Application of PXDC1 in preparation of product for treating myocardial hypertrophy

Abstract

The invention relates to the field of biomedicine, in particular to application of PXDC1 in preparation of a product for treating myocardial hypertrophy. The invention discloses the effectiveness of inhibiting PXDC1 expression in treating cardiac hypertrophy and controlling the occurrence and development process of the cardiac hypertrophy for the first time. The invention provides a novel drug target and strategy for treating myocardial hypertrophy, and the novel drug target and strategy can reduce the expression of a myocardial hypertrophy biomarker, reduce the size of myocardial cells, improve the ejection fraction and short axis shortening rate of the heart, reduce the weight ratio of the heart and relieve the degree of myocardial fibrosis. Besides, the invention clarifies the action mechanism of PXDC1 in myocardial hypertrophy, deepens the understanding of the pathogenesis of the disease, and lays an important foundation for further exploration of myocardial hypertrophy-related cytobiology and molecular biology processes.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the application of PXDC1 in the preparation of products for treating myocardial hypertrophy. Background Art

[0003] Heart Failure, as one of the main causes of death worldwide, has pathological myocardial hypertrophy as an important pre - lesion. In the initial stage, myocardial hypertrophy is a compensatory response of the body to increased afterload, aiming to maintain the heart's pumping function; however, under continuous pressure load stimulation, the myocardium will become decompensated, thereby inducing heart failure. The long - term progression of myocardial hypertrophy can lead to myocardial fibrosis and insufficient coronary blood supply, and ultimately evolve into heart failure, becoming an important inducement for cardiovascular events. Although current research has revealed pathological features such as cardiomyocyte hypertrophy and interstitial fibrosis, its specific molecular regulatory network is still unclear, and there is a lack of specific markers and effective intervention targets in clinical practice.

[0004] Currently, the diagnosis of cardiovascular diseases mainly relies on imaging techniques such as echocardiography and MRI to evaluate myocardial thickness and functional status; however, these techniques are difficult to identify sub - clinical lesions at an early stage, limiting their application in disease prevention and early intervention. In terms of treatment, traditional drugs such as beta - blockers can only relieve symptoms and cannot reverse the pathological process; while surgical operations or interventional therapies have risks such as large trauma and high recurrence rates. In recent years, although targeted drugs against cardiac myosin have made some progress, they still rely on gene detection and precise typing, and their efficacy for non - obstructive patients is limited.

[0005] The research on molecular markers of myocardial hypertrophy has covered multiple fields such as miRNA (such as miR - 133b - 3p), mitochondrial proteins (such as NIPSNAP2), and gene mutations related to cardiac sarcomeres. However, existing markers generally face problems such as insufficient specificity, complex detection techniques that are difficult to popularize to the grass - roots level, and a lack of validation data dynamically associated with the pathological process. For example, although NIPSNAP2 has been proposed as a potential marker for myocardial hypertrophy, its specific regulatory mechanism has not been clarified, limiting its clinical application value.

[0006] As a highly conserved imprinted gene, PX domain-containing protein 1 (PXDC1) is significantly more paternally expressed than maternally. Given the current situation of the ambiguous function of pathological myocardial hypertrophy markers and the lack of specificity in targeted therapy, myocardial hypertrophy has become an independent risk factor for the high incidence and high mortality of cardiovascular diseases. If not intervened medically in time, it will ultimately develop into heart failure, endangering the lives of patients. Therefore, actively searching for key regulatory factors causing the onset of myocardial hypertrophy, using them as therapeutic targets, and developing drug screening methods and treatment strategies based on new molecular markers are of great significance for promoting the recovery of cardiac function. Summary of the Invention

[0007] In view of this, the present invention provides the use of PXDC1 in the preparation of products for treating myocardial hypertrophy.

[0008] The technical solution of the present invention is realized as follows:

[0009] The present invention provides the use of PXDC1 in the preparation of products for treating myocardial hypertrophy, and the PXDC1 includes the Pxdc1 gene or the protein encoded thereby.

[0010] NM_183373.4 is one of the main transcripts of the PXDC1 gene (refer to the RefSeq database); this transcript is further translated into PX domain-containing protein 1, and the reference number of its protein product in the NCBI database is NP_899229.2.

[0011] Further, the myocardial hypertrophy includes pathological myocardial hypertrophy.

[0012] Further, the myocardial hypertrophy is caused by pressure overload. The pressure overload includes transverse aortic constriction (TAC) surgery or phenylephrine-induced pressure overload.

[0013] In some specific embodiments, the expression product of PXDC1 is used as a drug target in the preparation of products for improving and / or treating myocardial hypertrophy.

[0014] In some specific embodiments, the use includes the use of PXDC1 expression inhibitors in the preparation of products for improving and / or treating myocardial hypertrophy. Further, the PXDC1 expression inhibitors include RNA interference molecules targeting the PXDC1 gene, and the RNA interference molecules include at least one of siRNA, shRNA, and miRNA mimics.

[0015] In some specific embodiments, the product is a drug or a drug combination, and its components include a pharmaceutically acceptable carrier, excipient or stabilizer. The product is a drug or a drug combination, and its components include a pharmaceutically acceptable carrier, excipient or stabilizer.

[0016] In some specific embodiments, the applications include that the product is used for at least one of the following purposes: (1) reducing the expression level of a myocardial hypertrophy biomarker; (2) reducing the cross-sectional area or volume of cardiomyocytes; (3) increasing the ejection fraction and shortening fraction of the heart; (4) reducing the ratio between the heart weight and the body weight; (5) repairing or reducing the degree of myocardial fibrosis.

[0017] The beneficial effects of the present invention at least include the following:

[0018] The present invention firstly proposes and effectively verifies that Pxdc1 can be used as a potential key target for treating pathological myocardial hypertrophy. By regulating the expression of Pxdc1, the drug or drug composition provided by the present invention can effectively inhibit the development of myocardial hypertrophy, providing a new drug action target and treatment strategy for the clinical treatment of pathological myocardial hypertrophy, and is expected to improve the treatment effect of pathological myocardial hypertrophy.

[0019] The present invention discloses the mechanism of action of Pxdc1 in myocardial hypertrophy, which not only deepens the understanding of the pathogenesis of myocardial hypertrophy, but also provides important clues for the subsequent in-depth study of the cell biology and molecular biology processes related to myocardial hypertrophy. The present invention helps to promote the basic research in the field of cardiovascular diseases and lays a solid foundation for the development of more innovative treatment methods for myocardial hypertrophy and related diseases.

[0020] Table 1 Sequence Information Table

[0021] Name SEQ ID NO Sequence (5’-3’) Length (bp) rPxdc1siRNA-sence 1 GUCCUGUGAAAAUAUCAGAAAUCAT 25 rPxdc1siRNA-antisence 2 AUGAUUUCUGAUAUUUUCACAGGACUU 27 rActb-qFP 3 CCCATCTATGAGGGTTACGC 20 rActb-qRP 4 TTTAATGTCACGCACGATTTC 21 rGapdh-qFP 5 ACAGCAACAGGGTGGTGGAC 20 rGapdh-qRP 6 TTTGAGGGTGCAGCGAACTT 20 rPxdc1-qFP 7 CGATGAGGAGGAGTTCTTCG 20 rPxdc1-qRP 8 CTCCAGCAGCTTCTCGACTT 20 rNppa-qFP 9 ATACAGTGCGGTGTCCAACA 20 rNppa-qRP 10 AGCCCTCAGTTTGCTTTTCA 20 rNppb-qFP 11 CAGCTCTCAAAGGACCAAGG 20 rNppb-qRP 12 GCAGCTTGAACTATGTGCCA 20 rMyh6-qFP 13 ACTCATGGCCACACTCTTCT 20 rMyh6-qRP 14 AAGTGAGGATGGGTGGTCCT 20 rMyh7-qFP 15 GCTCCTAAGTAATCTGTTTG 20 rMyh7-qRP 16 AAGTGAGGGTGCGTGGAGCG 20 rActa1-qFP 17 ATACTCTGCCTGGCATCACG 20 rActa1-qRP 18 TCCAGCTTCTCACCAGACCT 20 mActb-qFP 19 GGAGCACCCTGTGCTGCTCA 20 mActb-qRP 20 GCCAGGTCCAGACGCAGGAT 20 mGapdh-qFP 21 TCCTGCACCACCAACTGCTTAG 22 mGapdh-qRP 22 GATGACCTTGCCCACAGCCTTG 22 mPxdc1-qFP 23 TTTGGCAAACACAGAGACCA 20 mPxdc1-qRP 24 CGTCTCAAACGGAACCAAAT 20 mNppa-qFP 25 TTTCAAGAACCTGCTAGACCACC 23 mNppa-qRP 26 GATCTATCGGAGGGGTCCCA 20 mNppb-qFP 27 CGCTGGGAGGTCACTCCTAT 20 mNppb-qRP 28 CTTCAGTGCGTTACAGCCCAA 21 mMyh6-qFP 29 AGCTCACCTACCAGACAGAGG 21 mMyh6-qRP 30 TTCCTCGTCGTGCATCTTCTT 21 mMyh7-qFP 31 GGCCTGGGCTTACCTCTCTA 20 mMyh7-qRP 32 ACAGTCACCGTCTTGCCATT 20 mActa1-qFP 33 Same as SEQ ID NO: 17 20 mActa1-qRP 34 Same as SEQ ID NO: 18 20

[0022]

Term Explanation

[0023] In some specific embodiments of the present invention, the meanings of relevant terms include the following:

[0024] BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required in the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0026] Figure 1Detection results of cardiac-specific knockout of Pxdc1 and changes in its expression levels under different stress conditions in the embodiments of the present invention; among them Figure 1 a-1d are shown as follows:

[0027] Figure 1 a is a schematic diagram of the construction of Pxdc1 cardiac-specific knockout (Pxdc1 fl / fl ; cre) mice;

[0028] Figure 1 b is a result diagram of agarose gel electrophoresis for detecting the Pxdc1 gene in different tissues of mice with different genotypes; the experiments respectively compared Pxdc1 in cardiac, liver, and kidney tissue samples fl / fl and Pxdc1 fl / fl ; cre in two genotypes of mice, and the presence status and whether knockout occurred of the Pxdc1 gene in different tissues of mice with different genotypes can be judged;

[0029] Figure 1 c is a qRT-PCR detection of the change in Pxdc1 expression after TAC in wild-type mice, where the abscissa is different gene names, including Pxdc1, Nppa, Nppb, Myh6, Myh7; the ordinate is the relative value of gene expression; the "*", "**", "***" in the figure indicate statistical significance of differences, corresponding to P<0.05, P<0.01, P<0.001 respectively, indicating that there are significant differences in the expression levels of some genes in the TAC group compared with the sham group (both genotypes are wild-type WT);

[0030] Figure 1 d is a qRT-PCR detection of the change in Pxdc1 expression induced by PE treatment to induce myocardial cell hypertrophy in NRVMs; the solvent control group is uniformly labeled as the Vehicle treatment group in the data chart;

[0031] Figure 2 This is the effect of cardiac-specific deficiency of Pxdc1 on the cardiac function and structure of mice in the embodiments of the present invention; it is divided into the ShamPxdc1 fl / fl group, the TACPxdc1 fl / fl group, the ShamPxdc1 fl / fl ; cre group and the TACPxdc1 fl / fl ; cre group; among them Figure 2 a-2h are shown as follows:

[0032] Figure 2 a is a cardiac ultrasound image of the short-axis section of the left ventricle of a mouse;

[0033] Figure 2b shows that the cardiac-specific deficiency of Pxdc1 has no effect on ejection fraction (EF) and fractional shortening (FS) as shown by quantitative echocardiography results. The sample sizes n of the sham group and the TAC group are 5 and 8, respectively.

[0034] Figure 2 c shows representative images of the hearts of mice in the TAC / Sham Pxdc1 fl / fl group and Pxdc1 fl / fl ; cre group. Scale bar, 1 mm.

[0035] Figure 2 d shows the ratio of the heart weight to body weight of mice in the TAC / Sham Pxdc1 fl / fl group and Pxdc1 fl / fl ; cre group.

[0036] Figure 2 e shows representative images of H&E staining of the hearts of mice in the TAC / Sham Pxdc1 fl / fl group and Pxdc1 fl / fl ; cre group. Scale bar, 1000 μm. The sample size n of each group is 3.

[0037] Figure 2 f shows representative images and statistical results of wheat germ agglutinin (WGA) staining of cross-sections of cardiomyocytes of mice in the TAC / Sham Pxdc1 fl / fl group and Pxdc1 fl / fl ; cre group. Scale bar, 50 μm. The sample size n of each group is 25.

[0038] Figure 2 g shows representative images and statistical results of Masson trichome fl / fl staining of cross-sections of cardiomyocytes of mice in the TAC / Sham Pxdc1 fl / fl group and Pxdc1

[0039] ; cre group. Scale bar, 50 μm. The sample size n of each group is 15.

[0040] Figure 2 h shows the expression of cardiac hypertrophy markers (Nppa, Nppb, Myh6, Myh7, and Acta1) in the hearts of Pxdc1 fl / fl ; cre mice. The sample sizes n of the sham group and the TAC group are 5 and 6, respectively. The ordinate represents the relative gene expression value. fl / fl

[0041] Figure 3This is the effect of Pxdc1 on the expression of myocardial hypertrophy markers and cell morphology in the myocardial hypertrophy model of NRVMs cardiomyocytes in the embodiments of the present invention; among them Figure 3 a - 3d are as follows:

[0042] Figure 3 a is the effect of overexpressing Pxdc1 with adenovirus on the mRNA level expression of myocardial hypertrophy markers (Nppa, Nppb, and Acta1) in the myocardial hypertrophy model of PE - induced NRVMs cardiomyocytes; among them, the experimental group uses an adenovirus vector carrying the Pxdc1 gene (Ad - Pxdc1), while the control group uses an empty adenovirus vector (Ad - Vector); the transfected cells are divided into a Vehicle treatment group (solvent control group) and

[0043] PE treatment group;

[0044] Figure 3 b is the result of WGA staining and cell area statistics in the myocardial hypertrophy model of PE - induced NRVMs cardiomyocytes with overexpression of Pxdc1 by adenovirus;

[0045] Figure 3 c is the effect of knocking down Pxdc1 with siRNA on the mRNA level expression of myocardial hypertrophy markers in the myocardial hypertrophy model of PE - induced NRVMs cardiomyocytes; among them, the siPxdc1 group specifically knocks down the expression of the Pxdc1 gene, and siNeg is used as a control; the transfected cells are divided into a Vehicle treatment group (solvent control group) and a PE treatment group;

[0046] Figure 3 d is the result of WGA staining and cell area statistics in the myocardial hypertrophy model of PE - induced NRVMs cardiomyocytes, among which the siPxdc1 group specifically knocks down the expression of the Pxdc1 gene, and siNeg is used as a control. Detailed implementation manners

[0047] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention. For those conditions not specified in the embodiments, they shall be carried out according to conventional conditions or conditions recommended by the manufacturer. For the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0048] Through in vitro and in vivo experiments, the present invention explored the role of Pxdc1 in the pathological mechanism of myocardial hypertrophy. At the cellular level, a hypertrophy model of neonatal rat ventricular myocytes (NRVMs) was induced by phenylephrine (PE). The results showed that knockdown of Pxdc1 significantly inhibited the expression of myocardial hypertrophy marker genes and cell hypertrophy, while overexpression of Pxdc1 exacerbated these effects. In animal experiments, a cardiac-specific Pxdc1 gene knockout mouse model was constructed, and transverse aortic constriction (TAC) was performed to induce myocardial hypertrophy. It was found that the degree of cardiac hypertrophy and cardiac function damage in Pxdc1 knockout mice were more significant. These findings comprehensively indicate that Pxdc1 plays a crucial role in the occurrence and development of myocardial hypertrophy. Therefore, the present invention first confirmed PXDC1 as a potential therapeutic target for pathological myocardial hypertrophy and effectively demonstrated the key role of PXDC1 in the occurrence and development of pathological myocardial hypertrophy.

[0049] In some specific embodiments, the present invention provides reagents for inhibiting the expression of PXDC1, including: specific inhibitors of PXDC1, knockdown siRNA or shRNA targeting Pxdc1. By preparing and applying reagents for inhibiting the expression of PXDC1, it is expected to delay the occurrence and development process of pathological myocardial hypertrophy.

[0050] In some specific embodiments, the present invention studied that Pxdc1 is involved in the pathological process of myocardial hypertrophy by regulating the expression of genes related to myocardial hypertrophy, such as Nppa, Nppb, Myh6, Myh7, and Acta1, etc. In the myocardial cell hypertrophy model induced by PE, knockdown of Pxdc1 significantly inhibited the expression of these genes and cell hypertrophy, while overexpression of Pxdc1 promoted these effects. In animal experiments, cardiac-specific knockout of Pxdc1 exacerbated the degree of cardiac hypertrophy and cardiac function damage induced by TAC. These findings revealed the core mechanism of action of Pxdc1 in myocardial hypertrophy and provided a scientific basis for its application as a therapeutic target.

[0051] In the embodiments of the present invention, all animal experimental procedures were reviewed and approved by the Animal Ethics Committee of Shenzhen Hospital of Fuwai Hospital, Chinese Academy of Medical Sciences, and were carried out in accordance with the Guide for the Care and Use of Laboratory Animals (8th Edition) published by the National Institutes of Health (USA). All mice were housed in a specific pathogen-free (SPF) environment at a room temperature of 24 ± 3 °C, a humidity of 55 ± 5%, with a 12 h light / 12 h dark cycle, and fed a normal diet. Male C57BL / 6 mice were used in the present invention. The Pxdc1 fl / fl mice were mated with αMHC-MerCreMer mice to obtain Pxdc1 fl / flMale mice expressing cre (for specific operations, refer to Example 1) were used in subsequent experiments.

[0052] (I) Method

[0053] 1. Establish a mouse model of myocardial hypertrophy (TAC group)

[0054] After shaving the mice, they were anesthetized, and the chest and abdominal regions of the mice were disinfected. The skin was incised horizontally along the 2nd - 3rd intercostal space. The muscle and soft tissues were separated in sequence, and the aortic arch region was dissected free. A 7-0 surgical suture was passed through the aorta, and the aortic arch was ligated together with the blunted 27-gauge needle. Then the needle was immediately withdrawn. After causing approximately 70% stenosis of the aorta, penicillin was instilled, and the incision was sutured.

[0055] In the sham operation (Sham) group, no ligation was performed, and other surgical procedures were the same as those in the model group.

[0056] 2. Detection of mouse cardiac ultrasound

[0057] The mice were anesthetized with isoflurane gas. The four limbs of the mice were fixed on the ultrasonic electrode pads with tape, and coupling agent was applied to the skin of their four limbs and the cardiac region to avoid air bubbles. Detection was performed using an echocardiography system with a 30-MHz imaging sensor. When detecting the short axis of the left ventricle of the heart, the notch of the ultrasonic probe was oriented towards the left forelimb of the mouse, with an inclination angle of about 45°. The probe was adjusted to fit the skin of the mouse. After turning on the B-mode ultrasound mode, the operation panel was adjusted according to the image until a clear circular echocardiogram with two papillary muscles was displayed. Subsequently, the M-mode ultrasound mode was turned on. After adjusting the sampling line to the correct position, the save key was pressed to obtain the M-mode echocardiogram of the left ventricular short axis. By using the mouse cardiac ultrasound detection technique, the ejection fraction (EF) and fractional shortening (FS) were obtained. The specific calculation formulas are as follows:

[0058]

[0059] The calculation formula for ejection fraction (EF) is:

[0060] where EDV represents the left ventricular end-diastolic volume and ESV represents the left ventricular end-systolic volume.

[0061]

[0062] The calculation formula for fractional shortening (FS) is:

[0063] where LVEDd represents the left ventricular end-diastolic diameter and LVESd represents the left ventricular end-systolic diameter.

[0064] 3. Isolation and culture of primary rat cardiomyocytes (Neonatal Rat Ventricular Myocytes, NRVMs)

[0065] Disinfect the chest skin of neonatal SD rats (within 3 days after birth, purchased from Zhuhai Bestone Biotechnology Co., Ltd.) with 75% ethanol. Use curved scissors to cut open the chest skin and ribs, use curved forceps to remove the heart, and place it in a petri dish (diameter 6 mm) containing ADS buffer (NaCl 120 mM, HEPES (pH 7.4) 20 mM, NaH2PO4 8 mM, glucose 6 mM, KCl 5 mM, MgSO4 0.8 mM) placed on ice. Remove the large blood vessels, auricles and atria attached to the surface of the heart, and cut the ventricular tissue into pieces of 1 mm 2 。Add 0.08% type II collagenase (Sigma) and 0.125% trypsin (Sigma) digestion solution, and digest at 37°C for 20 min each time. Discard the supernatant for the first time and start collecting the supernatant from the second time. This process continues until the heart tissue is completely digested. Use percoll (GE) density gradient centrifugation to separate fibroblasts, and culture them in high-glucose DMEM (Hyclone) medium containing 10% fetal bovine serum (Gbico) and 1% penicillin / streptomycin. After culturing for 24 h, the medium is changed to high-glucose DMEM containing 1% ITS and 1% penicillin / streptomycin.

[0066] 4. Overexpression of Pxdc1 (adenovirus infection of NRVMs)

[0067] In the overexpression experiment of NRVMs, overexpress Pxdc1 by infecting NRVMs with adenovirus (customized from Hanheng Biotechnology Co., Ltd., project number: HH20240803WHZL-ADP01). The virus infection steps are as follows:

[0068] Cells are cultured in six-well plates. After culturing NRVMs without serum for 24 h, according to the optimal virus usage amount explored in the preliminary experiment, add 1 μL of virus to each well of the six-well plate. After infecting NRVMs with the virus for 12 h, change the culture medium to high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin to remove the virus, add phenylephrine (100 μM per well), and continue to culture for 36 h, then harvest the cells.

[0069] 5. Knock down the expression of Pxdc1 gene using siRNA

[0070] Inhibit the expression of certain genes in cells by siRNA transfection. The rPxdc1-specific siRNA oligonucleotides were purchased from GenePharma. The target sequences of the siRNA used were rPxdc1 siRNA, sense and antisense (as shown in SEQ ID NO: 1-2). According to the manufacturer's instructions, siRNA transfection was performed using Lipofectamine iMAX (Invitrogen) at a transfection ratio of iMAX:siRNA = 3:2. After 12 h of transfection of NRVMs, the culture medium was replaced with high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin to remove the siRNA. After adding phenylephrine (100 μM per well) and continuing to culture for 36 h, the cells were harvested.

[0071] 6. Real-time quantitative PCR detection

[0072] Total RNA was extracted from heart and liver tissues and NRVMs using an RNA extraction solution (Servicebio) according to the manufacturer's instructions. RNA was quantified using a NanoDrop (Thermo Fisher Scientific). Cells were washed twice with PBS buffer for 3 minutes each time, Trizol was added, and a cell scraper was used to scrape the cells off the six-well plate; left to stand at room temperature for 5 minutes, pre-cooled chloroform at 4°C was added, shaken vigorously for 30 seconds, left to stand at room temperature for 3 minutes, centrifuged at 12,000 rpm at 4°C for 15 minutes; the liquid was layered, with the upper aqueous layer and the lower organic layer. The upper aqueous layer was carefully aspirated, an equal volume of isopropanol was added, gently mixed, left to stand at room temperature for 10 minutes, centrifuged at 12,000 rpm at 4°C for 60 minutes; RNA formed a precipitate at the bottom of the tube, 75% alcohol prepared with DEPC water was added, washed once, centrifuged at 12,000 rpm at 4°C for 10 minutes; the 75% alcohol was aspirated, left to stand at room temperature and air-dried, an appropriate amount of DEPC water was added to dissolve the RNA, and the concentration was measured using a Nanodrop instrument. RNA was reverse transcribed into cDNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis kit). The reaction system was as follows: 5×Reaction Buffer 2 μL, 10 mM dNTP Mix 1 μL, Random Primer 1 μL, RiboLock RNase Inhibitor 0.5 μL, RevertAid M-MuLV RT 0.5 μL, RNA 1 μg, nuclease-free Water was made up to 10 μL; PCR reaction: 25°C, 5 minutes; 42°C, 60 minutes; 70°C, 5 minutes. Real-time fluorescence quantitative PCR was performed using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme) on a QuantStudio 7 Pro detection instrument (Thermo Fisher Scientific). The reaction system for qRT-PCR was as follows:

[0073] 2×SYBR Green Master MIX 5 μL Water 3 μL Forward Primer 0.5 μL Reserve Primer 0.5 μL cDNA 1 μL

[0074] The reaction system except for cDNA was first added to a 384-well plate, then 1 μL of cDNA was added to the corresponding wells, and the 384-well plate was sealed with a transparent film. After centrifuging the 384-well plate at 1000 rpm at room temperature for 1 minute, it was placed in a real-time quantitative PCR instrument for detection. The reaction program was as follows:

[0075]

[0076] After the reaction, the specificity of the primers was judged by the melting curve, and the content of the target gene was calculated from the Ct value. The PCR primer sequences used in this application are shown in Table 1 (SEQ ID NO: 3-34). Actb or Gapdh was used as the endogenous control to measure the relative expression level of the gene.

[0077] 7. Histopathological staining

[0078] After the mice were sacrificed, the excised heart tissues were rinsed in physiological saline and fixed in 4% paraformaldehyde at room temperature for 24 h. Subsequently, these heart tissues were embedded in paraffin and cut into 5-μm tissue sections using standard histological methods. Histopathology was stained with H&E (hematoxylin-eosin staining method), fibrosis was stained with Masson, and the pathological section staining was completed by Sevier Biotechnology Co., Ltd. The cardiomyocyte area was stained with WGA (Wheat Germ Agglutinin). Scanning was performed using a confocal microscope (Olympus FV300), and analysis was performed using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda).

[0079] After transfection or drug stimulation, the cells were washed twice with phosphate buffered saline (PBS) for 3 min each time. The steps for WGA staining of cardiomyocytes are as follows:

[0080] Reagent Step Time / min Times 4% Paraformaldehyde Fix at room temperature 15 1 PBS Buffer Wash 5 3 0.2% Triton X-100 Permeabilize at room temperature 10 1 PBS Buffer Wash 5 3 5.0 μg / mL WGA Dye Stain the membrane at 37°C 10 1 PBS Buffer Wash 5 3

[0081] Images of WGA-stained cardiomyocytes were collected under a fluorescence microscope, and the surface of cardiomyocytes was measured using Image Pro Plus 6.0 software. The number of cells used for statistical analysis of the cardiomyocyte area in each group was more than 50.

[0082] 8. Statistical analysis

[0083] GraphPad Prism 8 software was used for statistical analysis. All experimental data were expressed as the mean ± SEM of at least three independent experiments. One-way ANOVA or two-way ANOVA was used for the statistical significance of multiple comparisons, followed by Tukey's test. Bonferroni adjustment was used for post hoc analysis. Student's t-test was used for comparison between two groups. P < 0.05 was considered statistically significant.

[0084] Example 1

[0085] 1. Construction of heart-specific Pxdc1 gene knockout mice (Pxdc1 fl / fl ; cre mice)

[0086] (1) Method

[0087] In this example, a mouse model (Pxdc1 fl / fl ; cre mice) was constructed by inserting loxp sites into two alleles of the Pxdc1 gene and expressing a heart tissue-specific Cre recombinase. The specific construction steps are as follows (as shown in Figure 1 a):

[0088] There are 4 transcripts of the Pxdc1 gene. According to the structure of the Pxdc1 gene, the region from exon 2 to exon 4 (exon2-exon4) of the Pxdc1-202 transcript (ENSMUST00000053459.15) was used as the knockout target region. This region contains 322 bp of coding sequence, and knockout will result in the disruption of protein function. The Pxdc1 gene was edited using the CRISPR / Cas9 technology, and the process is as follows: The CRISPR / Cas9 system and the donor vector (Donor) were injected into the fertilized eggs of C57BL / 6JGpt mice by microinjection. Subsequently, the fertilized eggs were transplanted to obtain positive F0 generation mice, and the effectiveness of gene editing was verified by PCR and sequencing. Further, the positive F0 generation mice were mated with C57BL / 6JGpt mice to finally obtain a stable F1 generation mouse model. Hybridization with the αMHC-MerCreMer (MCM) mouse strain carrying the CRE enzyme yielded a Pxdc1 fl / fl ; αMHC-MCM mouse strain. After induction with Tamoxifen (75 mg / kg), Pxdc1 heart-specific knockout mice were obtained.

[0089] (2) Results

[0090] The Pxdc1 gene in different tissues of mice with different genotypes was detected by agarose gel electrophoresis ( Figure 1 b). The insertion of two Loxp sites spanned exons 2-4. If knockout did not occur, since the two Loxp sites were separated by about 10,000 bp, the target band could not be obtained by conventional PCR, and the agarose gel electrophoresis showed no band. For example, in the Pxdc1 fl / fl control and the liver and kidneys of the Pxdc1 fl / fl ; cre group. Only when Tamoxifen induced the CRE enzyme to recognize and cleave the Loxp site of αMHC could the PCR successfully synthesize the target band, and the agarose gel electrophoresis showed a band. Combining these two groups of controls finally demonstrated that Pxdc1 was successfully knocked out specifically in the heart tissue.

[0091] 2. Changes in the expression levels of Pxdc1 and related genes in wild-type (Wildtype, WT) mice after TAC

[0092] (1) Methods

[0093] In this example, transverse aortic constriction (TAC) was performed on wild-type mice, and the expression levels of Pxdc1 and related genes were detected after the operation. The specific steps are as follows:

[0094] Wild-type mice (male, 8 weeks old) were subjected to TAC surgery to establish a pathological myocardial hypertrophy model. First, the mice were anesthetized with sodium pentobarbital (50 mg / kg), the hair on the left chest of the mice was shaved and disinfected for standby. The skin was incised between the 2nd and 3rd intercostal spaces to expose the muscle and soft tissue, the thoracic aorta was isolated, ligated together with the aorta using 7-0 surgical suture and a 26G needle, and then the needle was immediately withdrawn to cause about 70% stenosis of the aorta. Penicillin was dropped, and the surgical wound was sutured. The sham operation control group had the same steps except for not performing ligation. After the operation, a high-frequency Doppler ultrasound instrument was used to evaluate the degree of vascular stenosis and M-mode ultrasound was used to detect the development of myocardial hypertrophy (examined once a week). After 6 weeks, the mice were sacrificed, weighed, and heart samples were collected. Total RNA was extracted from the heart using an RNA extraction solution (Servicebio) according to the manufacturer's instructions. RNA was quantified using NanoDrop (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis kit) (the specific system and steps are shown in Method 6). Real-time fluorescence quantitative PCR was performed using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme) on a QuantStudio 7 Pro detection instrument (Thermo Fisher Scientific). (The specific steps and system are shown in Method 6)

[0095] (2) Results

[0096] The genes Nppa, Nppb, Myh6, and Myh7 are markers of myocardial hypertrophy. Previous studies have shown that the change directions of Nppa, Nppb, and Myh7 are the same, and they are upregulated during the process of myocardial hypertrophy in mice, while Myh6 is downregulated; and Myh6 and Myh7 show opposite trends in expression during the process of myocardial hypertrophy, one increasing while the other decreasing. The experimental results of this example showed that the expressions of Nppa, Nppb, and Myh7 were upregulated after TAC, and the expression of Myh6 was downregulated (as shown in Figure 1 c); indicating that the TAC surgery successfully induced myocardial hypertrophy. The expression level of the Pxdc1 gene was also upregulated after TAC. Therefore, the Pxdc1 gene may be involved in the process of myocardial hypertrophy.

[0097] 3. Changes in the expression levels of Pxdc1 and related genes during the process of phenylephrine (PE)-induced hypertrophy of neonatal rat ventricular myocytes (NRVMs)

[0098] (1) Method

[0099] In this example, PE was used to stimulate NRVMs, and the expression levels of Pxdc1 and related genes were detected. The specific steps are as follows:

[0100] Cells were cultured in six-well plates. After culturing NRVMs in serum-free medium for 24 h, phenylephrine (100 μM per well) was added and the cells were cultured for another 36 h, and then the cells were harvested. Total RNA was extracted from NRVMs using an RNA extraction solution (Servicebio) according to the manufacturer's instructions. RNA was quantified using NanoDrop (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis kit) (the specific system and steps are shown in Method 6). Real-time fluorescence quantitative PCR was performed using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme) on a QuantStudio 7 Pro detection instrument (Thermo Fisher Scientific). (The specific steps and system are shown in Method 6)

[0101] (2) Results

[0102] The expressions of Nppa and Nppb were up-regulated, and the expression of Myh6 was down-regulated in cardiomyocytes stimulated with phenylephrine (PE), indicating that PE successfully induced myocardial hypertrophy in NRVMs. The expression level of the Pxdc1 gene was significantly higher than that in the Vehicle group (as shown in Figure 1 d), indicating that the Pxdc1 gene may be involved in the process of cardiomyocyte changes, and this change is likely to be related to the occurrence of myocardial hypertrophy.

[0103] Example 2

[0104] (1) Method

[0105] In this example, Pxdc1 fl / fl ; cre mice and Pxdc1 fl / fl mice were respectively subjected to Sham and TAC treatments, and echocardiography and cardiac function parameters were measured. The specific steps are as follows:

[0106] The Pxdc1 fl / fl ; cre mice (male; 8-week-old) after Tamoxifen-induced knockout were subjected to TAC surgery (the specific method is shown in Method 1), with Pxdc1 fl / flAs a control. At 4 - 6 weeks after TAC, cardiac function and cardiac structure were evaluated weekly by echocardiography to observe the progression of myocardial hypertrophy in mice. The hair on the chest of the mice was shaved off, and the mice were anesthetized and fixed using an isoflurane inhalation anesthetic machine. Coupling agent was applied, and the mice were placed in the supine position. The probe was located at the apical region of the left chest. The standard short - axis section of the left ventricular papillary muscle was selected, and the left ventricular end - systolic / diastolic interventricular septum thickness (IVSs / IVSd), left ventricular end - systolic / diastolic posterior wall thickness (LVPWs / LVPWd), and left ventricular end - systolic / diastolic internal diameter (LVIDs / LVIDd) were measured for at least 3 consecutive cardiac cycles, and then the average values were taken. The left ventricular end - systolic / diastolic volume (LVESV / LVEDV) was calculated using Simoson’s method of disks. The formula for calculating the left ventricular ejection fraction (LVEF%) is (LVEDV - LVESV) / LVEDV×100%, and the formula for calculating the left ventricular fractional shortening (LVFS%) is (LVEDD - LVESD) / LVEDD×100%. Data from 5 - 8 mice were collected in each group.

[0107] (2) Results

[0108] Echocardiographic results of the short - axis section of the left ventricle in mice after Sham and TAC treatments Figure 2 a) showed that compared with the Sham group, the cardiac structures of both groups changed after TAC treatment, and Pxdc1 fl / fl ; there were morphological differences between the cre group and the Pxdc1 fl / fl group. Measurement results of the ejection fraction (EF) and fractional shortening (FS) in mice after Sham and TAC treatments Figure 2 b) showed that Pxdc1 fl / fl ; the decline in EF and FS values in the cre group became smaller, indicating that cardiac - specific deficiency of Pxdc1 could repair TAC - induced cardiac systolic function injury and slow down ventricular remodeling.

[0109] Figure 2c, d, e, and f show that the heart volume is increased in the TAC-treated group compared with that in the Sham-treated group, and cardiac-specific deficiency of Pxdc1 attenuates TAC-induced cardiac hypertrophy. In addition, Figure 2 in h, the expression levels of myocardial hypertrophy markers (Nppa, Nppb, Myh6, Myh7, Acta1) in the mouse heart were low and similar in the two groups during Sham treatment; after TAC treatment, the expressions of Nppa, Nppb, Myh7, and Acta1 markers were upregulated in both groups, the expression of Myh6 was downregulated, and Pxdc1 fl / fl ; the upregulation amplitude in the cre group was significantly lower than that in the Pxdc1 fl / fl group, indicating that cardiac-specific deficiency of Pxdc1 reduces the expression of TAC-induced myocardial hypertrophy markers, further demonstrating that cardiac-specific deficiency of Pxdc1 slows down the pathological process of TAC-induced myocardial hypertrophy.

[0110] Example 3

[0111] (1) Method

[0112] In this example, adenovirus was used to overexpress Pxdc1, and the expression of myocardial hypertrophy marker genes and cell morphological changes induced by PE were detected. The specific steps are as follows:

[0113] Cells were cultured in 6-well plates. After culturing NRVMs without serum for 24 h, according to the optimal virus dosage explored in the preliminary experiment, 1 μL of virus was added to each well of the 6-well plate. After the virus infected NRVMs for 12 h, the culture medium was replaced with high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin to remove the virus. After adding phenylephrine (100 μM per well) and continuing to culture for 36 h, the cells were harvested. Total RNA was extracted from NRVMs using an RNA extraction solution (Servicebio) according to the manufacturer's instructions. RNA was quantified using NanoDrop (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis kit) (the specific system and steps are shown in Method 6). Real-time fluorescence quantitative PCR was performed on a QuantStudio 7 Pro detection instrument (Thermo Fisher Scientific) using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme) (the specific steps and system are shown in Method 6). Scanning was performed using a confocal microscope (Olympus FV300), and analysis was carried out using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda) (the steps for WGA staining of cardiomyocytes are shown in Method 7).

[0114] (2) Results

[0115] Results of overexpressing Pxdc1 with adenovirus ( Figure 3 a) showed that overexpression of Pxdc1 further promoted the expression of myocardial hypertrophy marker genes Nppa, Nppb, and Acta1 under PE induction. Cell morphology and area showed ( Figure 3 b) When treated with Vehicle, there was no obvious difference in cell morphology between the Ad-Pxdc1 group and the Ad-Vector group; after PE treatment, the cell morphology change in the Ad-Pxdc1 group was more significant, and the cell volume was larger. The cross-sectional area of cells in the Ad-Pxdc1 group was significantly larger than that in the Ad-Vector group after PE treatment; thus, it can be seen that overexpression of Pxdc1 promoted the hypertrophy of cardiomyocytes under PE induction.

[0116] Example 4

[0117] (1) Method

[0118] In this example, siRNA was used to knockdown the expression of Pxdc1, and the expression of myocardial hypertrophy marker genes and cell morphology changes under PE induction were detected; the specific steps are as follows:

[0119] The target sequence of the siRNA used was rPxdc1 siRNA, sense and antisense (as shown in SEQ ID NO: 1-2). According to the manufacturer's instructions, siRNA transfection was performed using Lipofectamine iMAX (Invitrogen) at a transfection ratio of iMAX:siRNA = 3:2. After 12 h of transfection of NRVMs, the culture medium was changed to high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin to remove the siRNA. After adding phenylephrine (100 μM per well) and continuing to culture for 36 h, the cells were harvested. Total RNA was extracted from NRVMs using an RNA extraction solution (Servicebio) according to the manufacturer's instructions. RNA was quantified using NanoDrop (ThermoFisher Scientific). RNA was reverse transcribed into cDNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis kit) (the specific system and steps are shown in Method 6). Real-time fluorescence quantitative PCR was performed on a QuantStudio 7 Pro detection instrument (Thermo Fisher Scientific) using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme) (the specific steps and system are shown in Method 6). Scanning was performed using a confocal microscope (Olympus FV300), and analysis was performed using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda) (the steps for WGA staining of cardiomyocytes are shown in Method 7).

[0120] (2) Results

[0121] The effect of Pxdc1 knockdown on the expression of cardiomyocyte hypertrophy marker genes was as Figure 3 shown in c. The effect of Pxdc1 knockdown on the expression of cardiomyocyte hypertrophy marker genes was as Figure 3 shown in c. The siPxdc1 group successfully knocked down the Pxdc1 gene. After PE treatment, the expression levels of cardiomyocyte hypertrophy marker genes (Nppa, Nppb, Acta1) in the siPxdc1 group were significantly lower than those in the siNeg group, indicating that Pxdc1 knockdown inhibited the expression of these genes.

[0122] Therefore, Pxdc1 may play a central role in the pathological mechanism of cardiomyocyte hypertrophy. Achieving Pxdc1 knockout through technical means is expected to be an effective strategy for inhibiting the expression of cardiomyocyte hypertrophy marker genes induced by PE, opening up a new perspective and providing targets for the treatment research of cardiomyocyte hypertrophy.

[0123] From the results of cell morphology observation and area statistics ( Figure 3As shown in (d), from the WGA staining pictures, it can be seen that when treated with Vehicle, there is little difference in cell morphology between the siPxdc1 group and the siNeg group; after PE treatment, the change in cell morphology of the siPxdc1 group is relatively small, and the cell volume is smaller than that of the siNeg group. The cross-sectional area of the cells in the siPxdc1 group after PE treatment is significantly smaller than that of the siNeg group), indicating that knockdown of Pxdc1 inhibits cardiomyocyte hypertrophy induced by PE.

[0124] In summary, through the in vivo experiment of constructing a heart-specific Pxdc1 gene knockout mouse model and performing aortic constriction, and the in vitro experiment of stimulating NRVMs with phenylephrine, this application discovers that Pxdc1 plays a central role in the pathological mechanism of myocardial hypertrophy. Overexpression of Pxdc1 promotes the expression of myocardial hypertrophy marker genes and cardiomyocyte hypertrophy, while knockdown of Pxdc1 inhibits these effects. Therefore, Pxdc1 may become an effective target for inhibiting the progression of pathological myocardial hypertrophy under pressure load, providing a new perspective and strategy for the treatment research of myocardial hypertrophy.

[0125] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of PXDC1 in the preparation of a product for treating myocardial hypertrophy, characterized in that, The PXDC1 includes the Pxdc1 gene or the protein encoded thereby.

2. The application according to claim 1, wherein The myocardial hypertrophy includes pathological myocardial hypertrophy.

3. The application according to claim 1, characterized in that The myocardial hypertrophy is caused by pressure overload.

4. The application according to claim 3, characterized in that, The pressure overload includes the pressure overload induced by TAC surgery or phenylephrine.

5. The application according to claim 1, characterized in that Use of the expression product of PXDC1 as a drug target in the preparation of a product for improving and / or treating myocardial hypertrophy.

6. The application according to claim 1, characterized in that, Use of an inhibitor of PXDC1 expression in the preparation of a product for improving and / or treating myocardial hypertrophy.

7. The application according to claim 6, characterized in that, The inhibitor of PXDC1 expression includes an RNA interference molecule targeting the PXDC1 gene, and the RNA interference molecule includes at least one of siRNA, shRNA, and miRNA mimics.

8. The application according to claim 7, wherein The product is a drug or a drug combination, and its components include a pharmaceutically acceptable carrier, excipient, or stabilizer.

9. The application according to claim 7, wherein The dosage form of the product is any one of capsules, granules, tablets, pills, or oral liquids.

10. The application according to claim 1, characterized in that, The product is used for at least one of the following purposes: (1) reducing the expression level of a myocardial hypertrophy biomarker; (2) reducing the cross-sectional area or volume of cardiomyocytes; (3) increasing the ejection fraction and shortening fraction of the heart; (4) reducing the ratio between heart weight and body weight; (5) repairing or reducing the degree of myocardial fibrosis.

Images