Inhibiting antibodies against GLUT1

Abstract

Anti-SLC2A1 antibodies and binding fragments thereof are disclosed. The antibodies and fragments are useful for inhibiting glucose uptake in tumor cells and for reprogramming tumor cell metabolism to oxidative phosphorylation. The disclosed antibodies and binding fragments thereof are suitable for cancer treatment alone or in combination with compounds that inhibit the oxidative phosphorylation pathway.

Description

[0001] Sequence Listing

[0002] This application contains a Sequence Listing submitted in a computer-readable format. Technical Field

[0003] The present invention relates to anti-SLC2A1 monoclonal antibodies, to the use of said compounds as a single agent or in combination with an agent for the treatment or prevention of diseases such as cancer, autoimmune diseases, inflammation, infectious diseases and metabolic diseases, and to the use of said compounds as intermediates for the production of new modified anti-SLC2A1 monoclonal antibodies. Background Art

[0004] Glucose is an essential substrate for mammalian metabolism. The transport of glucose across cell membranes requires specific transporters belonging to the glucose transporter family. Within this family, the proteins are named with the symbol GLUT and the genes are named with the symbol SLC2 (solute carrier family 2).

[0005] All known GLUT proteins contain 12 transmembrane domains that form a large hydrophilic cavity in the center of the protein. Amino acids located inside the cavity facilitate ligand binding and determine the substrate specificity of the transporter 1 . Ligand transport is facilitated by a cycle of conformational changes that begin with ligand uptake in the outward-facing (open to the extracellular medium) conformation, transition to a closed state with the ligand in the protein cavity, and an inward-facing (open to the cytoplasm) state that allows ligand release 2,3 .

[0006] The GLUT family of proteins is subdivided into three classes based on protein sequence and similarity. Class I are the "glucose transporters" and include GLUT1, GLUT2, GLUT3, GLUT4 and GLUT14. Class II glucose transporters include GLUT5, GLUT7, GLUT9 and GLUT11 and are also known to transport fructose. Class III consists of GLUT6, GLUT8, GLUT10, GLUT12 and GLUT13 (HMIT1) and the substrates are largely unknown 4 .

[0007] Glucose is central to human energy consumption. The expression and subcellular localization of the most abundant mammalian glucose transporters GLUT1, GLUT2, GLUT3, GLUT4 on specific cell types are important aspects of glucose consumption regulation. GLUT2, GLUT3, GLUT4 are involved in specific central processes in the human body. GLUT2 is an important regulator of glucose sensing and insulin secretion in the pancreas, and GLUT3 mediates neuronal glucose uptake, while GLUT4 is involved in glucose metabolism in muscle and fat cells 5-7On the other hand, GLUT1 is considered to be the major glucose transporter during embryonic development 8 In adult tissues, GLUT1 is expressed on red blood cells, endothelial cells of the blood-brain barrier, and brown adipose tissue 9-11 。

[0008] Importantly, GLUT1 is the major glucose transporter expressed on tumor cells, and its overexpression is associated with poor prognosis 12,13 GLUT1, which promotes glucose uptake by tumor cells, enables tumor cells to grow, invade, and metastasize indefinitely, making them sensitive to GLUT1 inhibition 14 Inhibition of GLUT1 expression in cancer cells or glucose deprivation has been shown to inhibit cell growth in vitro and tumor growth in vivo, thus validating the targeting role of this transporter in cancer treatment 15-17 。

[0009] High GLUT1 expression also plays a role in other diseases. Infective agents, such as malaria parasite Plasmodia, rely on glucose consumption for growth and amplification 18 The GLUT1 inhibitors disclosed herein will also be useful for inhibiting infectious diseases. In diabetes, hypoglycemia is a serious side effect of insulin treatment, which can be alleviated by GLUT1 inhibitory antibodies and insulin fusion constructs 19 On the other hand, in diabetic hyperglycemia, dangerous high glucose uptake can be blocked with GLUT1 inhibitors to reduce tissue damage such as the occurrence of diabetic retinopathy 20 。 SUMMARY OF THE INVENTION

[0010] The present invention provides a variety of antibodies that bind to SLC2A1 and block glucose uptake. The blocking antibodies can be used therapeutically as a single agent to inhibit glucose uptake. In cancer treatment, anti-SLC2A1 inhibitory antibodies can be used in combination with other drugs to even more effectively reduce cancer cell fitness and disease burden

[0011] Accordingly, an object of the present invention is to provide an SLC2A1 antibody or an antigen-binding fragment thereof that blocks glucose uptake

[0012] Another object of the present invention is to provide a method for inhibiting glucose uptake in a patient, the method comprising administering to the patient one or more anti-SLC2A1 antibodies or antigen-binding fragments, wherein in a subset of tumor cells, glucose uptake is inhibited

[0013] Another object of the present invention is to provide a method of reprogramming tumor cell metabolism, which is carried out by providing one or more anti-SLC2A1 antibodies or binding fragments thereof to a tumor cell culture in vitro to block glucose uptake and shift metabolism towards, for example, oxidative phosphorylation.

[0014] Another object of the present invention is to provide a method of reprogramming the tumor cell metabolism of a patient by administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, wherein in a subset of tumor cells, inhibition of glucose uptake shifts metabolism towards, for example, oxidative phosphorylation.

[0015] Another object of the present invention is to provide a method of inhibiting cancer cell metabolism in vitro or in vivo, which is carried out by blocking glucose uptake with one or more anti-SLC2A1 antibodies or binding fragments thereof and inhibiting oxidative phosphorylation with a metabolic modulator such as complex I inhibitors metformin, phenformin, and IACS-010579.

[0016] Another object of the present invention is to provide a method of inhibiting the cancer cell metabolism of a patient, which comprises administering one or more anti-SLC2A1 antibodies or binding fragments thereof and a metabolic modulator such as complex I inhibitors metformin, phenformin, and IACS-010579 to the patient simultaneously or sequentially, wherein in a subset of tumor cells, inhibition of glucose uptake and simultaneous inhibition of metabolic pathways result in reduced adaptability of cancer cells.

[0017] Another object of the present invention is to provide a method of treating cancer in a patient, which comprises administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, wherein the cancer is treated.

[0018] Another object of the present invention is to provide a method of treating an infective agent such as malaria in a patient, which comprises administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, wherein the infective agent is treated.

[0019] Another object of the present invention is to provide a method of treating diabetic side effects in a patient, which comprises administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, wherein the diabetic side effects are treated.

[0020] Another object of the present invention is to provide the method as outlined above, wherein the anti-SLC2A1 antibody or binding fragment thereof comprises the amino acids of one or more complementarity determining regions (CDRs) selected from the group consisting of:

[0021] Heavy chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID 41-80 and SEQ ID NO:337, heavy chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID 81-120 and SEQ ID NO:339, heavy chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID121-160 and SEQ ID NO:340; and

[0022] Light chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID NO:201-240 and SEQ ID NO:342; light chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID NO 241-280 and SEQ ID NO:343; and light chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID NO:281-320 and SEQ ID NO:344.

[0023] Another object of the present invention is to provide a method as outlined above, wherein the anti-SLC2A1 antibody comprises a VL amino acid sequence selected from the group consisting of SEQ ID NO:1-40 and SEQ ID NO:341, and a VH amino acid sequence selected from the group consisting of SEQ ID NO:161-180 and SEQ ID NO:337.

[0024] Another object of the present invention is to provide a method for diagnosing cancer, the method comprising: a) contacting a tissue from a patient suspected of having cancer with at least one anti-SLC2A1 antibody or a binding fragment thereof; and b) determining the presence of overexpression of SLC2A1 in the tissue as an indication of the presence of cancer. The anti-SLC2A1 antibody can be as described herein and as outlined above. Description of the Drawings

[0025] Figure 1 . ELISA-based SLC2A1 VLP binding assay and EC50 values of anti-SLC2A1 antibodies. Results from n = 3 independent experiments are shown ± SEM. ELISA-based binding assay for estimating the binding affinity of anti-SLC2A1 antibodies to SLC2A1 pseudotyped VLPs. The figure shows the binding of six different antibodies and their corresponding effective concentration 50 (EC50) values. All antibodies bind to SLC2A1 on VLPs with low nanomolar EC50s.

[0026] Figure 2A Figure 2B. Flow cytometry-based binding assays of HepG2 (A) and HEPG (B) wild-type (wt) and SLC2A1 knockout (KO) cells. MFI ratio - mean fluorescence intensity ratio. Results from n = 3 independent experiments are shown ± SEM. Binding of anti-SLC2A1 antibody to HepG2 wild-type (wt) and SLC2A1 knockout (KO) cell lines was evaluated by flow cytometry. The anti-SLC2A1 antibody binds specifically to wild-type and not specifically to KO HepG2 cells.

[0027] Figure 3A Figure 3B , Figure 3C . ELISA-based evaluation of the binding of anti-SLC2A1 antibody to VLPs carrying SLC2A2, SLC2A3, SLC2A4. (A) 2E5#22, (B) 6F12#33, and (C) R14#54 antibody-based comparison of glucose transporter binding by ELISA. Results from one to two n = 2 technical replicates of a representative experiment are shown ± SEM.

[0028] Figure 4.A, Figure 4B . Deoxyglucose uptake in the presence of anti-SLC2A1 antibody or BAY-876 glucose uptake inhibitor. Results from one to three n = 2 technical replicates of a representative experiment are shown ± SEM. (A) A concentration-dependent decrease in glucose uptake was observed after incubation with anti-SLC2A1 antibody or BAY-876 for 2 hours.

[0029] Figure 5 . Effect of anti-SLC2A1 antibody monotherapy on MCF7 cell confluence. Results from n = 3 independent experiments are shown ± SEM. Inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibody. A decrease in cell confluence was detected after 24 hours of incubation.

[0030] Figures 6 - 8 Inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibody and complex I inhibitors metformin ( Figure 6 ), phenformin ( Figure 7 ), and IACS-010759 ( Figure 8 ) is shown. Complete and synergistic inhibition of MCF7 cell growth was observed when cells were co-treated with anti-SLC2A1 antibody and complex I inhibitors:

[0031] Figure 6 . Effect of the combination of anti-SLC2A1 antibody and metformin on MCF7 proliferation. Results from one n = 4 technical replicates of a representative experiment are shown ± SEM.

[0032] Figure 7 . Effect of anti-SLC2A1 antibody in combination with phenformin on MCF7 proliferation. Results from n = 3 independent experiments are shown ± SEM.

[0033] Figure 8 . Effect of anti-SLC2A1 antibody in combination with IACS-010759 on MCF7 proliferation. Results from n = 4 independent experiments are shown ± SEM.

[0034] Figure 9 . Comparison of the effect of different anti-SLC2A1 antibody clones in combination with phenformin on MCF7 proliferation. The dashed line represents the mean MCF7 normalized confluence of untreated samples (UT). Results from a representative experiment with n = 3 technical replicates are shown ± SEM. Anti-SLC2A1 antibodies with effective synergistic effects in co-treatment with phenformin were selected. Antibodies 2E5#22, 5G5#30, 6F12#33, and 7C3#39 completely inhibited MCF7 cell growth in a concentration-dependent manner when combined with phenformin.

[0035] Figure 10 . IC50 of co-treatment with anti-SLC2A1 antibody and 130 μM phenformin on MCF7 proliferation. Results from two separate experiments with n = 2 technical replicates are shown ± SEM. In the presence of 130 μM phenformin, anti-SLC2A1 inhibited the growth of the MCF7 cell line in a concentration-dependent manner.

[0036] Figure 11A Figure 11B 、 Figure 11C . Effect of anti-SLC2A1 antibody in combination with IACS-010759 on the proliferation of prostate cancer (A) and pancreatic cancer (B, C) cell lines. Results from a representative experiment with n = 2 technical replicates are shown. Verification of the synergistic growth inhibition of anti-SLC2A1 and complex I inhibitor. When combined with IACS-010759, the anti-SLC2A1 antibody significantly inhibited the growth of PC3 prostate cancer and pancreatic cancer cell lines PANC1 and MIAPACA2.

[0037] Figure 12A 、 Figure 12B Figure 12C . Antitumor efficacy against established MiaPaca2 xenograft tumors. (A) Tumor volume (A), body weight (B), and antibody serum concentration (C) measured over time. Results from an experiment with n = 10 animals per group are shown. Detailed Description

[0038] Definitions

[0039] As used herein, "antibody" is a polypeptide that specifically binds to and recognizes an antigen or an antigenic fragment thereof.

[0040] "Monoclonal antibody" is an antibody obtained from a substantially homogeneous population of antibodies, i.e., each antibody of the population is identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific for a single antigenic epitope.

[0041] The term "disease" refers to any change in the state of the body or some organs, interruption or interference with the performance of functions and / or causing symptoms such as discomfort, dysfunction, pain or even death in the person suffering from the disease or in a person in contact with the diseased person. Cancer or tumor is within the definition of disease.

[0042] As used herein, the terms "treat", "treatment", "treating" refer to a therapeutic treatment, wherein the aim is to reverse, alleviate, improve, inhibit, slow down or stop the progression or severity of a disease (including cancer).

[0043] A treatment is "effective" if the progression of the disease is reduced or stopped. That is, "treatment" includes not only an improvement in symptoms or markers, but also a halt or at least a slowing of the progression or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, a reduction in one or more symptoms, a reduction in the degree of the disease, stabilization of the disease state (i.e., not worsening), a delay or slowing of the progression of the disease, an improvement or alleviation of the disease state, remission (whether partial or complete) and / or a reduction in the mortality rate.

[0044] As used herein, the terms "prevent" or "prevention" refer to stopping, hindering and / or slowing down a disease. In one embodiment, "prevent" is synonymous with "inhibit".

[0045] As used herein, the term "administer" refers to placing a compound as disclosed herein into a subject by a method or route that results in at least partial delivery of the agent at the desired site. A pharmaceutical composition comprising a compound disclosed herein can be administered by any suitable route that produces an effective treatment in the subject.

[0046] As used herein, "subject" means a mammal, preferably a human. The terms "individual", "patient" and "subject" are used interchangeably herein.

[0047] The terms "increased", "increase", or "enhanced" are each generally used herein to mean an increase by a statically significant amount; the terms "increased", "increase", or "enhanced" mean an increase of at least 10% compared to a reference level, such as an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including 100% increase compared to the reference level or any increase between 10% - 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold or at least about 10-fold, or any increase between 2-fold and 10-fold or more compared to the reference level.

[0048] The terms "decrease", "reduce", "reduction", or "inhibit" are each generally used herein to mean a decrease by a statistically significant amount. For example, "decrease", "reduce", "reduction", or "inhibit" mean a decrease of at least 10% compared to a reference level, such as a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including 100% decrease (e.g., a non-existent level or an undetectable level compared to the reference level), or any decrease between 10% - 100%. In the context of a biomarker or symptom, it means a statistically significant decrease in such levels. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and preferably reduced to a level that is within the normal range for an individual without a given disease.

[0049] As used herein, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that are within the scope of sound medical judgment suitable for contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0050] As used herein, the term "combination" refers to the use of more than one prophylactic agent and / or therapeutic agent simultaneously or sequentially and in such a way that their respective actions are additive or synergistic.

[0051] As used herein, "composition" can be a single antibody or antigen-binding fragment thereof disclosed herein or a combination of antibodies or antigen-binding fragments thereof disclosed herein, which can be the same or different, for prophylactic or therapeutic treatment. Such combinations can be selected according to the desired immunity or effect. The antibody-based pharmaceutical compositions of the present invention can be formulated by any number of strategies known in the art (e.g., see McGoff and Scher, 2000, Solution Formulation of Proteins / Peptides: In McNally, E.J. ed Protein Formulation and Delivery. New York, N.Y.: Marcel Dekker; pp. 139-158; Akers and Defilippis, 2000, Peptides and Proteins as Parenteral Solutions. In: Pharmaceutical Formulation Development of Peptides and Proteins. Philadelphia, Pa.: Talyor and Francis; pp. 145-177; Akers et al., 2002, Pharm. Biotechnol. 14:47-127).

[0052] Increasing evidence supports the view that altered cancer cell metabolism can be used as a therapeutic target. The abnormal glucose metabolism of human tumors, known as the Warburg effect, is characterized by a significant increase in the rates of glucose consumption and lactate excretion even in the presence of oxygen. 21 The elevated level of glucose consumption sustains high cell proliferation because glycolytic intermediates are used in various pathways to promote the biosynthesis of new macromolecules and organelles. 22 To be able to uptake large amounts of glucose, the expression of glucose transporters is usually upregulated on tumor cells. 13,23,24 Increased glucose uptake and utilization have also been observed in the clinical setting, where glucose uptake is visualized by using labeled glucose analogs. 25 .

[0053] GLUT1 inhibition can lead to blocking the metabolic pathways downstream of glucose and restricting the proliferation of glycolysis-dependent cancer cells. Small molecule inhibitors of GLUT1 have been developed, but they lack specificity for GLUT1. 26-28 Targeting other class I glucose transporters is not preferred because they have important functions in central processes in the body. Inhibiting GLUT1 function with monoclonal antibodies can achieve much higher specificity than small molecule drugs.

[0054] Cancers that are highly dependent on glycolysis are particularly sensitive to GLUT1 inhibition. For example, high expression of SLC7A11 during glucose restriction renders cancer cells sensitive to acute death 29,30 , and inactivating mutations in TCA cycle proteins or OXPHOS can also lead to greater glucose dependence 31-34 . However, some tumors have inherent metabolic plasticity and can use alternative energy-producing pathways other than glycolysis to meet their energy requirements. It has been shown that inhibiting glycolysis alone induces a metabolic shift towards mitochondrial-dependent oxidative phosphorylation (OXPHOS). 35 Co-targeting glycolysis with anti-GLU1 therapeutic monoclonal antibodies and OXPHOS may have greater promise for specifically restricting the growth of such tumor cells.

[0055] Combination therapy

[0056] The compounds of the present invention can be administered as the sole agent or in combination with one or more other agents, provided that the combination does not cause unacceptable side effects. The present invention also relates to such combinations. Possible combination methods for the compounds include standard chemotherapy options, but also combinations of existing and novel targeted therapies and immunotherapies (such as angiogenesis inhibitors, receptor tyrosine kinase inhibitors, CTLA4 and PD-1 / PD-L1 inhibitors). Additionally, compounds that affect metabolic pathways can be added to the composition, including but not limited to complex I inhibitors such as metformin, phenformin, and IACS-010759.

[0057] Generally, the combination use of a systemic tumor agent with the compounds or compositions of the present invention will be used for:

[0058] (1) Produce better efficacy in reducing tumor growth or even eliminating tumors compared to administering either agent alone,

[0059] (2) Provide administration of a smaller amount of the chemotherapeutic / targeted / immunogenic agent administered,

[0060] (3) Provide a well-tolerated treatment in patients, with fewer adverse pharmacological complications compared to those observed with single-agent therapy and certain other combination therapies,

[0061] (4) Provide treatment for a wider range of different cancer types in mammals, especially humans,

[0062] (5) Provide a higher response rate in the patients being treated,

[0063] (6) Provide a longer survival time in the patients being treated compared to standard treatment,

[0064] (7) Provide more time for tumor progression, and / or

[0065] (8) Produce efficacy and tolerability results that are at least as good as those of the agent used alone, compared to the case of producing antagonism when combined with other known cancer agents.

[0066] The compounds and compositions of the present disclosure are expected to be effective as therapeutic agents in treating various tumor types. In vitro and in vivo experiments will be conducted with breast cancer, colorectal cancer, and pancreatic cancer, and all of these cancers are expected to respond to the compounds and compositions. In addition, these compositions and compounds can be used to treat a variety of other cancer types, such as but not limited to lung cancer, liver cancer, biliary tract cancer, and cervical cancer.

[0067] In addition, the compounds and compositions of the present disclosure are expected to be effective in treating infectious diseases in patients, such as malaria, and in treating side effects of diabetes.

[0068] A further use of the compounds and compositions of the present disclosure is a method for diagnosing cancer in a patient, which is carried out by the following steps: contacting tissue from the patient with an anti-SLC2A1 antibody; and determining the presence of SLC2A1 overexpression in the tissue as an indication of the presence of cancer. Detailed Description

[0070] Chicken immunization, discovery and isolation of monoclonal antibodies that bind to SLC2A1 using Hybrifree technology

[0071] Immunization, discovery, and isolation of monoclonal antibodies that recognize the SLC2A1 protein using the Hybrifree technology (Kivi G et al., BMC Biotechnol. 2016; 16:2; this document is incorporated herein by reference). Brown Nick chickens approximately 5 to 8 months old were immunized 5 times with a combination of 0.6 mg of the SLC2A1 DNA expression vector per injection and electroporation (EP). Subsequently, they were given a final boost immunization with SLC2A1 pseudotyped VLPs. Every 2 to 2.5 weeks later, the chickens were immunized intramuscularly and intradermally. 2.5 weeks after the 5th immunization, the chickens were given a boost immunization with SLC2A1 pseudotyped VLPs intramuscularly, intravenously, or intradermally. After confirming the antigen-specific antibody response in the serum, the spleens were collected 2 to 4 days after the final immunization. The animals were anesthetized, the spleens were removed and stored on ice until processing (within one hour). To prepare cell homogenates, the spleens were homogenized in ice-cold PBS using a 40 μm cell dissociation sieve. The cells were pelleted and frozen in 1 ml cryovials using ice-cold freezing medium [fetal bovine serum, (FBS) + 10% DMSO]. For antibody isolation, the frozen spleen cell suspension was thawed, washed, and collected into 10 ml of RPMI 1640 supplemented with penicillin / streptomycin and 10% FBS. The cells were then seeded into 100 mm cell culture dishes and incubated at 37 °C in an 8% CO2 atmosphere for approximately 1 h. Then, the free-floating cells (the fraction enriched in B cells and separated from plastic-adherent cells such as macrophages) were collected, the viable cell count was determined, and the cells were transferred to capture medium (RPMI 1640 supplemented with 0.5% BSA and 0.1% NaN3). To capture or pan B cells that express SLC2A1 protein-specific antibodies on their surface, the MaxiSorp TM Surface 96-well (Thermo Fisher Scientific, US) was coated with SLC2A1 pseudotyped VLPs and blocked with a PBS solution of 2% BSA for 1 h. One hundred microliters of the cell suspension containing 4 × 10 4 viable cells in the capture medium was loaded into a single well. The plate was centrifuged (200 × g, 5 min) and incubated for 45 to 60 min. The medium was discarded, and the loosely attached cells were removed by washing 4 to 5 times with PBS. Finally, the plastic-bound cells were lysed and total RNA isolation and cDNA synthesis were performed using oligo-T primers. Using SuperScript provided by the kit TMThe first-strand synthesis system (Thermo Fischer Scientific catalog number: 18091050) and oligo d(T)20 primer were used for cDNA synthesis. Forward primers that bind to the FR1 region of the VH or VL_λ light chain coding sequences and reverse primers that bind to the junction region between the variable region coding sequence and the constant region coding sequence of the chicken IgY heavy chain and λ light chain were used to amplify the cDNA of the antibody VH and VL regions.

[0072] The chicken HC forward primer was based on SEQ ID NO:321

[0073] (GTGACCACAGGCGTCCACAGCGCCGTGACGTTGGACGAGTCCG)

[0074] The chicken HC reverse primer was based on SEQ ID NO:322

[0075] (CACGCTAGGTCCCTTGGTCGAAGCGGAGGAGACGATGACTTCG GTC)

[0076] The chicken LC-λ forward primer was based on SEQ ID NO:323

[0077] (GGCTGACAGACGCCAGGTGCGCGCTGACTCAGCCGTCCTCG)

[0078] The chicken LC reverse primer was based on SEQ ID NO:324

[0079] (GGAGCGGCCTTAGGCTGGCCTAGGACGGTCAGGGTTGTCCC)

[0080] Using a ligase-independent cloning strategy, both the VH and VL PCR products recovered from the same capture reaction were precisely ligated at the 5'-end to the promoter and the secretory leader peptide cDNA and at the 3'-end to the constant domain cDNA. This reaction generated only native linkages between the variable and constant domains in the human IgG1 heavy and λ light chains, respectively. The final product generated by the cloning reaction was the pQMCF IgG shuttle expression vector, which contained an ampicillin resistance gene for the selective growth of transformed Escherichia coli and separate mammalian expression cassettes for the IgG1 heavy and light chains, respectively. The cloning reaction was transformed into competent Escherichia coli cells, and the bacterial culture was propagated in liquid medium. The plasmid DNA product was then purified from the propagated bacteria, yielding a library pool of antibody expression vectors. In principle, such a library pool was a VH / VL combinatorial library of a limited number of VH and VL sequences recovered from the same capture reaction and ligated in pairs in a single expression vector molecule. The efficiency of antigen-specific IgG reconstruction of VH and VL combinations was initially analyzed via transfection of the library pool. DNA was transfected into CHO cells, and 48 h - 72 h later, the secretion of IgG molecules specifically recognizing the SLC2A1 protein (VLP) in the culture supernatant was evaluated by ELISA, indicating the presence of the desired VH / VL combinations in the library. Next, the library pool showing a distinct positive signal was divided into individual clones by back-transformation into competent Escherichia coli cells and picking individual bacterial colonies (each bacterial colony containing a single type of plasmid with a unique VH and VL combination). Then, the specific SLC2A1-binding assay by ELISA was repeated using the supernatant of CHO cells transfected with plasmid DNA preparations from individual clones instead of the library pool. Finally, the VH and VL sequences were identified by sequencing the VH and VL insert sequences of the positive plasmid clones.

[0081] Affinity Maturation Library and Oligonucleotide Design

[0082] An affinity maturation library was designed based on structural analysis and a rational approach. Four oligonucleotides annealing to the H1, H2, H3, and L3 CDR regions containing different numbers of randomized codons were synthesized. Oligonucleotide randomization was performed using non-equimolar degenerate oligonucleotides that incorporated nucleotide mixtures at specific positions during DNA synthesis (Integrated DNA Technologies), and mutagenic oligonucleotides were generated.

[0083] Using the Kunkel mutagenesis protocol (Kunkel, 1985), mutated oligonucleotides were used to generate an affinity matured library with randomized CDR regions H1, H2, H3, and L3. To enforce mutagenesis and avoid obtaining wt#33Fab displayed on phage, two tandem stop codons (TAA and TGA) were introduced into the template phagemid in CDR H2 by Kunkel mutagenesis. These stop codons replaced two amino acids in CDR H2 to generate a stop template, thus generating non-functional Fab. The stop template was generated with the AM_H2_Stop_Short oligonucleotide according to SEQ ID NO:332.

[0084] CTGGAATTCGTCGCAGCTATTTAATGATGGACAGCCTACGCGAC

[0085] ccc-dsDNA with desired mutations was electroporated into SS320 E. coli cells, grown overnight, and the phage library was extracted by PEG / NaCl precipitation the next day. Nunc ImmunoSorp 96-well ELISA plates (ThermoFisher Scientific, US) were coated with a PBS solution of SLC2A1 VLP or BSA, then washed and blocked with 1% BSA, 0.05% Tween 20. The library was incubated on a negative BSA selection plate, then the library was transferred to an SLC2A1 selection plate for positive selection. Unbound, non-specific, and weakly binding phages were removed with wash buffer, and target-bound phages were eluted with 0.1 M HCl and subsequently neutralized with 1 M Tris pH 11 buffer. The eluted phages were then collected and used for titration or reinfection. For reinfection, XL1 Blue cells were infected with the phage output and helper phage M13KO7 (New England Biolabs, US) to precipitate phages the next day. SLC2A1-specific phages were identified by SLC2A1 VLP ELISA, and the VH and VL sequences of positive phage clones were identified by PCR amplification and sequencing of the VH and VL insert sequences.

[0086] The PCR amplification forward primer was according to SEQ ID NO:333.

[0087] TGTAAAACGACGGCCAGTCTATTGCTACAAATGCCTATGCATCC

[0088] The PCR amplification reverse primer was according to SEQ ID NO:334.

[0089] CAGGAAACAGCTATGACCCACCGGTTCGGGGAAGTAG

[0090] The sequencing forward primer is based on SEQ ID NO:335.

[0091] TGTAAAACGACGGCCAGT

[0092] The sequencing reverse primer is based on SEQ ID NO:336

[0093] CAGGAAACAGCTATGACC

[0094] ELISA-based VLP binding assay

[0095] An ELISA-based VLP binding assay was performed to compare the EC50 values of antibody clones ( Figure 1 ). Similarly, an ELISA-based VLP binding assay was performed to compare the binding of antibodies to different glucose transporters (Figure 3). MaxiSorpTM high-capacity binding ELISA plates (Thermo Fisher Scientific, US) were coated overnight with a PBS solution of 5 μg / mL SLC2A1, SLC2A2, SLC2A3, SLC2A4 pseudotyped VLPs or MOCK VLPs. The plates were washed and blocked for 1 h with a PBS solution of 0.05% Tween 20, 2% BSA. Serial dilutions of antibodies were incubated on the washed plates for 1 h, followed by incubation with a goat anti-human IgG horseradish peroxidase (HRP)-conjugated antibody (Invitrogen) for 1 h. TMB (3,3',5,5'-tetramethylbenzidine) solution VII (Biopanda Diagnostics) was used as the substrate for HRP, and 0.5 M H2SO4 was used as the stop solution. After each step, the wells were washed with a PBS solution of 0.05% Tween 20, 0.1% Proclin 300. Absorbance at 450 nm was measured using a ThermoScientific TM Multiskan TM FC microplate photometer. Exemplary antibodies 1G2#9, 2A2#12, 2E5#22, 5G5#30, 6F12#33, 7C3#39 that were reasonably used all bound to SLC2A1 VLPs with low nanomolar EC50 values ( Figure 1 ). The binding of exemplary antibodies 2E5#22 and 6F12#33 to SLC2A2, SLC2A3, and SLC2A4 VLPs did not exceed their binding to MOCK VLPs (Figure 3).

[0096] Flow cytometry-based cell binding assay

[0097] A flow cytometry-based binding assay using HepG2 wild-type (wt, Abcam, ab275467) and SLC2A1 knockout (KO) cells (Abcam, ab280797) was performed to demonstrate specific binding of anti-SLC2A1 antibodies to the SLC2A1 membrane protein (Figure 2). For this purpose, 0.1 × 10 6 cells were incubated on ice in flow cytometry buffer (PBS solution with 1% FBS, 1 mM EDTA) in the presence of 100 nM anti-SLC2A1 antibody solution. Subsequently, they were incubated with secondary goat anti-human IgG AF488 antibody (Jackson Immuno Research). Mean fluorescence intensity (MFI) was measured in the FITC channel using a Becton, Dickinson and Company Accuri C6 Plus flow cytometer, and the MFI ratio was calculated by dividing the MFI of each antibody by the MFI of the anti-HEL isotype (Icosagen Cell Factory) control staining. An MFI ratio higher than 1.5 was considered binding. None of the evaluated antibodies bound to HepG2 SLC2A1 KO when the MFI ratio was below 1.5. However, all antibodies bound to HepG2 wild-type cells with an MFI ratio far higher than 1.5. The results demonstrated specific binding to the SLC2A1 membrane protein.

[0098] 2-Deoxyglucose uptake assay

[0099] To evaluate whether the anti-SLC2A1 antibody inhibits glucose uptake, a commercial Glucose Uptake-Glo assay kit (Promega) was used according to the manufacturer's instructions. Briefly, HEK-293-ALL cells were transfected with a human SLC2A1 expression plasmid and incubated overnight at 37 °C in the presence of 5% CO2. The cells were washed twice with 0.5% BSA PBS and 7000 cells per well were plated into 0.5% BSA PBS in a white clear-bottom 96-well plate in the presence of 0.35 nM to 6.89 μM anti-SLC2A1 antibody or the glucose uptake inhibitor BAY-876 (Cayman Chem). The cells were incubated at room temperature for 2 h. Glucose uptake was initiated by adding 1 mM 2-deoxyglucose (2DG) and allowed to proceed for 20 min at 37 °C in the presence of 5% CO2. After adding the termination and neutralization reagents included in the kit, luminescence was measured using a GloMax Explorer microplate reader (Promega). Non-specific luminescence was measured in lysates from cells without the addition of (2DG). The data were normalized to non-specific luminescence and the average luminescence in the absence of inhibitor. A strong concentration-dependent decrease in glucose uptake was observed after the addition of anti-SLC2A1 antibody; exemplary rational antibodies 2E5#22 and 6F12#33 or BAY-876 were used to show the results in Figure 4.

[0100] Cell proliferation inhibition assay

[0101] The Incucyte S3 live-cell analysis instrument and the Cell-by-Cell analysis software module (Sartorius) were used to evaluate the effect of anti-SLC2A1 antibody on label-free cancer cell proliferation ( Figures 5 - 11). Seed MCF7, PC3, or PANC1 or MIAPACA2 cells in a flat-bottom tissue culture 96-well plate in Plasmax medium (Ximbio) supplemented with 2.5% FBS. Incubate the cells overnight and add 0.02 nM to 13 μM anti-SLC2A1 antibody, anti-HEL isotype control, PBS, or BAY-876 alone or in combination with metformin (Cayman Chem), phenformin (Sigma Aldrich), or IACS-010759 (Cayman Chem) to the cells. Measure cell confluence or object count with an Incucyte S3 over 24 h to 96 h and normalize to the time point 0 h or 4 h. Anti-SLC2A1 antibody alone and especially in combination with complex-I inhibitors metformin, phenformin, and IACS-010759 inhibits cancer cell proliferation. Exemplary antibodies 1G2#9, 2A2#12, 2E5#22, 5G5#30, 6F12#33, 7C3#39, and R14#54 are used in the proliferation assay.

[0102] Antitumor efficacy against MiaPaca2 xenograft tumors

[0103] Hsd: Nude-Foxn1 athymic nu Mice (10 per group) are subcutaneously inoculated with 5e6 MiaPaca2 cells / mouse. Allow the tumors to reach a size of 100 mm3 and then initiate IP treatment with 200 μg of 6F12#33 per mouse, and administer phenformin 20 mg / kg / IP every 72 h, daily, or not at all. Figures 12A to 12C Shown are the measurements of tumor volume over time, body weight over time, and serum concentration over time. Using a mixed-effects model and subsequently a Tukey post hoc test, a statistically significant tumor growth inhibition was observed for the co-treatment of 6F12#33 and phenformin compared to phenformin alone. Body weight remained constant. The antibody levels in serum monitored by VLP ELISA remained stable during the experiment.

[0104] Characterization of antibody clones

[0105] The obtained antibody clones are described in the table below by VH and VL sequences and heavy and light chain CDRs.

[0106] Table 1. Characterization of antibody clones

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139] ELISA results showed that the anti-SLC2A1 antibodies bound their targets expressed on the surface of VLPs with high affinity( Figure 1 ). In addition, the antibodies bound to HepG2 tumor cells endogenously expressing SLC2A1 (Figure 2). The antibodies were highly specific for SLC2A1 as they did not bind to HepG2 cells negative for SLC2A1 (knockout (KO) HepG2 cells, Abcam, ab280797). Specific binding to SLC2A1 compared to other related glucose transporters was demonstrated in ELISA-based SLC2A2, SLC2A3, and SLC2A4 VLP binding assays (Figure 3). Some binding of the 2E5#22 antibody to other VLPs besides SLC2A1 was observed due to low endogenous levels of SLC2A1 on all VLPs (determined by mass spectrometry, data not shown). Importantly, the anti-SLC2A1 antibodies described herein were potent inhibitors of glucose uptake (Figure 4). Glucose uptake inhibition directly affects the ability of cancer cells to promote their growth via glycolysis. However, this may force the cells to rely on OXPHOS as an alternative for maintaining proliferation. Indeed, when MCF7 breast cancer cells were incubated in the presence of the anti-SLC2A1 antibody 2E5#22, only a modest inhibition of cell growth was observed using the Incucyte live cell analysis system, which tracks cell growth as the change in confluence or cell count over time( Figure 5 ). Metformin, phenformin, and IACS-010759 are all inhibitors of OXPHOS. We used combinations of the anti-SLC2A1 antibody with metformin, phenformin, and IACS-010759 to simultaneously inhibit both glycolysis and OXPHOS and enhance growth inhibition. When MCF7 breast cancer cells were treated with combinations of anti-SLC2A1 5G5#30 or 6F12#33 with metformin, phenformin, or IACS-010759, MCF7 breast cancer cell growth was significantly inhibited ( Figure 6 , Figure 7 and Figure 8 ). The effects of metformin, phenformin, or IACS-010759 and anti-SLC2A1 combination treatments were much greater than the growth inhibition induced by anti-SLC2A1 alone( Figure 6 , Figure 7 and Figure 8)。However, metformin, phenformin, or IACS-010759 alone did not affect the cell growth of the MCF7 breast cancer cell line ( Figure 6 , Figure 7 and Figure 8 ), respectively).

[0140] The rapid and effective anti-proliferative effect of anti-SLC2A1 antibodies in combination with OXPHOS inhibitors such as phenformin enables easy comparison of anti-SLC2A1 antibodies ( Figure 9 ) after 24 hours of co-treatment incubation. In Figure 9 , antibodies 2E5#22, 5G5#30, 6F12#33, and 7C3#39 stood out as the most effective growth inhibitors of MCF7 breast cancer cell growth in combination with phenformin. No growth inhibition was detected when phenformin was used alone or in combination with antibodies 1G2#9 and 2A2#12 or isotype control ( Figure 9 ). In Figure 10 , R14#54 and 6F12#33 anti-SLC2A1 antibodies demonstrated concentration-dependent growth inhibition of MCF7 cells in the presence of 130 μM phenformin, and R14#54 appeared to be the most effective antibody.

[0141] The 2E5#22 and 6F12#33 anti-SLC2A1 antibodies and the OXPHOS inhibitor IACS-010759 were used as exemplary compounds to evaluate the effect of combination therapy in other tumor types, and other compounds with similar OXPHOS inhibitory effects can also be used. Strong synergistic growth inhibition of 2E5#22 and IACS-010759 was observed in the prostate cancer cell line PC3 compared to single-agent treatment (Figure 11A). In addition, in the pancreatic cancer cell lines PANC1 and MIAPACA2, the same significant growth reduction was detected with co-treatment with 6F12#33 and IACS-010759 compared to single-agent treatment ( Figure 11B and Figure 11C ), respectively. PC3 and MIAPACA2 cell growth was inhibited by treatment with IACS-010759 alone, while MIAPACA2 cells showed sensitivity to anti-SCL2A1 single treatment (Figure 11). This highlights the heterogeneity of the metabolic pathways utilized by tumor cells. Nevertheless, combining anti-SCL2A1 antibodies with OXPHOS inhibitors has excellent growth inhibitory effects, and the in vitro results presented in Figure 11 suggest that this combination could be an option for restricting the growth of multiple tumor types.

[0142] In an in vivo experimental system in which immunodeficient mice were xenografted with MIAPACA2 pancreatic cancer cells, the anti-SLC2A1 antibody alone had no effect on tumor growth. However, as observed in the in vivo assay, co-treatment with the anti-SLC2A1 antibody 6F12#33 and phenformin resulted in a statistically significant inhibition of tumor growth( Figure 12A ). No change in animal body weight was observed during the treatment (Figure 12B), and the antibody level was not decreased( Figure 12C ).

[0143] References

[0144] [1] Yan, N. Trends Biochem. Sci. 38, 151-159 (2013).

[0145] [2] Jardetzky, O. Nat. 1966 2115052 211, 969-970 (1966).

[0146] [3] Quistgaard, E. M. et al. Nat. Struct. Mol. Biol. 2013 206 20, 766-768 (2013).

[0147] [4] Mueckler, M. et al. Mol. Aspects Med. 34, 121-138 (2013).

[0148] [5] Thorens, B. Diabetologia 58, 221-232 (2015).

[0149] [6] Leto, D. et al. Nat. Rev. Mol. Cell Biol. 13, 383-396 (2012).

[0150] [7] Vannucci, S. J. et al. Glia 21, 2-21 (1997).

[0151] [8] Moley, K. H. Semin. Reprod. Med. 17, 137-152 (1999).

[0152] [9] Hankir, M. K. et al. EMBO Rep. 19, e46404 (2018).

[0153]

[10] Mueckler, M. et al. Science(80-.). 229, 941-945 (1985).

[0154]

[11] Morgello, S. et al., Glia 14, 43 - 54 (1995).

[0155]

[12] Shim, B.Y. et al., Int. J. Color Dis. 2012 283 28, 375 - 383 (2012).

[0156]

[13] Sun, H.W. et al., PLoS One 11, e0168907 (2016).

[0157]

[14] Hanahan, D. et al., Cell 144, 646 - 674 (2011).

[0158]

[15] Noguchi, Y. et al., Cancer Lett. 154, 175 - 182 (2000).

[0159]

[16] Ito, S. et al., J. Natl. Cancer Inst. 94, 1080 - 1091 (2002).

[0160]

[17] Seki, T. et al., Nature 608, 421 - 428 (2022).

[0161]

[18] Wei, M. et al., Biochem. Biophys. Res. Commun. 503, 1154 - 1159 (2018).

[0162]

[19] Wang, J. et al., Proc. Natl. Acad. Sci. U.S.A. 116, 10744 - 10748 (2019).

[0163]

[20] Lu, L. et al., J. Cell Physiol. 228, 251 - 257 (2013).

[0164]

[21] Warburg, O. et al., J. Gen. Physiol. 8, 519 - 530 (1927).

[0165]

[22] Heiden, M.G.V. et al., Science (80 -.). 324, 1029 - 1033 (2009).

[0166]

[23] Yamamoto, T. et al., Biochem. Biophys. Res. Commun. 170, 223 - 230 (1990).

[0167]

[24] Zhang, X. et al. BMC Cancer 21, 1 - 10 (2021).

[0168]

[25] Beaney, R. P. Semin. Nucl. Med. 14, 324 - 341 (1984).

[0169]

[26] Ojelabi, O. A. et al. J. Biol. Chem. 291, 26762 (2016).

[0170]

[27] Siebeneicher, H. et al. ChemMedChem 11, 2261 (2016).

[0171]

[28] Olszewski, K. et al. Cell Chem. Biol. 29, 423 - 435.e10 (2022).

[0172]

[29] Koppula, P. et al. J. Biol. Chem. 292, 14240 (2017).

[0173]

[30] Shin, C. S. et al. Nat. Commun. 2017 81 8, 1 - 11 (2017).

[0174]

[31] Martínez - Reyes, I. et al. Nat. Commun. 2020 111 11, 1 - 11 (2020).

[0175]

[32] Yang, Y. et al. Cancer Genet. Cytogenet. 196, 45 - 55 (2010).

[0176]

[33] Birsoy, K. et al. Nat. 2014 5087494 508, 108 - 112 (2014).

[0177]

[34] Saxena, N. et al. JNCI J. Natl. Cancer Inst. 108, 287 (2016).

[0178]

[35] Sottnik, J. L. et al. Clin. Exp. Metastasis 28, 865 - 875 (2011).

Claims

1. An antibody or antigen-binding fragment thereof that binds to the SLC2A1 protein and inhibits glucose uptake by tumor cells.

2. The antibody or antigen-binding fragment according to claim 1, wherein the antibody or antigen-binding fragment binds to SLC2A1 with an EC50 value of less than 10 nM, more preferably less than 5 nM, and most preferably less than 2 nM.

3. The antibody or antigen-binding fragment according to claim 1 or 2, wherein the antibody or antigen-binding fragment comprises one or more complementarity-determining regions (CDRs) having an amino acid sequence selected from the group consisting of: Heavy chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID 41-80 and SEQ ID NO: 337; heavy chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID 81-120 and SEQ ID NO: 339; heavy chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID 121-160 and SEQ ID NO: 340; and Light chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID NO: 201-240 and SEQ ID NO: 342; light chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID NO 241-280 and SEQ ID NO: 343; and light chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID NO: 281-320 and SEQ ID NO:

344.

5. The antibody or antigen-binding fragment according to any one of the preceding claims, comprising a heavy chain variable region having an amino acid sequence according to any one of SEQ ID NO: 161-180 and SEQ ID NO: 337 and / or a light chain variable region having an amino acid sequence according to any one of SEQ ID NO: 1-40 and SEQ ID NO:

341.

6. A method for inhibiting glucose uptake by tumor cells, the method comprising the step of administering to a patient suffering from a tumor a compound comprising at least one anti-SLC2A1 antibody or antigen-binding fragment thereof.

7. The method according to claim 5, wherein the antibody or antigen-binding fragment is according to any one of claims 1 to 4.

8. The method according to claim 5 or 6, wherein the method comprises co-administering or sequentially administering the compound with at least one oxidative phosphorylation inhibitor.

9. The method according to claim 7, wherein the at least one oxidative phosphorylation inhibitor is selected from the group consisting of metformin, phenformin, and IACS-010579.

10. A pharmaceutical composition for use in the treatment of cancer, the composition comprising one or more anti-SLC2A1 antibodies or antigen-binding fragments thereof, optionally in combination with one or more oxidative phosphorylation inhibitors.

11. The pharmaceutical composition according to claim 9, wherein the one or more antibodies or antigen-binding fragments thereof are selected from the antibodies and antigen-binding fragments according to any one of claims 1 to 4.

11. The pharmaceutical composition according to claim 9 or 10, wherein the one or more oxidative phosphorylation inhibitors are selected from the group consisting of metformin, phenformin, and IACS-010579.

12. The pharmaceutical composition according to any one of claims 9 to 11, wherein the composition inhibits the metabolism of cancer cells selected from breast cancer cells, liver cancer cells, colorectal cancer cells, lung cancer cells, pancreatic cancer cells, biliary tract cancer cells, and cervical cancer cells.

13. An anti-SLC2A1 antibody or a binding fragment thereof for use in the treatment of infectious diseases.

14. A method for treating an infectious disease, which method comprises administering an anti-SLC2A1 antibody or a binding fragment thereof to a patient.

15. The anti-SLC2A1 antibody or a binding fragment thereof according to claim 13, or the method according to claim 14, wherein the infectious disease is malaria.

16. An anti-SLC2A1 antibody or a binding fragment thereof for use in the treatment of diabetes side effects.

17. A method for treating diabetes side effects in a patient, comprising administering an anti-SLC2A1 antibody or a binding fragment thereof to the patient.

18. A method for diagnosing cancer, which method comprises contacting a tissue from a patient suspected of having the cancer with an anti-SLC2A1 antibody or a fragment thereof, and determining the presence of overexpression of SLC2A1 in the tissue as an indication of the presence of cancer, and wherein the overexpression is determined for treating the patient.

Images