blight of tomato, early blight of potato, wheat smut, barley smut, corn smut, Verticillium wilt of potato, Verticillium wilt of watermelon, Verticillium wilt of strawberry, Verticillium wilt of cotton, wilt of banana, and wilt of pepper. Watermelon wilt, rapeseed sclerotinia stem rot, sunflower sclerotinia stem rot, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger wilt, pear fire blight, apple fire blight, celery soft rot, cabbage soft rot, tomato soft rot, cucumber soft rot, scallion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial spot, citrus canker, kiwifruit canker, tomato canker, rice bacterial leaf blight, banana bacterial leaf blight, rapeseed black rot, cabbage black rot.

[0029] As used in this article, the term "plant disease" refers to a series of morphological, physiological, and biochemical pathological changes in plants under the influence of biotic or abiotic factors, which hinder the normal growth and development process and thus affect human economic benefits.

[0030] bacterial strains and biological agents

[0031] This application provides a Bacillus licheniformis ( Bacillus licheniformis The *Bacillus licheniformis* was deposited on December 7, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China. Its classification name is *Bacillus licheniformis* (…). Bacillus licheniformis (The accession number is CGMCC No.29258).

[0032] The sequence of the 16S rRNA of Bacillus licheniformis is shown in SEQ ID NO:3:

[0033]

[0034] The strain described in this application was screened from soil samples from the Tibetan region of Ganzi Plateau. The strain has excellent control effects, such as good control effects on anthracnose of pumpkin, stem rot of eggplant, and bacterial wilt of tomato. In particular, for anthracnose of pumpkin, its control effect can reach more than 95% at a dilution concentration of 10 million CFU / mL.

[0035] In this application, the prevention and control effect is calculated using the following formula:

[0036] Relative prevention and control effect (%) = (disease index of control group - disease index of treatment group) / disease index of control group × 100.

[0037] This application also provides a biological agent comprising the aforementioned Bacillus licheniformis.

[0038] In some embodiments, the bio-initiator also includes agriculturally acceptable adjuvants.

[0039] In this application, the agriculturally acceptable excipients are commonly used excipients in the art, which can be used to prepare corresponding dosage forms.

[0040] In some embodiments, the excipients may be selected from one or more of the following: solvents, synergists, stabilizers, dispersants, fillers, wetting agents, and adhesives, mainly including water, glucose, amino acids, citric acid, starch, xanthan gum, sodium alginate, polyethylene glycol, etc.

[0041] In some embodiments, the dosage form of the biological agent may be a wettable powder, water-dispersible granule, granule, liquid, powder, water emulsion, suspension, microemulsion, capsule, tablet or biofilm.

[0042] In this application, no restrictions are placed on the preparation methods of wettable powders, water-dispersible granules, pellets, liquids, powders, emulsions, suspensions, microemulsions, capsules, tablets or biofilms, which can be prepared using conventional methods in the art.

[0043] The concentration of Bacillus licheniformis in the biological agent can be adjusted according to actual needs. In some embodiments, the concentration of Bacillus licheniformis in the biological agent is 100,000 CFU / mL to 50,000,000 CFU / mL, for example, it can be 100,000 CFU / mL, 1,000,000 CFU / mL, 2,000,000 CFU / mL, 3,000,000 CFU / mL, 4,000,000 CFU / mL, 5,000,000 CFU / mL, 6,000,000 CFU / mL, 7,000,000 CFU / mL, 8,000,000 CFU / mL, 9,000,000 CFU / mL, 10,000,000 CFU / mL, 15,000,000 CFU / mL, 20,000,000 CFU / mL, 25,000,000 CFU / mL, 30,000,000 CFU / mL, 35,000,000 CFU / mL, 40,000,000 CFU / mL, 45,000,000 CFU / mL, 50,000,000 CFU / mL, etc.

[0044] In some embodiments, the concentration of Bacillus licheniformis in the biological agent is 1 million CFU / mL to 10 million CFU / mL.

[0045] Uses of strains

[0046] This application provides the use of the aforementioned Bacillus licheniformis or the aforementioned biological agents in the prevention and control of plant diseases.

[0047] In some embodiments, the plant disease is selected from one or two of the following: anthracnose of pumpkin, anthracnose of pepper, anthracnose of tomato, anthracnose of watermelon, anthracnose of mango, stem base rot of eggplant, stem base rot of pepper, stem base rot of cucumber, stem base rot of strawberry, stem base rot of wheat, stem base rot of corn, gray mold of tomato, gray mold of cucumber, gray mold of strawberry, gray mold of grape, early blight of tomato, early blight of potato, wheat smut, barley smut, corn smut, Verticillium wilt of potato, Verticillium wilt of watermelon, Verticillium wilt of strawberry, Verticillium wilt of cotton, wilt of banana, wilt of pepper, wilt of watermelon, and rapeseed fungus. Sclerotinia stem rot, sunflower sclerotinia stem rot, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, cabbage downy mildew, tomato bacterial wilt, potato bacterial wilt, pepper bacterial wilt, ginger wilt, pear fire blight, apple fire blight, celery soft rot, cabbage soft rot, tomato soft rot, cucumber soft rot, scallion soft rot, cucumber angular leaf spot, melon angular leaf spot, soybean angular leaf spot, sorghum bacterial spot, citrus canker, kiwi canker, tomato canker, rice bacterial leaf blight, banana bacterial leaf blight, rapeseed black rot, cabbage black rot.

[0048] In some embodiments, the plant disease is selected from one or more of pumpkin anthracnose, eggplant stem rot, and tomato bacterial wilt.

[0049] In some embodiments, the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, cabbage, rapeseed, celery, kale, watermelon, mango, strawberry, grape, banana, pear, apple, cantaloupe, citrus, kiwi, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, and scallion.

[0050] The strain exhibits excellent control efficacy against anthracnose in pumpkin, achieving a control rate of 95.22%. Furthermore, the strain is also effective against anthracnose in various crops including pepper, tomato, watermelon, mango, eggplant stem base rot, pepper stem base rot, cucumber stem base rot, strawberry stem base rot, wheat stem base rot, corn stem base rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rapeseed sclerotinia rot, sunflower sclerotinia rot, tomato damping-off, cucumber damping-off, soybean damping-off, and more. It also has good control effects on black scurf of potatoes, damping-off of tomatoes, damping-off of cucumbers, damping-off of watermelons, downy mildew of watermelons, downy mildew of cabbage, bacterial wilt of tomatoes, bacterial wilt of potatoes, bacterial wilt of peppers, wilt of ginger, fire blight of pears, fire blight of apples, soft rot of celery, soft rot of cabbage, soft rot of tomatoes, soft rot of cucumbers, soft rot of scallions, angular leaf spot of cucumbers, angular leaf spot of melons, angular leaf spot of soybeans, bacterial spot of sorghum, citrus canker, citrus canker, citrus canker, bacterial canker of tomatoes, bacterial leaf blight of rice, bacterial leaf blight of bananas, black rot of rapeseed, and black rot of cabbage, etc., that is, the strains mentioned above have good broad-spectrum antibacterial effects.

[0051] This application provides the use of the aforementioned Bacillus licheniformis or the aforementioned biological agent in promoting plant growth.

[0052] In some embodiments, the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, cabbage, rapeseed, celery, kale, watermelon, mango, strawberry, grape, banana, pear, apple, cantaloupe, citrus, kiwi, wheat, corn, highland barley, sorghum, rice, soybean, cotton, sunflower, ginger, and scallion.

[0053] When the strains described in this application are applied to pumpkin, they can increase the stem diameter, stem height, average yield per fruit, and growth rate of pumpkin; when applied to eggplant, they can increase the stem diameter, plant height, average yield per fruit, and growth rate of eggplant; and when applied to cherry tomatoes, they can increase the stem diameter, plant height, average yield per fruit, and growth rate of cherry tomatoes.

[0054] In summary, the Bacillus licheniformis strain described in this application has excellent control effects on plant diseases, especially on anthracnose of pumpkin, where the control effect is extremely significant. In addition, the strain can promote the growth of crop plants and greatly improve the plant's production performance.

[0055] Furthermore, the Bacillus licheniformis described in this application has a broad spectrum of protection against plant diseases, which overcomes the shortcomings of single-effect disease compared with existing technologies.

[0056] Example

[0057] This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0058] Example 1: Strain source, screening and identification

[0059] (1) Source of the strain

[0060] The *Bacillus licheniformis* strain was isolated from soil in the Tibetan region of Ganzi Plateau, and its isolation and purification methods are as follows:

[0061] Take 1-3 g of soil sample, add 30 mL of PBS buffer, and simultaneously add culture medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose), and incubate at 37℃ and 200 rpm for 30-60 min. After incubation, allow natural sedimentation, aspirate 100 μL of supernatant, and spread it onto LB agar plates. Incubate at 37℃ for 14-16 h. When the colonies on the plates have grown to 2 / 3 of the culture medium, pick single colonies for isolation and purification until the colonies on each plate have the same morphology and color, which indicates a single strain. Store the purified strain on slant agar.

[0062] (2) Screening of strains

[0063] Method 1: The plate confrontation method was used for fungal pathogens. The desired fungal pathogens were inoculated onto PDA medium for activation and culture. After centering the plate using the cross-cutting method, a 5 mm diameter sterile punch was used to make holes at the edge of the activated pathogen colonies, and mycelial discs were collected. Using a sterile toothpick, the mycelial side of the mycelial disc was transferred, facing down, to the center of a blank PDA plate. The selected strains were inoculated around the disc at equal distances from the center, and the plate was incubated. Each treatment was repeated in triplicate. The growth of the pathogens was observed, and strains that effectively inhibited the growth of fungal pathogens were screened.

[0064] Method 2: Inhibition zone method for bacterial pathogens. The required bacterial pathogens were inoculated onto LB agar for activation and cultured for later use. Single colonies of the selected strains were picked and inoculated into LB liquid medium, incubated at 200 rpm and 37°C with shaking for 24 h. The culture was diluted with sterile water and spot-inoculated onto the center of a blank LB agar plate, sprayed with diluted pathogenic bacteria solution, and incubated at 37°C for 24 h. Each treatment was performed in triplicate. The inhibition zone was observed, and strains with good inhibitory effects on bacterial pathogen growth were screened.

[0065] The results of Method 1 showed that the strain had good inhibitory effects on the fungal pathogens of anthracnose in pumpkin, pepper, tomato, watermelon, mango, eggplant stem base rot, pepper stem base rot, cucumber stem base rot, strawberry stem base rot, wheat stem base rot, corn stem base rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, watermelon wilt, rapeseed sclerotium rot, sunflower sclerotium rot, tomato damping-off, cucumber damping-off, soybean damping-off, potato black scurf, tomato damping-off, cucumber damping-off, watermelon damping-off, watermelon downy mildew, and Chinese cabbage downy mildew. The results are shown in Table 1.

[0066] Table 1. Antimicrobial spectrum of screened strains against fungal pathogens

[0067]

[0068] Note: If there is an antagonistic effect, use "+"; if there is no antagonistic effect, use "-".

[0069] The results of Method 2 showed that the strain had good inhibitory effects on bacterial wilt of tomato, bacterial wilt of potato, bacterial wilt of pepper, bacterial wilt of ginger, fire blight of pear, fire blight of apple, soft rot of celery, soft rot of cabbage, soft rot of tomato, soft rot of cucumber, soft rot of scallion, angular leaf spot of cucumber, angular leaf spot of melon, angular leaf spot of soybean, bacterial spot of sorghum, citrus canker, citrus canker, citrus canker, bacterial canker of tomato, bacterial leaf blight of rice, bacterial leaf blight of banana, black rot of rapeseed, and black rot of cabbage (bacterial). The results are shown in Table 2.

[0070] Table 2. Antibacterial spectrum of screened strains against bacterial pathogens

[0071]

[0072] (3) Identification of the selected strains

[0073] The colony morphology of the screened strains is as follows Figure 1As shown, the colonies are pale yellow, moist, with transparent mucus on the edges, and have umbrella-shaped folds and protrusions in the center.

[0074] The 16S rRNA sequence of this strain was amplified using universal primers 27F (5'-3')AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1) and 1492R (5'-3'):TACGGCTACCTTGTTACGACTT (SEQ ID NO:2). The amplification reaction system is shown in Table 3, and the amplification reaction conditions are shown in Table 4.

[0075] Table 3 PCR amplification system

[0076]

[0077] Table 4 PCR reaction conditions

[0078]

[0079] The 16S rRNA sequence obtained based on PCR reaction is shown in SEQ ID NO:3. Homology comparison with other 16S rRNA sequences in the NCBI database (National Center for Biotechnology Information (nih.gov)) identified the selected strain as Bacillus licheniformis.

[0080]

[0081] The strain was deposited on December 7, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and its taxonomical name is Bacillus licheniformis (Bacillus licheniformis). Bacillus licheniformis (The accession number is CGMCC No.29258).

[0082] Example 2: Field trial of the strain's effect on controlling anthracnose and promoting growth in pumpkin.

[0083] (1) Test site: Mu Us Desert, Yanchi County, Wuzhong City, Ningxia Hui Autonomous Region

[0084] (2) Experimental design: Seven days after pumpkin transplanting, root irrigation was performed twice, with a volume of 200 mL each time and an interval of 10 days between each irrigation. Five inoculum treatments were set up, with water treatment serving as a blank control. Each treatment group had three replicates, for a total of 18 plots, with each plot being 100 m². 2 The inoculum treatment was prepared using conventional methods in the art, namely, inoculating the seed culture containing activated Bacillus licheniformis into LB liquid medium and incubating it at 37°C with shaking at 200 r / min for 36 h.

[0085] During the mature plant stage, the leaf lesion incidence of pumpkins in the control and treatment groups was examined. The total number of plants surveyed and the total number of diseased plants were recorded, graded, and the disease index and control effect were calculated. During the harvest period, 20 pumpkin plants were selected from each plot using a 5-point sampling method, tagged, and their yield was tracked and recorded. From the start of harvest to the end of harvest, the pumpkins were harvested, weighed, and recorded. The average weight of a single fruit and the yield increase rate were calculated. At the same time, the stem diameter, stem height, and other indicators at the harvest period were investigated and statistically analyzed.

[0086] (3) The experimental treatment design is shown in Table 5.

[0087] Table 5. Experimental Design Processing Group Information

[0088]

[0089] (4) Survey methods and results

[0090] The incidence of anthracnose in pumpkin was investigated using a 5-point sampling method, with each point measuring 5 meters. 2The total number of plants at each point was investigated, and the total number of plants in each plot was calculated from the average value of each point. Finally, the incidence rate and disease index of each plot were calculated, and the relative control effect was calculated from the disease index. The calculation method is as follows: Incidence rate (%) = Number of diseased plants / Total number of plants investigated × 100, Disease index = 100 × ∑ (Number of diseased plants at each level × Level) / (Total number of plants × Representative value of the highest level), Relative control effect (%) = (Disease index of control group - Disease index of treatment group) / Disease index of control group × 100.

[0091] Grading Standards: Grade 0: Plants show no anthracnose symptoms; leaves, stems, and fruits are all healthy with no lesions on the surface. Grade 1: A small number (1-5) of circular lesions appear on the leaves, with a lighter color, mostly brown; no lesions are seen on the stems and fruits. Grade 2: The number of lesions on the leaves increases to 6-10, the color of the lesions deepens, and a grayish-white center may appear; 1-2 small lesions appear on the stems; no disease is currently observed on the fruits. Grade 3: The number of lesions on the leaves exceeds 10, some lesions begin to merge, and the leaves show slight yellowing and curling; the number of lesions on the stems reaches 3-5, and the lesions are slightly sunken; a small number (1-3) of circular lesions begin to appear on the fruits, with a darker color. Level 4: Numerous lesions merge on the leaves, covering more than 50% of the total leaf area. Leaves turn severely yellow and wither, and some leaves begin to fall off. The stems have more than 5 lesions, which are noticeably sunken. Fruits have a large number of lesions, exceeding 3, and signs of rotting appear at the lesions, with small black dots or pinkish sticky substances. The experimental results are shown in Table 6.

[0092] Table 6. Control of anthracnose in pumpkin by different Bacillus licheniformis treatment groups

[0093]

[0094] The diameter and height of pumpkin stems were investigated, and the average weight of a single fruit and the yield increase rate during the harvest period were calculated. The average weight of a single fruit was determined using a five-point sampling method, with each point measuring 5 meters. 2 The yield increase was calculated based on the average yield of five points. The formula for the yield increase rate is as follows: Yield increase rate % = (Average yield of treatment plot - Average yield of CK water plot) / Average yield of CK water plot * 100%. The experimental results are shown in Table 7.

[0095] Table 7. Growth promotion of pumpkin anthracnose by different Bacillus licheniformis treatment groups

[0096]

[0097] Tables 6 and 7 show that *Bacillus licheniformis* has a good control effect on anthracnose in pumpkin, and no phytotoxicity was observed in the pumpkins during the experiment; the plants grew well. The incidence rate was significantly reduced in the inoculum treatment group, with treatment two showing an 89.71% reduction compared to the control group. The root drenching treatment with *Bacillus licheniformis* inoculum not only controlled anthracnose in pumpkins but also further promoted pumpkin growth, with varying degrees of increase in stem diameter and height. The average weight of a single fruit increased by up to 81.67% compared to the control group (see Table 7). Figure 2 This effectively improved the growth and production quality of pumpkin plants.

[0098] Example 3: Field trial of strain's effect on controlling eggplant stem base rot and promoting growth.

[0099] (1) Experimental location: Vegetable base in Shouguang City, Weifang City, Shandong Province.

[0100] (2) Experimental design: Seven days after transplanting, eggplants were irrigated twice with a 10-day interval between irrigations, using 200 mL of the inoculant solution each time. Five inoculant treatments were set up, with a water treatment serving as a blank control. Each treatment group had three replicates, for a total of 18 plots, each plot being 100 m². 2 The preparation method of the bacterial agent is the same as in Example 2.

[0101] During the mature stage, the disease incidence of eggplant plants in the control and treatment groups was examined. The total number of plants surveyed and the total number of diseased plants were recorded, graded, and the disease index and control effect were calculated. During the harvest period, 20 eggplant plants were selected from each plot using a 5-point sampling method, tagged, and their yield was tracked and recorded. From the start of harvest to the end of harvest, the plants were harvested, weighed, and recorded. The average weight of a single fruit and the yield increase rate were calculated. At the same time, the stem diameter, plant height, and other indicators at the harvest period were investigated and statistically analyzed.

[0102] (3) The experimental treatment design principles are the same as those in Example 2.

[0103] (4) Survey methods and results

[0104] The incidence of eggplant stem rot was investigated, and the methods for calculating the incidence rate, disease index, and relative control effect were the same as in Example 2.

[0105] Grading Standards: Grade 0: No lesions, discoloration, rot, or other abnormalities at the base of the stem. The plant is generally healthy and vigorous, without yellowing or wilting of leaves or other abnormalities in the above-ground parts that may be caused by stem base rot. Grade 1: Mild symptoms appear at the base of the stem, with lesions covering less than 10% of the total area of ​​the stem base. The lesions are irregular in shape and limited to the epidermis, not yet penetrating into the internal tissues. Occasionally, 1-2 leaves may show slight yellowing. The plant grows normally, without significant stunting or wilting. Grade 2: Lesions have developed, covering 10%-30% of the total area of ​​the stem base. The lesions darken to a deep brown and begin to extend into the internal tissues of the stem base. Some leaves on the above-ground parts are yellowing, and slight stunting may occur, but without significant wilting. Grade 3: The lesions at the base of the stem further expand, reaching 30%-50% of the total area of ​​the stem base. The lesions turn blackish-brown, and the internal tissues are clearly rotten. The above-ground leaves are severely yellowed, the plant is noticeably stunted, some branches are wilting, and growth is severely inhibited. Level 4: Lesions cover almost the entire base of the stem, exceeding 50% of the total area. The stem base is severely rotten, exhibiting a soft, rotten appearance; it is easily broken by hand, and the plant loses its support and collapses to the ground. Most of the above-ground leaves are withered and yellow, the plant has essentially stopped growing, and faces death. The experimental results are shown in Table 8.

[0106] Table 8. Control of eggplant stem base rot by different treatment groups of Bacillus licheniformis

[0107]

[0108] The stem diameter and plant height of eggplants at the harvest period were investigated, and the average weight of a single fruit and the yield increase rate at each harvest stage were calculated. The method for calculating the average weight of a single fruit was the same as in Example 2. The experimental results are shown in Table 9.

[0109] Table 9. Growth promotion of eggplant stem base rot by different Bacillus licheniformis treatment groups

[0110]

[0111] Tables 8 and 9 show that *Bacillus licheniformis* has a good control effect on eggplant stem rot, and no phytotoxicity was observed in the eggplants during the experiment; the plants grew well. The incidence rate was significantly reduced in the inoculum treatment group, with treatment two showing a 78.95% reduction compared to the control group. The root irrigation treatment with *Bacillus licheniformis* inoculum not only controlled eggplant stem rot but also further promoted eggplant growth, with varying degrees of increase in stem diameter and plant height, and a yield increase rate reaching up to 67.86%, effectively improving the yield of eggplant plants (see...). Figure 3 ).

[0112] Example 4: Field trial of the strain's effect on controlling bacterial wilt in tomato and promoting growth.

[0113] (1) Experimental location: Tomato greenhouses in Shenxian County, Liaocheng City, Shandong Province.

[0114] (2) Seven days after transplanting, cherry tomatoes were irrigated twice, with 200 mL of solution applied each time, 10 days apart. Five inoculum treatments were set up, with water treatment serving as a blank control. Each treatment group had three replicates, for a total of 18 plots, each plot being 100 m². 2 The preparation method of the bacterial agent is the same as in Example 2.

[0115] During the mature stage, the disease incidence of cherry tomato plants in the control and treatment groups was examined. The total number of plants surveyed and the total number of diseased plants were recorded, graded, and the disease index and control effect were calculated. During the harvest period, 20 cherry tomato plants were selected from each plot using a 5-point sampling method, tagged, and their yield was tracked and recorded. From the start of harvest to the end of harvest, the plants were harvested, weighed, and recorded. The average yield per plant and the yield increase rate were calculated. At the same time, the stem diameter, plant height, and other indicators at the harvest period were investigated and statistically analyzed.

[0116] (3) The experimental treatment design principles are the same as those in Example 2.

[0117] (4) Survey methods and results

[0118] The incidence of bacterial wilt in cherry tomatoes was investigated, and the methods for calculating the incidence rate, disease index, and relative control effect were the same as in Example 2.

[0119] Grading Standards: Grade 0: Plants are asymptomatic, growing normally, with no symptoms related to bacterial wilt on stems, leaves, or other parts. Grade 1: Only a few leaves show slight wilting, generally not exceeding 25% of the total number of leaves, with no obvious lesions at the base of the stem. Grade 2: 25%-50% of the leaves show wilting, the base of the stem begins to discolor, turning light brown, but the lesions do not encircle the base of the stem. Grade 3: 50%-75% of the leaves show wilting, the lesions at the base of the stem darken to dark brown, and the lesions encircle 50%-75% of the base of the stem. The representative value is 3. Grade 4: More than 3 / 4 of the leaves show wilting, or even the entire plant dies, the lesions at the base of the stem encircle the base of the stem for more than one circumference, and the vascular bundles inside the stem are severely browned. The experimental results are shown in Table 10.

[0120] Table 10. Control of bacterial wilt in tomato by different treatment groups of Bacillus licheniformis

[0121]

[0122] The stem diameter and plant height of cherry tomatoes at the harvest period were investigated, and the average yield per plant and yield increase rate during the harvest period were calculated. The average weight of a single fruit was calculated using the same method as in Example 2. The experimental results are shown in Table 11.

[0123] Table 11. Growth promotion effect of different Bacillus licheniformis treatments on tomato bacterial wilt.

[0124]

[0125] Tables 10 and 11 show that *Bacillus licheniformis* has a good control effect on bacterial wilt of cherry tomatoes, and no phytotoxicity was observed in tomatoes during the experiment; the plants grew well. The incidence rate was significantly reduced in the inoculum treatment group, with a relative control effect of over 80%. Root drenching with *Bacillus licheniformis* inoculum not only controlled bacterial wilt of cherry tomatoes but also further promoted the growth of tomato plants, with varying degrees of increase in stem diameter and plant height, and a yield increase rate of up to 64.34%, effectively improving the production performance of cherry tomato plants.

[0126] Example 5: Field trials of the strain on other plants

[0127] Example 5 followed the same experimental design as Examples 2-4, involving root drenching with 200 mL of the agent twice, 10 days apart. Five inoculum treatments were set up, with a water treatment as a blank control. Each treatment had three replicates. The relative control effect and yield increase were calculated using the same method as in Example 2. The results are shown in Tables 12 (fungal diseases) and 13 (bacterial diseases).

[0128] Table 12. Control and growth promotion effects of different Bacillus licheniformis treatments on fungal diseases.

[0129]

[0130]

[0131] Table 13. Control and growth promotion effects of different Bacillus licheniformis treatment groups on bacterial diseases.

[0132]

[0133]

[0134] As shown in Tables 12 and 13, the strain exhibited significant effects in plant disease control, covering most common plant disease types. These diseases included fungal diseases such as anthracnose and gray mold, as well as bacterial diseases such as bacterial wilt and soft rot. In addition to disease control, the strain also promoted plant growth and yield, a characteristic that gives it great application potential in the field of plant disease control, applicable to the prevention and treatment of common plant diseases and for promoting growth.

Claims

1. A type of Bacillus licheniformis ( Bacillus licheniformis The Bacillus licheniformis described herein is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 29258.

2. A biological agent comprising Bacillus licheniformis as described in claim 1.

3. The biological agent according to claim 2, wherein the biological agent further comprises agriculturally acceptable adjuvants.

4. The biological agent according to claim 2 or 3, wherein the dosage form of the biological agent is a wettable powder, water-dispersible granule, granule, liquid, powder, emulsion, suspension, microemulsion, capsule, tablet or biofilm.

5. The biological agent according to claim 2 or 3, wherein the concentration of Bacillus licheniformis in the biological agent is 100,000 CFU / mL to 50,000,000 CFU / mL.

6. The use of Bacillus licheniformis as described in claim 1 or the biological agent as described in any one of claims 2-5 in the prevention and control of plant diseases.

7. The use according to claim 6, wherein the plant disease is selected from one or more of the following: pumpkin anthracnose, pepper anthracnose, tomato anthracnose, watermelon anthracnose, mango anthracnose, eggplant stem base rot, pepper stem base rot, cucumber stem base rot, strawberry stem base rot, wheat stem base rot, corn stem base rot, tomato gray mold, cucumber gray mold, strawberry gray mold, grape gray mold, tomato early blight, potato early blight, wheat smut, barley smut, corn smut, potato verticillium wilt, watermelon verticillium wilt, strawberry verticillium wilt, cotton verticillium wilt, banana wilt, pepper wilt, and watermelon wilt. Sclerotinia rot of rapeseed, sclerotinia rot of sunflower, damping-off of tomato, damping-off of cucumber, damping-off of soybean, black scurf of potato, damping-off of tomato, damping-off of cucumber, damping-off of watermelon, downy mildew of watermelon, downy mildew of cabbage, bacterial wilt of tomato, bacterial wilt of potato, bacterial wilt of pepper, ginger wilt, fire blight of pear, fire blight of apple, soft rot of celery, soft rot of cabbage, soft rot of tomato, soft rot of cucumber, soft rot of scallion, angular leaf spot of cucumber, angular leaf spot of melon, angular leaf spot of soybean, bacterial spot of sorghum, citrus canker, citrus canker, tomato canker, bacterial leaf blight of rice, bacterial leaf blight of banana, black rot of rapeseed, black rot of cabbage.

8. The use according to claim 6 or 7, wherein the plant is selected from one or more of the following: pumpkin, eggplant, tomato, pepper, cucumber, potato, cabbage, rapeseed, celery, kale, watermelon, mango, strawberry, grape, banana, pear, apple, melon, citrus, kiwi, wheat, corn, and barley.

9. The use according to claim 6 or 7, wherein the use further includes promoting plant growth.

Citation Information

Patent Citations

  • Bacillus subtilis and application thereof

    CN110079483A

  • Bacillus licheniformis for preventing and treating plant diseases and application of bacillus licheniformis

    CN113755381A