Ancient tree tea endophytic burkholderia cepacia YN-7 and application thereof

Abstract

The invention belongs to the technical field of biocontrol strains of crops, and particularly relates to an endophytic burkholderia cepacia YN-7 of ancient tree tea and application of the endophytic burkholderia cepacia YN-7. According to the present invention, the endophytic Burkholderia cepacia YN-7 of the ancient tree tea is obtained through screening, and the preservation number of the endophytic Burkholderia cepacia YN-7 is CGMCC (China General Microbiological Culture Collection Center) No: 33203. The strain YN-7 and the microbial inoculum thereof are used for preventing and treating peanut black rot, peanut leaf rot and / or peanut brown spot, and the bacteriostatic effect is remarkable; the strain has the advantages of high yield and high yield, can obviously improve the fresh weight and dry weight of peanuts, obviously improve the chlorophyll content, promote the growth of peanuts and improve the soil environment, is an excellent strain with disease-resistant and growth-promoting functions, has obvious effects on promoting the growth of peanuts and preventing and treating peanut diseases, and has wide application prospects in the aspects of agricultural green production and soil improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of crop biocontrol strains, and particularly relates to an endophytic Burkholderia cepacia YN-7 from an ancient tea tree and an application thereof. Background Art

[0002] In recent years, the serious occurrence of soil-borne diseases and leaf diseases has threatened the sustainable development of the peanut industry. Peanut black rot caused by infection with Calonectria ilicicola is a quarantine pathogen for imported plants. It mainly harms the base of the peanut stem, root system, fruit needles and pods. The typical symptoms are blackening and rotting of the base of the peanut stem, fruit needles and pods and the entire root system, which eventually leads to plant wilting and death, posing a serious threat to the production and biosafety of crops such as peanuts and soybeans. Peanut brown spot is a global leaf fungal disease caused by infection with Cercospora arachidicola Hori, which poses a serious threat to peanut yield and quality. The disease mainly infects peanut leaves, causing leaf tissue damage and a significant decrease in photosynthetic efficiency, which in turn causes premature aging and shedding of leaves and reduced pod quality, ultimately resulting in a reduction in peanut production. It is worth noting that peanut leaf diseases often show the characteristics of complex infection. Brown spot disease occurs synergistically with black spot disease, leaf rot and other diseases, further aggravating the degree of damage, leading to large-scale peanut production reduction and causing significant impact on agricultural production.

[0003] At present, the prevention and control of soil-borne diseases and leaf diseases of peanuts mainly rely on chemical control. However, the long-term use of chemical pesticides not only leads to the enhancement of pathogen resistance, but also causes environmental pollution and agricultural product safety issues, which restricts the sustainable development of the peanut planting industry. Biological control, as a green prevention and control method, can use beneficial microorganisms to inhibit or reduce the number of pathogens and control the occurrence and development of plant diseases, which has significant advantages. Based on this, exploring and creating efficient biological microbial agent resources is an important way to achieve safe and effective prevention and control of such diseases. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems existing in the prior art, and proposes an endophytic Burkholderia cepacia YN-7 from ancient tea trees and its application. By developing and utilizing the endophytic bacterial resources of large-leafed ancient tea trees, the strain YN-7 obtained by screening is an excellent strain with both disease resistance and growth-promoting functions, which has a significant effect on promoting peanut growth and preventing and controlling peanut diseases, and has broad application prospects in agricultural green production and soil improvement.

[0005] The technical solution of the present invention is:

[0006] The present invention protects an endophytic Burkholderia cepacia YN-7 from ancient tree tea. The preservation number of strain YN-7 is CGMCC No: 33203.

[0007] The present invention also protects a bacterial agent containing the endophytic Burkholderia cepacia YN-7 from ancient tree tea.

[0008] Furthermore, the bacterial agent includes one or several of the bacterial suspension of strain YN-7, volatile gas, and fermented broth containing bacteria.

[0009] The present invention also protects the application of the strain YN-7 or the bacterial agent in preventing and treating peanut black rot, peanut leaf rot, and / or peanut brown spot.

[0010] The present invention also protects the application of the strain YN-7 or the bacterial agent in increasing the chlorophyll content of peanut leaves.

[0011] Furthermore, the roots of peanut plants are irrigated with the fermented broth containing bacteria of strain YN-7 at a dose of 10 mL / plant and a concentration of 1×10 8 CFU / mL.

[0012] The present invention also protects the application of the strain YN-7 or the bacterial agent in promoting the growth of peanuts.

[0013] Furthermore, the roots of peanut plants are irrigated with the fermented broth containing bacteria of strain YN-7 at a dose of 10 mL / plant and a concentration of 1×10 8 CFU / mL; the strain YN-7 or the bacterial agent promotes the increase in the fresh weight and dry weight of peanut plants.

[0014] Bacterial strain preservation information:

[0015] Burkholderia cepacia YN-7 was preserved in the China General Microbiological Culture Collection Center on December 27, 2024. The preservation number is CGMCC No.33203, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0016] Advantages of the present invention:

[0017] The endophytic bacterium YN-7 (Burkholderia cepacia) screened from the ancient big-leaf tea trees of the present invention has a broad-spectrum antibacterial effect, especially a significant antibacterial effect on the quarantine disease upon entry - the peanut black rot pathogen, and can effectively reduce the occurrence of the soil-borne disease peanut black rot; at the same time, it also has a good control effect on peanut leaf diseases such as peanut brown spot and peanut leaf rot. The YN-7 strain can produce cellulase, protease and β-1,3-glucanase, and also has the abilities of nitrogen fixation, phosphorus solubilization, potassium solubilization and siderophore production. The YN-7 strain can significantly increase the fresh weight and dry weight of peanuts, significantly increase the chlorophyll content, promote the growth of peanuts, and improve the soil environment. It is an excellent strain with both disease resistance and growth promotion functions, and has broad application prospects in agricultural green production and soil improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is the colony morphology of strain YN-7 on LA medium;

[0019] Figure 2 is the phylogenetic tree constructed by strain YN-7 based on 16S rDNA and gyrB;

[0020] Figure 3 is the antagonistic effect of the bacterial suspension of strain YN-7 against the peanut black rot pathogen, peanut leaf rot pathogen and peanut brown spot pathogen;

[0021] Figure 4 is the inhibitory effect of the volatile gas of strain YN-7 on the peanut black rot pathogen and peanut leaf rot pathogen;

[0022] Figure 5 is the characteristics of strain YN-7 to produce cellulase, protease, nitrogen fixation, phosphorus solubilization, potassium solubilization and siderophore production;

[0023] Figure 6 is the effect of the fermented broth with bacteria of strain YN-7 on the fresh weight and dry weight of peanuts;

[0024] Figure 7 is the effect of the fermented broth with bacteria of strain YN-7 on the chlorophyll content of peanut leaves. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0026] To further understand the present invention, the present invention will be further described in conjunction with the accompanying drawings and embodiments.

[0027] In the following examples, the experimental methods are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, culture media, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0028] LA medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0029] LB medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0030] PDA medium: 200 g of potato, 20 g of glucose, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0031] PDB medium: 200 g of potato, 20 g of glucose, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0032] Cellulase detection medium: 2 g of sodium carboxymethyl cellulose, 0.2 g of congo red, 1 g of K2HPO4, 0.5 g of MgSO4, 2 g of (NH4)2SO4, 2 g of peptone, made up to 1000 mL with deionized water.

[0033] Protease detection medium: 10 g of imported skim milk powder, 15 g of agar, made up to 1000 mL with deionized water.

[0034] Ashby nitrogen-free medium: 15 g of mannitol, 0.2 g of CaCl2·2H2O, 0.2 g of K2HPO4, 0.2 g of MgS04·7H2O, 0.001 g of MoO3, 0.005 g of FeC13, 15 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0035] Phosphate-solubilizing medium: 10.0 g of glucose, 0.5 g of ammonium sulfate, 0.5 g of yeast extract powder, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, 5.0 g of calcium phosphate, 15.0 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0036] Potassium-solubilizing medium: 5.0 g of sucrose, 0.5 g of magnesium sulfate, 2.0 g of disodium hydrogen phosphate, 0.005 g of ferric chloride, 0.1 g of calcium carbonate, 1.0 g of soil minerals, 18 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0037] CAS medium: 60.5 mg of chrome azurol S (CAS), 72.9 mg of hexadecyltrimethylammonium bromide (HDTMA), 2.645 mg of FeC1·6H2O, 4.5 g of peptone, 9 g of glucose, 2.7 g of beef extract powder, 4.5 g of NaCl, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0038] Example 1

[0039] Isolation and identification of Burkholderia cepacia YN-7

[0040] 1. Isolation and purification of strains

[0041] Sampling: Fresh leaves of ancient tree tea of Daye variety in Xigu, Lincang, Yunnan were collected and brought back to the laboratory for storage at 4 °C for later use.

[0042] Isolation of strains: The surface of the sample was washed three times with sterile water to remove surface impurities. The sample was cut into appropriate sizes with a sterile scalpel, immersed in 75% ethanol for 30 s for surface disinfection, and then rinsed three times with sterile water. The surface-disinfected sample was placed in a sterile mortar, and sterile phosphate buffer was added and ground into a homogenate. 50 μL of the sample homogenate was evenly spread on the LA solid medium, and each sample was repeated three times. The plates were incubated in the dark at 28 °C for 24 h.

[0043] Purification of strains: Single colonies with obvious morphological differences were selected and purified three times by the LA medium plate streaking method. Different strains were numbered according to their colony morphological characteristics, and the purified strains were stored in 50% sterilized glycerol tubes and stored in a -80 °C ultra-low temperature refrigerator for long-term preservation.

[0044] 2. Screening of strains

[0045] Using the peanut black rot pathogen as the indicator bacterium, by the plate confrontation method, a 6-mm diameter peanut black rot pathogen agar disc was inoculated in the center of the LA medium plate. 5 μL of the culture solution of the strain to be tested was aspirated with a pipette and inoculated 2 cm away from the pathogen. The plate was incubated in the dark at 25 °C for 7 - 10 d, and the formation of the inhibition zone was observed to evaluate the inhibitory effect of the strain to be tested on the pathogen. Strains with significant antagonistic effects were screened out and named YN-7.

[0046] As Figure 1 shown, it is the colony morphology of strain YN-7 on the LA medium.

[0047] 3. Identification of Bacterial Strains

[0048] The genomic DNA of strain YN-7 was amplified by PCR using the 16S rDNA universal primers 27F (5’AGAGTTTGATCMTGGCTCAG 3’) (SEQ ID NO:3) and 16S-R (5’AAGGAGGTGATCCAGCCGCA 3’) (SEQ ID NO:4), and the gyrB gene primers UP-1E (5’CAGGAAACAGCTATGACCAYGSNGGNGGNAARTTYR 3’) (SEQ ID NO:5) and APrU (5’TGTAAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA 3’) (SEQ ID NO:6). The PCR products were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0049] The full length of the 16S rDNA sequence is 1402 bp, and the sequence is shown in SEQ ID NO:1:

[0050]

[0051] The full length of the gyrB gene sequence is 1168 bp, and the sequence is shown as SEQ ID NO:2:

[0052]

[0053] The obtained sequences were subjected to BLAST analysis and alignment. Based on the 16S rDNA and gyrB sequences, a phylogenetic tree was constructed using MEGA 11.0 software, as Figure 2 shown. The results showed that strain YN-7 was on the same branch as Burkholderia cepacia ATCC 25416, and the similarity between strain YN-7 and Burkholderia cepacia ATCC 25416 reached 95%, indicating that strain YN-7 was a new Burkholderia cepacia. Burkholderia cepacia YN-7 was deposited in the China General Microbiological Culture Collection Center with the deposit number CGMCC No. 33203.

[0054] Example 2

[0055] Inhibitory effect of Burkholderia cepacia YN-7 bacterial suspension on the mycelial growth of pathogenic bacteria

[0056] The inhibitory effects of strain YN-7 on the pathogenic bacteria of peanut black rot, peanut leaf rot and peanut brown spot were determined by the methods of plate confrontation and inhibition zone.

[0057] (1) Preparation of bacterial suspension: Strain YN-7 was inoculated into liquid LB medium and cultured with shaking at 28 °C for 24 h, then centrifuged at high speed for 5 min, and the supernatant was discarded.

[0058] (2) Activation of pathogenic bacteria: The pathogenic bacteria cakes of peanut black rot and peanut leaf rot were respectively inoculated into the center of PDA medium and cultured in the dark at 25 °C for 3 - 7 d for standby. The pathogenic bacteria cake of peanut brown spot was inoculated into PDB medium and cultured with shaking at 25 °C for 5 d for standby.

[0059] (3) Plate confrontation method: A pathogenic bacteria cake with a diameter of 5 mm was inoculated in the center of LA medium, and 10 μL of the bacterial suspension of strain YN-7 was dropped at about 2 cm on both sides of the bacteria cake. Inoculating 10 μL of liquid LB medium was used as a control. Each treatment was repeated 6 times and cultured in the dark at a constant temperature of 25 °C. The inhibition rate was calculated according to the mycelial growth rate method. Inhibition rate (%) = (control colony growth diameter - treatment colony growth diameter) / control colony growth diameter × 100.

[0060] The results were as Figure 3 shown. Strain YN-7 had significant inhibitory effects on the pathogenic bacteria of peanut black rot and peanut leaf rot, and the inhibition rates were 76.01% and 78.11% respectively.

[0061] (4) Antibacterial circle method: Transfer 100 μL of the culture solution of Cercospora arachidicola to evenly coat on the PDA medium. Drop 10 μL of the bacterial suspension of YN-7 in the center of the medium. Use the inoculation of 10 μL of liquid PDB medium as a control. Each treatment is repeated 6 times and cultured at a constant temperature of 25 °C in the dark. Antibacterial rate (%) = (colony diameter of the control group - colony diameter of the treatment group) / colony diameter of the control group × 100.

[0062] The results are as Figure 3 shown. The strain YN-7 has a significant antibacterial effect on Cercospora arachidicola, and its inhibition rate is 84.12%.

[0063] Example 3

[0064] Inhibitory effect of volatile gases of Burkholderia cepacia YN-7 on the mycelial growth of pathogenic bacteria

[0065] Dip a sterilized toothpick into the bacterial suspension of strain YN-7 and evenly streak it on the LA medium plate. Inoculate a 5-mm diameter bacterial cake of the pathogenic bacteria in the center of another LA medium plate. Seal the two plates with a sealing film. Use a blank LA medium plate as a control. Each treatment has 6 replicates, measure the mycelial growth, and calculate the antibacterial rate.

[0066] The results are as Figure 4 shown. The volatile gases of strain YN-7 significantly reduced the growth of the mycelia of the pathogenic bacteria of peanut black rot and peanut leaf rot, and their inhibition rates were 75.76% and 59.45% respectively.

[0067] Example 4

[0068] Study on the metabolites of Burkholderia cepacia YN-7

[0069] (1) Cellulase detection

[0070] Inoculate the strain YN-7 on the cellulase detection medium plate and culture it at 28 °C for 5 days. The appearance of a hydrolysis clear circle around the colony indicates the production of cellulase.

[0071] The results are as Figure 5 shown. The strain YN-7 produced a hydrolysis clear circle on the cellulase detection medium, indicating that YN-7 has the ability to produce cellulase.

[0072] (2) Protease detection

[0073] Inoculate the strain YN-7 on the protease detection medium plate and culture it at 28 °C for 2 days. The appearance of a hydrolysis clear circle around the colony indicates the production of protease.

[0074] The results are as Figure 5As shown, strain YN-7 produced a hydrolysis clear zone on the protease detection medium, indicating that YN-7 has the ability to produce protease.

[0075] (3) β-1,3-glucanase detection

[0076] The β-1,3-glucanase activity of antagonistic bacterium YN-7 was detected using the β-1,3-glucanase kit from Keming Biotechnology Co., Ltd. The calculation method for β-1,3-GA activity is β-1,3-GA (mg / h / mL) = [(ΔA + 0.0192) ÷ 0.0958 × V1] ÷ V1 = 10.438 × (ΔA + 0.0192). The β-1,3-glucanase activity of strain YN-7 was 0.25 mg / h / mL.

[0077] In summary, strain YN-7 can secrete cellulase, protease, and β-1,3-glucanase. These hydrolases can effectively inhibit the growth of pathogenic bacteria by degrading the cell wall of pathogenic bacteria or destroying their key metabolic components, showing good application potential for disease resistance and antibacterial activity.

[0078] Example 5

[0079] Detection of nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production by Burkholderia cepacia YN-7

[0080] Ashby nitrogen-free medium, phosphorus-solubilizing medium, potassium-solubilizing medium, and CAS medium were used to detect whether strain YN-7 has the abilities of nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production.

[0081] The results are as Figure 5 shown. Strain YN-7 could grow on the nitrogen-fixing, phosphorus-solubilizing, potassium-solubilizing, and siderophore-producing plates. Obvious clear zones could be observed on the phosphorus-solubilizing and potassium-solubilizing plates, and obvious red halos could be seen on the siderophore-producing plate. This indicates that strain YN-7 has the abilities of nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production. Root irrigation treatment with bacterial agents such as the bacterial fermentation broth of strain YN-7 can activate soil nutrients (nitrogen, phosphorus, potassium, iron) and promote root absorption, thereby promoting plant growth.

[0082] Example 6

[0083] Control effect of the bacterial fermentation broth of Burkholderia cepacia YN-7 on peanut black rot

[0084] Strain YN-7 was inoculated into LB medium and cultured at 28 °C for 1 day to complete strain activation; the activated strain was inoculated into 100 mL of LB liquid medium and cultured with shaking at 28 °C and 180 rpm for 72 h to prepare the mother liquor of Burkholderia cepacia YN-7; the mother liquor was diluted with LB liquid medium to adjust the bacterial concentration to 1×108 CFU / mL, thus obtaining the fermented broth of Burkholderia cepacia YN-7 containing bacteria.

[0085] The peanut variety Huayu 36 was sown in flower pots. After 4 weeks, the control group was inoculated with the pathogen of peanut black rot and 10 mL of LB liquid medium, and the treatment group was inoculated with the pathogen of peanut black rot and the fermented broth of YN-7 containing bacteria (10 mL / strain) cultured with shaking for 3 days. There were 3 pots for both the control and the treatment, with 3 seedlings in each pot, and the experiment was repeated 3 times. Each treatment was carried out once a week. After 4 weeks, the incidence rate and disease index of peanuts in each treatment were counted, and the control effect of different treatments on peanut black rot was calculated. The pot experiment results showed that the control effect of YN-7 on peanut black rot reached 44.06% (Table 1).

[0086] Table 1 Control effect of strain YN-7 on peanut black rot in pot experiments

[0087]

[0088] Example 7

[0089] Effect of the fermented broth of Burkholderia cepacia YN-7 containing bacteria on the fresh weight and dry weight of peanuts

[0090] The peanut variety Huayu 36 was sown in flower pots. After 2 weeks, the roots were irrigated with the fermented broth of strain YN-7 containing bacteria (10 mL / strain, 1×10 8 CFU / mL), with the inoculation of an equal amount of LB liquid medium as the control. There were 3 pots for both the control and the treatment, and the experiment was repeated 3 times. Each treatment was carried out once a week. After 4 weeks, the fresh weight of peanuts was weighed, and the dry weight of peanuts was weighed after drying.

[0091] Statistics showed that compared with the control (CK), the fermented broth of strain YN-7 containing bacteria could significantly increase the fresh weight and dry weight of Huayu 36 plants, with an increase of 21.35% and 22.18% respectively compared with the control ( Figure 6 ).

[0092] Example 8

[0093] Effect of the fermented broth of Burkholderia cepacia YN-7 containing bacteria on the chlorophyll content of peanuts

[0094] The peanut variety Huayu 36 was sown in flower pots. After 2 weeks, the roots were irrigated with the fermented broth of strain YN-7 containing bacteria (10 mL / strain, 1×10 8 CFU / mL), with the inoculation of an equal amount of LB liquid medium as the control. There were 3 pots for both the control and the treatment, and the experiment was repeated 3 times. Each treatment was carried out once a week. After 4 weeks, the chlorophyll content (mg / g) of peanut leaves in the control and treatment groups was measured simultaneously using a portable photosynthesis and transpiration meter (CB-1102).

[0095] Statistics showed that, compared with the control (CK), the fermented broth of strain YN-7 could significantly increase the chlorophyll content in peanut leaves, and the chlorophyll content in the treatment group was significantly increased by 65.16% compared with the control group ( Figure 7 ).

[0096] In summary, the root irrigation treatment with the fermented broth of strain YN-7 could significantly increase the chlorophyll content in peanut leaves (+65.16%), thereby enhancing the photosynthesis efficiency, promoting plant growth, increasing the fresh and dry weights of peanuts, and showing a potential yield increase effect. Strain YN-7 is an excellent strain with both disease resistance and growth promotion functions, and has broad application prospects in agricultural green production and soil improvement.

[0097] The above description is only the preferred embodiment of the present invention and is not a limitation to the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, modifications, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An endophytic Burkholderia cepacia YN-7 from ancient tree tea, characterized in that, The preservation number of strain YN-7 is CGMCC No: 33203.

2. A microbial agent containing the endophytic Burkholderia cepacia YN-7 in ancient tree tea described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent includes one or several of the bacterial suspension of strain YN-7, volatile gas, and fermented broth with bacteria.

4. Application of the strain YN-7 described in claim 1 or the microbial agent described in claim 2 in preventing and treating peanut black rot, peanut leaf rot, and / or peanut brown spot.

5. Application of the strain YN-7 described in claim 1 or the microbial agent described in claim 2 in increasing the chlorophyll content of peanut leaves.

6. The application according to claim 5, characterized in that Irrigate the roots with the bacterial fermentation broth of strain YN-7, 10 mL / plant, 1×10 8 CFU / mL.

7. Application of the strain YN-7 described in claim 1 or the microbial agent described in claim 2 in promoting peanut growth.

8. The application according to claim 7, wherein Irrigate the roots with the bacterial fermentation broth of strain YN-7, 10 mL / plant, 1×10 8 CFU / mL; the strain YN-7 or the microbial agent promotes the increase in the fresh weight and dry weight of peanut plants.

Images