Insulin resistance method for promoting signal pathway based on CTRP9

Abstract

The invention relates to the technical field of insulin resistance, in particular to an insulin resistance method for promoting a signal channel based on CTRP9. The method comprises the following steps: constructing a human hepatocyte line plasmid; carrying out cell culture and transfection; detecting the influence of CTRP9 on LO human hepatocyte glucose uptake, PGC-1a gene expression and the phosphorylation level of insulin signal channel related protein; detecting the influence of CTRP9 on glucose uptake of an LO human hepatocyte insulin resistance model, PGC-1a gene expression and the phosphorylation level of insulin signal channel related protein; and carrying out SirT1 / PGC-1a protein expression detection. According to the insulin resistance method for promoting the signal channel based on the CTRP9, a human hepatocyte line is taken as an in-vitro research object, an in-vivo research environment is simulated, a corresponding insulin resistance model is established, and the insulin resistance can be obtained by using technologies such as flow cytometry analysis, RT-PCR (Reverse Transcription-Polymerase Chain Reaction), western blotting and signal channel inhibition. And the treatment effect of CTRP9 on hepatic cell insulin resistance and the specific action mechanism are researched.

Description

Technical Field

[0001] The present invention relates to the technical field of insulin resistance, and particularly to a method for insulin resistance based on promoting the CTRP9 signaling pathway. Background Art

[0002] Diabetes is one of the most important non-communicable diseases that seriously threaten human health, and its prevalence rate has been increasing year by year. Most of the diabetic patients in China are type 2 diabetes (Type 2 Diabetic Dellitus, T2DM), accounting for 90% of the total number of diabetes. T2DM is prone to various acute and chronic complications, which is the main cause of death of diabetic patients. The pathogenesis of T2DM is complex. Insulin resistance, as the main pathophysiological basis of type 2 diabetes, runs through the whole process of the occurrence and development of type 2 diabetes, but the mechanism of forming insulin resistance is still not very clear. In-depth study of the molecular mechanism of insulin resistance is of great significance for promoting the prevention and treatment of current diabetes and its complications.

[0003] Possible causes of insulin resistance: Insulin resistance refers to the decrease in the sensitivity and responsiveness of insulin target tissues to insulin under the action of various pathological factors, resulting in a decrease in the efficiency of glucose uptake and utilization and an increase in blood glucose levels, and the body compensatorily secretes too much insulin to produce hyperinsulinemia. The liver is an important target organ for the body's energy balance, glucose and lipid metabolism, and insulin action. It is very important to maintain the normal blood glucose state of patients by regulating and controlling liver glucose metabolism. In T2DM, liver glucose metabolism is disordered, and liver insulin resistance and being not regulated by insulin are important factors in the occurrence and development of T2DM. Liver insulin resistance may be related to the following factors:

[0004] ① Impaired insulin signal transduction causes abnormal glucose metabolism and transport disorders;

[0005] ② In obese patients, pro-inflammatory cytokines in adipocytes are activated, inducing endoplasmic reticulum stress and mitochondrial dysfunction;

[0006] ③ Abnormal metabolites such as elevated serum free fatty acids (FFA), low plasma adiponectin, and low leptin lead to insulin resistance; SirT1 (sirtuin 1) directly stimulates the insulin signaling pathway in insulin-sensitive organs such as the liver.

[0007] Research has confirmed that C1q tumor necrosis factor-related protein 9 (C1q tumor necrosis factor related Proteins--CTRP9) triggers the AdipoR1 / SirT1 / PGC-1a (peroxisome proliferator-activated receptor-coactivator-1a) signal and plays an important role in the formation of liver insulin resistance.

[0008] C1q Tumor Necrosis Factor-Related Protein Family (CTRPs) is a newly discovered highly conserved protein family homologous to adiponectin, including CTRP1 to CTRP15, which consists of an amino-terminal signal peptide, a collagen repeat domain, and a carboxy-terminal C1q-like globular domain. Among the CTRPs family, CTRP9 is a secreted glycoprotein produced by adipose tissue. The C1q region of CTRP9 has 54% amino acid sequence highly identical to adiponectin. Meanwhile, CTRP9 shares multiple common biochemical and structural characteristics ( Figure 1 ), including adipose-selective expression, domain, trimer formation, and post-translational modifications (proline hydroxylation and lysine glycosylation). More interestingly, CTRP9 can form heterotrimers with adiponectin in vivo and in vitro.

[0009] CTRP9 plays an important role in regulating blood glucose. Early animal studies found that overexpressing CTRP9 protein in ob / ob mice using an adenovirus vector method led to a decrease in blood glucose after 7 days, while the change in insulin was not obvious. Thus, CTRP9 may be involved in the process of glucose metabolism, but no further research was done on the specific process and possible mechanism of CTRP9's participation in glucose metabolism. In recent years, with the development of genetic engineering technology, some scholars have taken CTRP9 transgenic mice (CTRP9 KO mice) as the research object to further study the role of CTRP9 in metabolism: Zhikui Wei et al. found an increase in fasting insulin levels in CTRP9 KO mice and further calculated the Home-IR index. Through glucose tolerance test and insulin tolerance test, they concluded that the deletion of the CTRP9 gene could reduce the insulin clearance rate in mice and form insulin resistance. Another animal experiment study found that the phosphorylation level of protein kinase B (Akt) in the liver tissue of CTRP9 KO mice decreased under insulin stimulation, while there was no change in adipose tissue and skeletal muscle, indicating that there was insulin resistance in the liver of CTRP9 KO mice. However, whether the deletion of CTRP9 affects glucose uptake by the liver, hepatic glycogen synthesis, or hepatic gluconeogenesis needs further study.

[0010] Currently, the conclusions regarding CTRP9 in clinical studies are inconsistent. Multiple studies have shown that CTRP9 levels are significantly increased in patients with type 2 diabetes, and CTRP9 levels are positively correlated with insulin resistance index and obesity-related metabolic parameters. In mice, short-term upregulation of CTRP9 using adenovirus vectors and long-term overexpression of CTRP9 using transgenic strategies both significantly reduce blood glucose levels, insulin levels, and significantly improve insulin resistance. In addition, targeted deletion of CTRP9 results in insulin resistance in peripheral tissues, elevated fasting insulin levels, impaired hepatic insulin signal transduction, and reduced insulin tolerance sensitivity.

[0011] AMPK, as the main downstream component of the CTRP9 signal, is a serine / threonine kinase sensitive to cellular energy changes. CTRP9 regulates lipid metabolism by alleviating endoplasmic reticulum stress, which may lead to lipid deposition in the liver, based on AMPK-mediated autophagy induction. CTRP9 can also regulate the expression of hypothalamic orexigenic neuropeptides through a central pathway, thereby increasing food intake in a negative feedback manner. If CTRP9 expression decreases, hypothalamic orexigenic neuropeptides will be upregulated, leading to increased food intake and fat synthesis. It is known that liver X receptor a (LXRa) plays a central role in stimulating the transcription of ATP-binding cassette (ABC) transporter A1 (ABCA1) and ABCG1 genes. After CTRP9 activates AMPK, the lxra-dependent expression in vascular smooth muscle cells (VSMCs) increases significantly. Notably, the vasodilatory effect of CTRP9 is also mediated by the AMPK / Akt / eNOS pathway. After CTRP9 binds to N-cadherin, it triggers the phosphorylation of extracellular signal-regulated kinase (ERK) 1 / 2, resulting in a significant increase in the expression of matrix metalloproteinase 9 (MMP-9) and erythroid-derived nuclear factor 2-like 2 (Nrf2) in adipose-derived MSCs. In addition, CTRP9 increases the expression and activity of zinc finger transcription factor GATA4 in mouse hepatocytes in an erk5-dependent manner.

[0012] SirT1 / PGC-1α and Insulin Resistance: Another important mechanism involved in cellular redox regulation is the Sirtuins family, a cluster composed of seven homologous proteins that regulate peroxisome proliferator-activated receptor γ co-activator (PGC-1), cell biology, and metabolism through the deacetylation of histones and other cytokines such as NFκB, HSF1, p53, and FOXOs. By promoting deacetylation, Sirtuins can either promote or inhibit the activities of several protein targets. Sirt1 is the most extensively studied Sirtuin, mediating its roles in DNA damage response, lifespan regulation, and carcinogenesis through its NAD-dependent deacetylase activity. Sirt1 also plays important roles in metabolic tissues such as the liver, skeletal muscle, and adipose tissue, where Sirt1 deacetylates a series of substrates, including PGC1α, UCP2, NFκB, and Foxo1 proteins, which have significant effects on glucose homeostasis and insulin secretion. Increasing evidence suggests that SirT1 regulates glucose or lipid metabolism through its deacetylase activity on more than twenty known substrates and plays a positive role in metabolic pathways by directly or indirectly participating in insulin signaling. SirT1 also deacetylates many non-histone proteins such as p53, FOXOs, nuclear receptor co-repressors (SMRT / NCOR), and PGC-1α. In addition, Sirt1 also increases cellular stress by increasing insulin sensitivity, reducing free fatty acids and insulin-like growth factor (IGF-1) in circulation, increasing AMPK activity, increasing PGC-1α activity, and increasing the number of mitochondria.

[0013] PGC1α is a metabolic co-activator that interacts with transcription factors and induces mitochondrial biogenesis and respiration. Sirt1 can deacetylate PGC1α at several lysine residues, thereby enhancing its ability to activate gene transcription of target genes involved in mitochondrial biogenesis, and this ability indicates that the regulation of Sirt1 activity contributes to maintaining the number of mitochondria in cells. Increasing evidence suggests that a decrease in Sirt1 expression or activity may be related to the pathogenesis of insulin resistance-related diseases: studies have shown that the Sirt1 protein level is reduced in mice fed a high-fat diet and in two mouse models of aging, both of which are associated with insulin resistance. In addition, inhibiting Sirt1 can induce insulin resistance in cultured insulin-sensitive cells and tissues, and these effects together indicate the relationship between Sirt1 and insulin action.

[0014] Limited research data indicate that CTRP9 can specifically activate the AMPK, Akt, and p44 / 42 MAPK signaling pathways, reduce hepatic lipid deposition, increase glucose uptake, and ultimately lead to a decrease in blood glucose levels in mice. Further research shows that CTRP9 may regulate metabolism through peripheral mechanisms. On the one hand, CTRP9 can increase the mitochondrial content in skeletal muscle and enhance the expression levels of enzymes related to fatty acid oxidation, including long-chain acyl-CoA dehydrogenase (LCAD) and medium-chain acyl-CoA dehydrogenase (MCAD), and enhance basal metabolism and fat oxidation by activating adenosine monophosphate-activated protein kinase (AMPK). On the other hand, CTRP9 can also regulate lipid metabolism by alleviating endoplasmic reticulum stress, which may lead to lipid deposition in the liver. Existing research has demonstrated that Sirtuins are directly involved in regulating cellular stress responses through the deacetylation of certain factors: Sirt1 increases cellular stress resistance by increasing insulin sensitivity, reducing free fatty acids and insulin-like growth factor (IGF-1) in circulation, increasing AMPK activity, increasing PGC-1a activity, and increasing the number of mitochondria. In addition, Sirt1 acts through participating in signaling molecules such as PI3 kinase-Akt, MAPK, and p38mapk-β.

[0015] Therefore, an insulin resistance method based on the CTRP9-promoting signaling pathway is designed to provide another technical solution to the above technical problems. Summary of the Invention

[0016] Based on this, it is necessary to provide an insulin resistance method based on the CTRP9-promoting signaling pathway to solve the technical problems proposed in the above background technology.

[0017] To solve the above technical problems, the present invention adopts the following technical solutions:

[0018] An insulin resistance method based on the CTRP9-promoting signaling pathway comprises the following steps:

[0019] Construct a plasmid of the human hepatocyte cell line;

[0020] Perform cell culture and transfection;

[0021] Detect the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in LO human hepatocytes;

[0022] Detect the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in the insulin resistance model of LO human hepatocytes;

[0023] Perform SirT1 / PGC-1a protein expression detection;

[0024] Detect the molecular mechanism by which CTRP9 affects the function of SirT1 protein.

[0025] As a preferred embodiment of the insulin resistance method based on promoting the signal pathway by CTRP9 provided by the present invention, the steps for constructing the plasmid of human hepatocyte cell line are as follows:

[0026] Amplify the full coding region cDNA fragment of mouse L02 gene by RT-PCR method;

[0027] Insert it into the pIRES2-EGFP expression vector after double digestion with EcoRI and SalI;

[0028] Transform DH5α competent bacteria and pick monoclonal plasmid for small-scale extraction;

[0029] After correct identification by double digestion and sequencing, extract it with an endotoxin-free plasmid large-scale extraction kit.

[0030] As a preferred embodiment of the insulin resistance method based on promoting the signal pathway by CTRP9 provided by the present invention, the steps for cell culture and transfection are as follows:

[0031] Incubate Heap1-6 cells with DMEM + 10% FBS + penicillin-streptomycin, 5% CO2, at 37 °C;

[0032] Perform eukaryotic overexpression plasmid transfection when the cells grow to 80%-90%;

[0033] After 48 h of transfection, change the culture medium to DMEM + 1% FBS + penicillin-streptomycin and culture under starvation for 16 h.

[0034] As a preferred embodiment of the insulin resistance method based on promoting the signal pathway by CTRP9 provided by the present invention, the steps for detecting the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of insulin signaling pathway-related proteins in LO human hepatocytes are as follows:

[0035] Culture LO human hepatocytes overnight with serum-free medium;

[0036] Observe the localization of SirT1 / PGC-1a in the nucleus and the process of PGC-1a protein localization in the cell and its transfer from the nucleus to the cytoplasm.

[0037] As a preferred embodiment of the insulin resistance method based on promoting the signal pathway by CTRP9 provided by the present invention, the steps for detecting the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of insulin signaling pathway-related proteins in the insulin resistance model of LO human hepatocytes are as follows:

[0038] The cells were cultured in serum-free medium for 2 h, and then stimulated with insulin, glucose, and palmitic acid for 1 h respectively to construct a hepatic insulin resistance model.

[0039] As a preferred embodiment of the insulin resistance method based on the CTRP9 promoting signaling pathway provided by the present invention, the detection of SirT1 / PGC-1a protein expression is carried out as follows:

[0040] The intracellular SirT1 protein was fluorescently stained using anti-SirT1 antibody and immunofluorescence staining technology, and then the distribution differences of SirT1 in the cell nucleus and cytoplasm were compared using laser confocal imaging technology;

[0041] The cell nucleus, cytoplasm, and total protein of hepatocytes were extracted by ultracentrifugation method, and the contents of SirT1 protein in the cell nucleus, cytoplasm, and total were detected using rabbit anti-mouse SirT1 antibody and western blot technology.

[0042] As a preferred embodiment of the insulin resistance method based on the CTRP9 promoting signaling pathway provided by the present invention, the detection of the molecular mechanism by which CTRP9 affects the function of SirT1 protein is carried out as follows:

[0043] LO human hepatocytes and hepatic insulin resistance cells were cultured overnight in serum-free medium.

[0044] As a preferred embodiment of the insulin resistance method based on the CTRP9 promoting signaling pathway provided by the present invention, it further includes detecting the changes in PGC-1a subcellular proximity proteomics and the interaction between PGC-1a and potential associated proteins, and the steps are as follows:

[0045] The intracellular localization of SirT1 / PGC-1a, FoxO1, InsR, IRS, Akt, and GSK3β was observed using immunofluorescence staining technology and laser confocal imaging technology;

[0046] The PGC-1a neighboring proteins were labeled with biotin tags using the APEX2-based live cell biotin proximity labeling method;

[0047] The biotin-modified proteins were affinity enriched through beads conjugated with streptavidin, separated by SDS-PAGE, and the biotin-modified proteins were identified using proteomic technology;

[0048] SirT1 / PGC-1a protein was immunoprecipitated using anti-Flag antibody, and the expression of SirT1 / PGC-1a and other proteins was detected using western blot technology.

[0049] It can be seen without doubt that through the above technical solutions of the present application, the technical problems to be solved by the present application can surely be solved.

[0050] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects:

[0051] 1. An insulin resistance method based on CTRP9 promoting signal pathway provided by the present invention uses a human hepatocyte cell line as the in vitro research object, simulates the in vivo research environment, establishes a corresponding insulin resistance model, and uses techniques such as flow cytometry analysis, RT-PCR, Western blot, and signal pathway inhibition to study the therapeutic effect of CTRP9 on hepatocyte insulin resistance and the specific mechanism of action, providing a basis for new type 2 diabetes treatment targets and biomarkers.

[0052] 2. The present invention uses CTRP9 to regulate PGC-1a-mediated insulin resistance through intracellular Sirt1.

[0053] 3. The present invention jointly applies biotin labeling technology and proteomic technology to study the potential spatio-temporal interaction regulation mechanism between the α-chain of PGC1 and SirT1 in hepatocytes in real time.

[0054] 4. The present invention uses a human hepatocyte cell line as the research object, simulates the hyperglycemic or hyperinsulinemic or hyperlipidemic in vivo test environment, establishes an insulin-resistant hepatocyte model, and studies the specific mechanism and molecular basis of the therapeutic effect of CTRP9 on IR, providing a basis for the development of new diabetes drugs.

[0055] 5. The present invention uses anti-SirT1 antibody and immunofluorescence staining technology to perform fluorescence staining of intracellular SirT1 protein, and then uses laser confocal imaging technology to compare the distribution differences of SirT1 in the cell nucleus and cytoplasm.

[0056] 6. The present invention uses immunofluorescence staining technology and laser confocal imaging technology to observe the intracellular localization of SirT1 / PGC-1a, FoxO1, InsR, IRS, Akt, and GSK3β.

[0057] 7. The present invention uses the APEX2-based in vivo biotin proximity labeling method to label the PGC-1a proximal protein with a biotin tag, and then enriches the biotin-modified protein by affinity with beads conjugated with streptavidin, separates it by SDS-PAGE, and identifies the biotin-modified protein using proteomic technology.

[0058] 8. The present invention uses anti-Flag antibody for co-immunoprecipitation of SirT1 / PGC-1a proteins, detects the expression of SirT1 / PGC-1a and proteins using western blot technology, and then treats with 50 mM SIrt1720 to observe the changes in PGC-1a subcellular proximity proteomics and the interaction between PGC-1a and potential associated proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0060] Figure 1 Schematic diagram of human adiponectin and CTRP9 in the prior art;

[0061] Figure 2 Schematic diagram of the potential mechanism by which CTRP9 of the present invention improves hepatic insulin resistance via the SIRT1 / PGC-1a pathway;

[0062] Figure 3 Effect of CTRP9 of the present invention on the gene expression of SirT1 / PGC-1a and the phosphorylation level of proteins related to the insulin signaling pathway in human liver insulin-resistant cells;

[0063] Figure 4 Schematic diagram of the changes in plasma insulin levels and related metabolic indices during the insulin clamp process of the present invention;

[0064] Figure 5 Schematic diagram of the effect of GLP-1 receptor agonist on plasma ZAG and ADI levels during OGTT of the present invention;

[0065] Figure 6 Schematic diagram of the effect of GLP-1 receptor agonist on the correlation between insulin resistance and plasma ZAG and ADI levels during the insulin clamp process of the present invention;

[0066] Figure 7 Schematic diagram of ZAG levels of cytokines in healthy women and patients with metabolic syndrome of the present invention;

[0067] Figure 8 Schematic diagram of cytokines in healthy women and patients with metabolic syndrome during EHC of the present invention;

[0068] Figure 9 Schematic diagram of the changes in the levels of CTRP9 and adiponectin in peripheral blood among different glucose metabolism populations of the present invention;

[0069] Figure 10 Schematic diagram of RT-PCR detection of GLUT1, GLUT4 mRNA and protein expression in the present invention;

[0070] Figure 11 Schematic diagram of Western blot detection of phosphorylation levels of proteins related to insulin signaling pathway in the present invention;

[0071] Figure 12 Schematic diagram of the change of CTRP9 level in peripheral blood in different glucose metabolism populations in the present invention. Detailed implementation manners

[0072] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0073] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0074] It should be noted that, without conflict, the embodiments in the present invention and the features and technical solutions in the embodiments may be combined with each other.

[0075] It should be noted that similar reference numerals and letters denote similar items in the following drawings. Therefore, once an item is defined in one drawing, it does not need to be further defined and explained in subsequent drawings.

[0076] Refer to Figures 2 - 12 , a method for insulin resistance based on the CTRP9 promoting signal pathway.

[0077] CTRP9 first triggers AdipoR1 on the hepatic cell membrane to enter the cytoplasm, and activates SirT1 by reducing the acetylation of TNF-stimulated nFκB.

[0078] ① During energy deficiency, after deacetylation, SirT1 triggers the phosphorylation of PGC-1a by AMPK through the elevated AMP / ATP ratio, and increases the activity of PGC-1a, resulting in up-regulation of gene transcription involved in lipid catabolism and mitochondrial biogenesis, thereby affecting hepatic insulin sensitivity.

[0079] ②When the insulin signal weakens, SirT1 binds to phosphorylated PGC-1α and translocates to the nucleus, catalyzing the deacetylation of PGC-1α by SirT1, increasing the transcriptional activity of PGC-1α, and enhancing insulin sensitivity; when the insulin signal strengthens, SirT1 dissociates from phosphorylated PGC-1α, and after PGC-1α is acetylated, it re-translocates outside the nucleus, resulting in weakened insulin sensitivity( Figure 2 ).

[0080] The effect of CTRP9 on this special function of SirT1 may provide new and promising targets for the anti-inflammatory treatment of insulin resistance-related diseases.

[0081] I. Experiments

[0082] 1.1 Construction of plasmids in L02 (human hepatocyte cell line)

[0083] For the construction and identification of eukaryotic expression plasmids of cells, the full coding region cDNA fragment of the mouse L02 gene was amplified by RT-PCR. The upstream primer used was: 5-CCGGAATTCATGTCGGCCGCCGTGGCT-3', and the downstream primer was: 5'GCGGTCGACCTACAGGCAAGCAGTGAAGCT3'. The product size was 978 bp. After double digestion with EcoRI and SalI, it was inserted into the pIRES2-EGFP expression vector. After transforming DH5α competent bacteria, single colonies were picked and the plasmid was extracted in small amounts. After correct identification by double digestion and sequencing, the endotoxin-free plasmid was extracted in large amounts using a plasmid extraction kit for standby.

[0084] 1.2 Cell culture and transfection

[0085] Heap1-6 cells were incubated in DMEM + 10% FBS + double antibiotics (penicillin-streptomycin) with 5% CO2 at 37 °C. When the cells grew to 80%-90%, eukaryotic overexpression plasmids (pIRES2-EGFP-KLF14) were transfected; 48 hours after transfection, the medium was changed to DMEM + 1% FBS + double antibiotics (penicillin-streptomycin) for starvation culture for 16 hours and kept for standby.

[0086] 1.3 Effects of CTRP9 on glucose uptake, PGC-1α gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in LO human hepatocytes

[0087] LO human hepatocytes were cultured overnight in serum-free medium to localize SirT1 / PGC-1α in the nucleus, and the intracellular localization of PGC-1α protein and the process of its transfer from the nucleus to the cytoplasm were observed. The groups were as follows:

[0088] ① Control group, cells without any treatment, with the same cell culture time as the experimental group;

[0089] ②Insulin treatment group, cells were treated with 100 nM Insulin for 0.5 h and 6 h respectively;

[0090] ③CTRP9 treatment group, cells were treated with CTRP9 for 0.5 h and 6 h respectively;

[0091] ④Insulin + CTRP9 treatment group, cells were pre - treated with 0.3 μg / ml, 1.0 μg / ml, 3.0 μg / ml CTRP9 for 2 h, and then co - treated with 100 nM Insulin + different concentrations of CTRP9 for 0.5 h and 6 h respectively;

[0092] ⑤Insulin + Sirt1 inhibitor treatment group, cells were pre - treated with 50 mM Sirt1 inhibitor nicotinamide for 2 h, and then co - treated with 100 nM Insulin + 50 mM nicotinamide for 0.5 h and 6 h respectively.

[0093] 1.4 Effects of CTRP9 on glucose uptake, PGC - 1a gene expression and phosphorylation levels of proteins related to insulin signaling pathway in LO human hepatocyte insulin resistance model

[0094] Cells were cultured in serum - free medium for 2 h and then stimulated with insulin (INS, 100 nmol / L), glucose, and palmitic acid for 1 h to construct a hepatic insulin resistance model. The cell groups were as follows:

[0095] ①Control group, cells were not treated with anything and had the same culture time as the experimental group cells;

[0096] ②Insulin treatment group, cells were treated with 100 nM Insulin for 0.5 h and 6 h respectively;

[0097] ③CTRP9 treatment group, cells were treated with CTRP9 for 0.5 h and 6 h respectively;

[0098] ④Insulin + CTRP9 treatment group, cells were pre - treated with 1.0 μg / ml CTRP9 for 2 h, and then co - treated with 100 nM Insulin + CTRP9 for 0.5 h and 6 h;

[0099] ⑤Insulin + Sirt1 agonist treatment group, cells were pre - treated with 50 mM Sirt1 agonist SIrt1720 for 2 h, and then co - treated with 100 nM Insulin + 50 mM SIrt1720 for 0.5 h and 6 h respectively.

[0100] 1.5 Detection of SirT1 / PGC - 1a protein expression

[0101] Anti-SirT1 antibody and immunofluorescence staining technique were used for fluorescent staining of intracellular SirT1 protein, and then laser confocal imaging technique was used to compare the distribution differences of SirT1 in cell nucleus and cytoplasm. Ultracentrifugation method was adopted to extract nuclear, cytoplasmic and total proteins of hepatocytes, and rabbit anti-mouse SirT1 antibody and western blot technique were used to detect the contents of nuclear, cytoplasmic and total SirT1 proteins. At the same time, the phosphorylation and acetylation levels of SirT1 were compared and the expression of downstream target genes was detected according to the methods described above. On this basis, cells were treated with 50 mM SIrt1720 to observe the changes in intracellular localization and nuclear / cytoplasmic translocation of SirT1.

[0102] 1.6 Molecular mechanism of CTRP9 affecting SirT1 protein function

[0103] LO human hepatocytes and liver insulin-resistant cells were cultured overnight in serum-free medium. The experimental groups were divided as follows:

[0104] ① Starvation overnight control group: Cells were starved in serum-free medium overnight, and the cell culture time was the same as that of group ②;

[0105] ② Insulin treatment group: Cells were starved in serum-free medium overnight, and then treated with 100 nM Insulin for 0.5 h and 6 h respectively;

[0106] ③ H2O2 treatment group: Cells were starved in serum-free medium for 2 h, and then treated with 100 nM H2O2 for 0.5 h and 6 h;

[0107] LO2 human hepatocytes and liver insulin-resistant cells expressed green fluorescent protein. Immunofluorescence staining technique and laser confocal imaging technique were used to observe the intracellular localization of SirT1 / PGC-1a, FoxO1, InsR, IRS, Akt, GSK3β; The proximity labeling method of biotin in living cells based on APEX2 was used to label the adjacent proteins of PGC-1a with biotin tags, and then the biotin-modified proteins were affinity enriched by beads conjugated with streptavidin (streptavidin), separated by SDS-PAGE and identified by proteomic technique; Anti-Flag antibody was used for immunoprecipitation of SirT1 / PGC-1a protein, and western blot technique was used to detect the expression of SirT1 / PGC-1a and other proteins. Interaction of other potential interacting proteins. On this basis, cells were treated with 50 mM SIrt1720 to observe the changes in PGC-1a subcellular proximity proteomics and the interaction between PGC-1a and potential associated proteins.

[0108] 1) It was confirmed that CTRP9 interacts with SirT1 / PGC-1a, and changes in insulin signaling can affect the binding affinity between SirT1 and PGC-1a and accelerate the nuclear export of PGC-1a.

[0109] Specifically, the experimental groups were divided by co-immunoprecipitation method:

[0110] ① Control group: The cells were not treated with anything and had the same culture time as the experimental group cells.

[0111] ② Insulin treatment group: The cells were treated with 100 nM Insulin for 0.5 h and 6 h respectively.

[0112] ③ CTRP9 treatment group: The cells were treated with CTRP9 for 0.5 h and 6 h respectively.

[0113] ④ Insulin + CTRP9 treatment group: The cells were pre-treated with 1.0 μg / ml CTRP9 for 2 h, and then co-treated with 100 nM Insulin + CTRP9 for 0.5 h and 6 h.

[0114] The results showed that: compared with the control group, the binding between SirT1 and PGC-1a in the insulin treatment group was weakened, the binding between SirT1 and PGC-1a in the CTRP9 treatment group was enhanced, and the weakened binding between SirT1 and PGC-1a in the insulin resistance group was restored after treatment with CTRP9.

[0115] To verify the regulation of insulin signaling on the binding of SirT1 / PGC-1a and the nuclear export of PGC-1a

[0116] Based on the previous grouping, an Insulin + CTRP9 + SirT1 inhibitor treatment group was added. The cells were pre-treated with 50 mM SirT1 inhibitor nicotinamide for 2 h, and then co-treated with 100 nM Insulin + 1.0 μg / ml CTRP9 + 50 mM nicotinamide for 0.5 h and 6 h respectively. LO human hepatocytes were cultured overnight in serum-free medium to localize SirT1 / PGC-1a in the nucleus, and then the intracellular localization of PGC-1a protein and the process of its transfer from the nucleus to the cytoplasm were observed.

[0117] The results showed that: compared with the control group, the nuclear ratio of PGC-1a in the insulin treatment group decreased (nuclear export); after treatment with CTRP9 in the insulin resistance group, the nuclear ratio of PGC-1a increased and the nuclear export was reversed; treatment with the SirT1 inhibitor nicotinamide could block the regulation of nuclear localization by CTRP9.

[0118] The above research results show that CTRP9 enhances the binding of SirT1 to PGC-1α; insulin resistance leads to the nuclear translocation of PGC-1α by inhibiting SirT1 activity or disrupting the SirT1 / PGC-1α complex; CTRP9 inhibits gluconeogenesis and improves insulin resistance by restoring the interaction between SirT1 and PGC-1α and maintaining the nuclear localization of PGC-1α.

[0119] 2) It was confirmed that treatment of L02 with different concentrations of CTRP9 inhibited the deacetylation of PGC-1α by Sirt1 protein, thereby reducing the transcriptional activity of PGC-1α;

[0120] LO human hepatocytes were cultured overnight in serum-free medium to localize SirT1 / PGC-1α in the nucleus, and then the following groups were set up:

[0121] ① Control group, the cells were not treated with anything and had the same culture time as the experimental group cells;

[0122] ② CTRP9 treatment group: The cells were treated with 0.3 μg / ml, 1.0 μg / ml, and 3.0 μg / ml CTRP9 for 2 h respectively;

[0123] ③ SirT1 inhibitor treatment group: The cells were treated with 50 mM SirT1 inhibitor nicotinamide for 2 h;

[0124] The acetylation level of PGC-1α was detected by western blot technique; the transcriptional activity of PGC-1α was evaluated by immunoprecipitation method; the SirT1 enzyme activity was directly detected using a fluorescent substrate (SirT1 Activity Assay Kit).

[0125] The results showed that: compared with the control group, the acetylation level of PGC-1α was significantly increased after treatment with CTRP9, and the acetylation level of PGC-1α gradually increased with the increase of CTRP9 concentration; after intervention with the SirT1 inhibitor nicotinamide, the deacetylation of PGC-1α was significantly higher than that of the control group, showing a trend similar to that of the high-concentration CTRP9 group;

[0126] The correlation analysis of the concentration of CTRP9 with the acetylation level of PGC-1α and SirT1 activity by linear regression analysis showed that: the SirT1 enzyme activity in the CTRP9 treatment group decreased in a concentration-dependent manner; in the high-concentration CTRP9 group, the binding of SirT1 to PGC-1α decreased, the acetylation level of PGC-1α increased, the co-localization of SirT1 and PGC-1α decreased, and the nuclear retention of PGC-1α decreased, thereby reducing the transcriptional activity of nuclear PGC-1α.

[0127] 3) It was confirmed that under the conditions of high insulin, high glucose-high insulin, and palmitic acid, L02 dephosphorylated Sirt1, reduced the re-entry of Sirt1 into the nucleus, and weakened insulin resistance.

[0128] The LO human hepatocyte line was cultured in serum-free medium for 2 h, and then stimulated with insulin, glucose, and palmitic acid respectively to construct a hepatic insulin resistance model. The cell groups were as follows:

[0129] ① Control group: normal medium;

[0130] ② High insulin-high glucose group: The cells were treated with 25 mM glucose + 100 nM Insulin for 48 h;

[0131] ③ Palmitic acid group: The cells were treated with 0.5 mM palmitic acid for 24 h;

[0132] ④ Recovery experimental group: The cells were pretreated with 100 nM Insulin for 24 h, and then treated with 10 μM SirT1 agonist SirT1720 for 2 h.

[0133] The phosphorylation status of SirT1 and the ratio of nuclear to cytoplasmic SirT1 were detected by western blot technique; the enzyme activity of SirT1 was directly detected using a fluorescent substrate (SirT1 Activity Assay Kit).

[0134] The results showed that after treatment of the LO human hepatocyte line with insulin, glucose, and palmitic acid, the phosphorylation level of SirT1 decreased significantly, cytoplasmic retention increased, nuclear localization decreased, the enzyme activity of SirT1 decreased, and insulin resistance worsened, indicating that the insulin resistance model was successfully established; after intervention with the SirT1 agonist SirT1720, the phosphorylation level of SirT1 increased significantly, nuclear localization increased, and insulin resistance improved, indicating that the phosphorylation-dependent nuclear localization of SirT1 is the key mechanism for its improvement of insulin resistance, providing new ideas for targeted treatment of metabolic diseases.

[0135] II. Corresponding effects of the schematic diagram

[0136] Figure 4 It was proposed that during the insulin clamp technique, the changes in plasma insulin levels and related metabolic indexes during the clamp process were evaluated. The results showed that pretreatment of high-fat diet-induced insulin-resistant rats with Exenatide might increase the insulin sensitivity of the body by promoting insulin secretion of B cells and improving glucose and lipid metabolism.

[0137] Figure 5 and Figure 6It was proposed in [reference] that the effects of GLP-1 receptor agonists on glucose and lipid metabolism, insulin function status, and adiponectin and zinc-α2-glycoprotein were evaluated by OGTT and insulin clamp techniques for the effects of GLP-1 receptor agonists on plasma ZAG and ADI levels. The results showed that GLP-1 receptor agonists could improve glucose and lipid metabolism and insulin sensitivity in newly diagnosed type 2 diabetes patients and increase plasma adiponectin and zinc-α2-glycoprotein levels.

[0138] Figure 7 and Figure 8 It was proposed in [reference] that to study the relationships between circulating zinc-α2-glycoprotein (ZAG), irisin, β-atrophin, and adiponectin concentrations in vivo and the components of metabolic syndrome (MetS), and to analyze the effects of blood glucose and insulin on the concentrations of these cytokines, oral glucose tolerance tests and euglycemic-hyperinsulinemic clamps (EHC) were performed on healthy subjects and women with metabolic syndrome. Serum ZAG, irisin, betatrophin, and adiponectin levels were measured using enzyme-linked immunosorbent assay kits, and their relationships with MetS components were analyzed. The results showed that serum ZAG, irisin, betatrophin, and adiponectin were associated with metabolic syndrome.

[0139] Among them, Figure 7 in [reference], (A) βetatrophin level (B), irisin level (C), adiponectin level (D), Figure 8 in [reference], (A) ZAD level, (B) βetatrophin level, (C) irisin level, (D) adiponectin level.

[0140] To study the relationship between circulating zinc-α2-glycoprotein levels and different phenotypes of polycystic ovary syndrome, the relationship between ZAG and metabolic characteristics in PCOS patients was studied. The results showed that circulating ZAG levels were not associated with oligo-ovulation but were associated with hyperandrogenism and PCO morphology. It was suggested that circulating ZAG levels could be used as a biomarker for PCOS phenotypes.

[0141] Table 1: Multiple regression analysis between different clinical factors for diagnosing PCOS and ZAG levels

[0142]

[0143] Table 2: Regression analysis of the correlation between different PCOS phenotypes and ZAG

[0144]

[0145] Figure 9It is proposed in [reference] that the blood circulation CTRP9 level in patients with IGT or nT2DM is significantly higher than that in the normal control group, and is positively correlated with obesity and obesity-related metabolic disorder-related diseases. Circulating CTRP9 may play an important role in the development of type 2 diabetes, insulin resistance or obesity.

[0146] Figure 10 and Figure 11 It is proposed in [reference] that one can proficiently construct and apply tools such as plasmids and adenoviruses for differential expression of genes and proteins, and fully master molecular biology techniques such as RT-PCR, Western blot, yeast two-hybrid system, and co-immunoprecipitation.

[0147] Figure 12 It is proposed in [reference] that a cross-sectional study was conducted on newly diagnosed type 2 diabetes patients and healthy adults. The results showed that the circulating CTRP5 level in newly diagnosed type 2 diabetes patients was significantly decreased and was related to IR, among which, (a) and the changes in CTRP9 level before and after treatment with dapagliflozin (b).

[0148] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all the details in detail, nor limit the present invention to the specific embodiments described. Obviously, many modifications and variations can be made according to the content of this specification. These embodiments are selected and specifically described in this specification to better explain the principle and practical application of the present invention, so that those skilled in the art can well understand and utilize the present invention. The present invention is only limited by the claims and their full scope and equivalents.

Claims

1. A method for insulin resistance based on promoting the CTRP9 signaling pathway, characterized in that, The steps are as follows: Construct a plasmid of human hepatocyte line; Perform cell culture and transfection; Detect the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in LO human hepatocytes; Detect the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in the insulin resistance model of LO human hepatocytes; Perform SirT1 / PGC-1a protein expression detection; Detect the molecular mechanism by which CTRP9 affects the function of SirT1 protein.

2. The method for insulin resistance based on promoting a signaling pathway by CTRP9 according to claim 1, wherein For the construction of the plasmid of human hepatocyte line, the steps are as follows: Amplify the full coding region cDNA fragment of mouse L02 gene by RT-PCR method; Insert it into the pIRES2-EGFP expression vector after double digestion with EcoRI and SalI; Transform DH5α competent bacteria and pick monoclonal plasmids for mini-preparation; After correct identification by double digestion and sequencing, extract with an endotoxin-free plasmid maxi-preparation kit.

3. The method for insulin resistance based on CTRP9 promoting signal pathway according to claim 1, wherein For the performance of cell culture and transfection, the steps are as follows: Incubate Heap1-6 cells with DMEM + 10% FBS + penicillin-streptomycin at 5% CO2 and 37 °C; Perform eukaryotic overexpression plasmid transfection when the cells grow to 80%-90%; After 48 h of transfection, change the medium to DMEM + 1% FBS + penicillin-streptomycin and culture under starvation for 16 h.

4. A method for insulin resistance based on promoting the CTRP9 signaling pathway according to claim 1, wherein For the detection of the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in LO human hepatocytes, the steps are as follows: Culture LO human hepatocytes overnight with serum-free medium; Observe the localization of SirT1 / PGC-1a in the nucleus, and observe the intracellular localization of PGC-1a protein and the process of its transfer from the nucleus to the cytoplasm.

5. A method for insulin resistance based on promoting a signaling pathway by CTRP9 according to claim 1, characterized in that, For the detection of the effects of CTRP9 on glucose uptake, PGC-1a gene expression, and phosphorylation levels of proteins related to the insulin signaling pathway in the insulin resistance model of LO human hepatocytes, the steps are as follows: Culture with serum-free medium for 2 h, and respectively stimulate with insulin, glucose, and palmitic acid for 1 h to construct a hepatic insulin resistance model.

6. The method for insulin resistance based on promoting the CTRP9 signaling pathway according to claim 1, wherein For the performance of SirT1 / PGC-1a protein expression detection, the steps are as follows: Perform fluorescence staining of intracellular SirT1 protein with anti-SirT1 antibody and immunofluorescence staining technology, and then compare the distribution differences of SirT1 in the nucleus and cytoplasm with laser confocal imaging technology; Extract nuclear, cytoplasmic, and total proteins of hepatocytes by ultracentrifugation method, and detect the contents of nuclear, cytoplasmic, and total SirT1 proteins with rabbit anti-mouse SirT1 antibody and western blot technology.

7. A method for insulin resistance based on promoting a signaling pathway by CTRP9 according to claim 1, characterized in that, For the detection of the molecular mechanism by which CTRP9 affects the function of SirT1 protein, the steps are as follows: Culture LO human hepatocytes and hepatic insulin resistance cells overnight with serum-free medium.

8. A method for insulin resistance based on promoting the CTRP9 signaling pathway according to claim 1, wherein It also includes detecting the changes in PGC-1a subcellular proximity proteomics and the interaction between PGC-1a and potential associated proteins. The steps are as follows: The immunofluorescence staining technique and laser confocal imaging technique were used to observe the intracellular localization of SirT1 / PGC-1a, FoxO1, InsR, IRS, Akt, and GSK3β; The APEX2-based live-cell biotin proximity labeling method was used to label the proteins adjacent to PGC-1a with biotin tags; The biotin-modified proteins were affinity enriched by beads conjugated with streptavidin, separated by SDS-PAGE, and the biotin-modified proteins were identified using proteomic techniques; The SirT1 / PGC-1a protein was immunoprecipitated with anti-Flag antibody, and the expression of SirT1 / PGC-1a and the protein was detected by western blot technique.

Images