Bacillus marinus with the ability of producing idebenone and high antioxidant capacity

By screening and identifying Oceanobacillus sp. Y-3, the problem of lacking strains that efficiently scavenge free radicals and produce idebenone in existing technologies has been solved, and the ability to efficiently scavenge free radicals and produce idebenone has been achieved, which is applicable to the fields of pharmaceuticals, cosmetics and health products.

CN120290355BActive Publication Date: 2026-06-02JIANGNAN UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2024-12-13
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The lack of efficient free radical scavenging microbial strains in existing technologies, especially strains capable of producing idebenone, limits the development of products in the food, health products, and cosmetics industries.

Method used

A strain of Oceanobacillus sp. Y-3 was screened and identified. It has the ability to efficiently scavenge free radicals and produce idebenone, adapts to growth from a variety of carbon sources, has high salt tolerance, and exhibits significant antioxidant properties. It is suitable for preparing microbial agents and product compositions.

Benefits of technology

Bacillus aureus CCTCC NO: M 20242434 can effectively scavenge DPPH free radicals, ABTS cation free radicals and hydroxyl free radicals, has a strong iron ion reducing ability, and can produce idebenone, making it suitable for the fields of pharmaceuticals, cosmetics and health products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290355B_ABST
    Figure CN120290355B_ABST
Patent Text Reader

Abstract

The application discloses a bacillus megaterium with the ability of producing aediron and high antioxidant capacity, and belongs to the field of microbial strains. The bacillus megaterium Y-3 is screened from black mud in a salt lake in Yuncheng, Shanxi, has high free radical scavenging capacity and strong iron ion reduction capacity, shows high antioxidant activity, and has the ability of producing aediron. The strain has great application potential in the fields of health products and cosmetics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a strain of Bacillus aquatilis with the ability to produce idebenone and high antioxidant capacity, belonging to the field of microbial strains. Background Technology

[0002] Free radicals, as clusters of atoms or molecules with unpaired electrons produced during metabolism, play an important role in signal transduction under physiological conditions. However, when free radicals accumulate excessively in the body, they attack cellular structures, leading to a series of oxidative stress reactions such as DNA damage, lipid peroxidation, and protein denaturation, thereby triggering various diseases. Therefore, finding effective methods to eliminate free radicals in the body is of great significance for maintaining human health.

[0003] Currently, free radical scavenging is mainly achieved through two mechanisms: first, through the body's naturally occurring antioxidant enzyme system, such as superoxide dismutase (SOD); and second, through exogenous intake of substances with antioxidant activity, such as vitamins, minerals, and certain natural products. However, with age and individual differences, the activity of antioxidant enzymes in the body gradually decreases, and the absorption and utilization efficiency of traditional antioxidants also has certain limitations. Therefore, developing new and highly efficient free radical scavengers has become a current research hotspot.

[0004] Idebenone, a highly effective antioxidant, possesses a benzoquinone group in its structure that efficiently captures and scavenges free radicals, thereby protecting cells from oxidative stress damage. In the biomedical field, idebenone has been widely used to treat neurological and cardiovascular diseases and improve skin health. In cosmetics and skincare products, idebenone also plays a role in scavenging free radicals, inhibiting lipid peroxidation, suppressing inflammation, and inhibiting DNA damage, significantly improving skin condition. However, the chemical synthesis of idebenone is not only costly but may also pollute the environment. Therefore, finding a sustainable and environmentally friendly method for producing idebenone is particularly important.

[0005] In the field of microbiology, probiotics such as lactic acid bacteria and bifidobacteria are widely used in food fermentation, pharmaceuticals, and health products due to their excellent bioactivity and safety. Recent studies have shown that some lactic acid bacteria and bifidobacteria strains possess strong antioxidant capabilities, scavenging free radicals in the body and protecting cells from oxidative damage. However, although many probiotics have been proven to have antioxidant activity, the free radical scavenging abilities vary significantly among different strains. Relatively few strains can efficiently scavenge multiple free radicals, and no existing technology for producing idebenone by microorganisms has been publicly disclosed or reported. Therefore, screening and isolating strains with higher free radical scavenging capabilities and the ability to produce idebenone is of great significance for developing novel functional products applicable to various fields such as food, health products, and cosmetics. Summary of the Invention

[0006] To address the aforementioned issues, this invention screened a strain of Bacillus aquatilis Y-3 from the black mud of Yuncheng Salt Lake in Shanxi Province. This bacterium possesses highly efficient free radical scavenging and antioxidant capabilities, as well as the ability to produce idebenone. Furthermore, this invention comprehensively identified the bacterium through physiological and biochemical analyses and phenotypic characterization, aiming to lay a foundation for the development of new and highly efficient free radical scavengers from a microbiological perspective, and to provide new ideas and strain resources for the development of pharmaceuticals, cosmetics, and health products.

[0007] The first objective of this invention is to provide a strain of Bacillus aquaticus with the ability to produce idebenone and high antioxidant capacity. Oceanobacillus sp. Y-3, taxonomically named Oceanobacillus sp. Y-3 was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

[0008] The novel *Bacillus cereus* CCTCC NO: M20242434 of this invention, possessing idebenone-producing ability and high antioxidant capacity, has the following characteristics:

[0009] (1) Colony characteristics: The colonies are orange-red round colonies, opaque, with a raised center, and the edges of the colonies are neat and the size and shape are stable;

[0010] (2) Morphological characteristics: Gram-positive bacteria, without flagella, the bacterial cells are short rod-shaped, with a length range of 1.5 to 1.8 μm and a width range of 0.3 to 0.4 μm;

[0011] (3) Growth characteristics: It can tolerate 0~5% salinity; the optimal growth temperature is 30 ℃; the growth pH range is 6.5~9.0, and the optimal growth pH range is 7.0~7.2; it can use starch, glucose, sucrose, maltose and other sugars as the only carbon source for growth;

[0012] (4) Physiological and biochemical characteristics: positive for catalase, starch hydrolysis, cellulose decomposition, glucose oxidation and fermentation, negative for protease, positive for esterase, and positive for indole; it is a facultative anaerobic bacterium that grows well under both aerobic and anaerobic conditions.

[0013] (5) Antioxidant properties:

[0014] a. It can effectively scavenge DPPH free radicals, ABTS cationic free radicals, and hydroxyl free radicals, exhibiting strong antioxidant capacity: When the concentration of *Bacillus oryzae* CCTCC NO: M 20242434 cell lysate is higher than 12 mg / mL, the scavenging rate of DPPH free radicals reaches over 90%; when the concentration of *Bacillus oryzae* CCTCC NO: M 20242434 cell lysate is higher than 10 mg / mL, the scavenging rate of ABTS cationic free radicals reaches over 90%; preferably, when the concentration of the cell lysate is 20 mg / mL, the scavenging rate of ABTS cationic free radicals reaches over 99%; the scavenging rate of hydroxyl free radicals by the 10 mg / mL anhydrous ethanol intracellular extract reaches 72.23%;

[0015] b. It has a strong iron ion reducing ability. When the concentration of Bacillus oceanicus CCTCC NO: M 20242434 cell lysate is 16 mg / mL, the FRAP value is 4.28 mmol / L.

[0016] (6) It has the ability to produce idebenone.

[0017] The second objective of this invention is to provide a microbial inoculant containing Bacillus aquaticus CCTCCNO: M 20242434.

[0018] In one embodiment of the present invention, the microbial agent uses Bacillus aureus CCTCC NO: M20242434 as the main microorganism.

[0019] In one embodiment of the present invention, the viable count of CCTCC NO: M 20242434 in the bacterial agent is 10. 7 ~10 9 CFU / mL.

[0020] In one embodiment of the present invention, the concentration range of CCTCC NO: M 20242434 in the bacterial agent is 10. 7 ~10 9 CFU / mL.

[0021] In one embodiment of the present invention, the microbial agent is obtained by preparing a seed culture of CCTCC NO: M 20242434 and then expanding it.

[0022] In one embodiment of the present invention, the bacterial agent contains live cells of the CCTCC NO: M 20242434 strain of the present invention, freeze-dried dried cells of the CCTCC NO: M 20242434 strain of the present invention, immobilized cells of the CCTCC NO: M 20242434 strain of the present invention, liquid bacterial agent of the CCTCC NO: M 20242434 strain of the present invention, solid bacterial agent of the CCTCC NO: M 20242434 strain of the present invention, or the CCTCC NO: M 20242434 strain of the present invention existing in any other form.

[0023] In one embodiment of the present invention, the microbial agent also contains other excipients.

[0024] In one embodiment of the present invention, the bacterial agent is a highly effective scavenger of DPPH·, ·OH, and ABTS. + Microbial preparations containing free radicals, possessing high reducing power, and exhibiting strong antioxidant capacity.

[0025] A third objective of this invention is to provide a product composition with antioxidant effects, wherein the preparation method of the product composition includes: adding the bacterial cell material and / or metabolites of Bacillus oceanus CCTCC NO: M 20242434 to a product matrix to obtain the product composition.

[0026] In one embodiment of the present invention, the antioxidant effect is the ability to scavenge free radicals or the ability to reduce iron ions;

[0027] In one embodiment of the present invention, the free radical is DPPH·, ·OH, or ABTS. + At least one of the following.

[0028] A fourth object of the present invention is to provide the use of Bacillus aquaticus CCTCC NO: M 20242434, the above-mentioned bacterial agent containing Bacillus aquaticus CCTCC NO: M 20242434, or the above-mentioned product composition in the preparation of products with free radical scavenging ability or antioxidant function.

[0029] In one embodiment, the product includes, but is not limited to, pharmaceuticals.

[0030] In one embodiment, the pharmaceutical product further contains pharmaceutically acceptable excipients, including but not limited to at least one of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH adjusters, antioxidants, antibacterial agents, or buffers.

[0031] In one embodiment, the medicine also contains other pharmaceutical ingredients with antioxidant capabilities.

[0032] In one embodiment, the medicine includes, but is not limited to, injections, oral liquids, tablets, capsules, drops, and sprays.

[0033] In one embodiment, the administration method includes, but is not limited to, subcutaneous injection, intravenous injection, oral administration, topical application, inhalation, local application, and sublingual administration.

[0034] The fifth object of the present invention is to provide a method for producing idebenone, the method using Bacillus aquaticus CCTCC NO: M 20242434 or an inoculum containing Bacillus aquaticus CCTCC NO: M 20242434 to produce idebenone.

[0035] A sixth object of the present invention is to provide a cosmetic comprising the bacterial lysate of Bacillus oceanus CCTCC NO: M 20242434.

[0036] In one embodiment, the cosmetic is a skincare product.

[0037] In one embodiment, the dosage form of the cosmetic can be formulated as a solution, topical ointment, emulsifiable foam, nourishing emollient, softening emollient, filler, soft water, emulsifiable cleanser, cosmetic base, fragrance, soap, liquid cleanser, bath product, sunscreen, sunscreen oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleanser, oil, foundation, emulsion foundation, wax foundation, patch, and spray.

[0038] In one embodiment, the cosmetic product further comprises at least one cosmetically acceptable carrier.

[0039] In one embodiment, the carrier may be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

[0040] Preservation of biological materials:

[0041] Bacillus oceanicus Y-3, taxonomically named Oceanobacillus sp. Y-3, the strain was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434, and the deposit address is Wuhan University, Wuhan, China.

[0042] Beneficial effects:

[0043] The *Bacillus aureus* strain CCTCC NO: M 20242434 of this invention exhibits high free radical scavenging ability, effectively scavenging DPPH free radicals, ABTS cation free radicals, and hydroxyl free radicals. The intracellular extract of *Bacillus aureus* strain CCTCC NO: M 20242434 at a concentration of 24 mg / ml showed a DPPH free radical scavenging rate of 92.81%; the intracellular extract at a concentration of 20 mg / ml showed a ABTS cation free radical scavenging rate of 99.81%; and the intracellular extract at a concentration of 10 mg / ml showed a hydroxyl free radical scavenging rate of 72.23%.

[0044] The Bacillus oceanicus strain CCTCC NO: M 20242434 of this invention has a strong iron ion reducing ability. When the concentration of CCTCC NO: M 20242434 bacterial lysate is 16 mg / mL, the FRAP value is 4.28 mmol / L.

[0045] The Bacillus oceanicus strain CCTCC NO: M 20242434 of the present invention also has the ability to produce idebenone.

[0046] Therefore, Bacillus oceanicus CCTCC NO: M 20242434 has high free radical scavenging ability and total reducing power, exhibiting high antioxidant activity; Bacillus oceanicus CCTCC NO: M 20242434 of the present invention also has the ability to produce idebenone, which has great application potential in the fields of health products and cosmetics. Attached Figure Description

[0047] Figure 1 for Oceanobacillus Colony morphology diagram of sp. Y-3;

[0048] Figure 2 for Oceanobacillus Cell morphology diagram of sp. Y-3;

[0049] Figure 3 for Oceanobacillus Growth of sp. Y-3 at different temperatures;

[0050] Figure 4 for Oceanobacillus Figures showing the growth of sp. Y-3 at different salinities;

[0051] Figure 5 for Oceanobacillus Figures showing the growth of sp. Y-3 under different carbon sources;

[0052] Figure 6 The total ion chromatogram of idebenone standard;

[0053] Figure 7 The first-order and second-order mass spectra of the idebenone standard are shown.

[0054] Figure 8 The total ion chromatogram of the sample solution;

[0055] Figure 9 The images show the primary and secondary mass spectra of the substance that elutes at 4.62 min in the sample solution. Detailed Implementation

[0056] This invention is not limited to the embodiments described herein; the embodiments are merely illustrative and not intended to limit the scope of protection of this invention. Any modifications or substitutions made to the methods, steps, or conditions of this invention without departing from the spirit and essence of this invention are within the scope of this invention.

[0057] In the following examples, unless otherwise specified, all solutions mentioned use water as the solvent.

[0058] The crude salt mentioned below is from Yuncheng Salt Lake, which originates from Yuncheng Salt Lake.

[0059] The culture medium formulations described in the following examples are as follows:

[0060] 1. Crude salt liquid culture medium: 50 g crude salt, 20 g MgSO4·7H2O, 2.0 g KCl, 3.0 g sodium citrate, 0.2 g anhydrous calcium chloride, 2.0 g yeast extract, 10.0 g peptone, add distilled water to make up to 1 L, and adjust the pH to 7.0-7.2.

[0061] 2. Crude Salt Solid Culture Medium: 50 g crude salt, 20 g MgSO4·7H2O, 2.0 g KCl, 3.0 g sodium citrate, 0.2 g anhydrous calcium chloride, 2.0 g yeast extract, 10.0 g peptone, add distilled water to a final volume of 1 L, adjust pH to 7.0-7.2, and add 15.0 g agar. Autoclave at 1×105 Pa, 121 ℃ for 30 min. After cooling the medium to 50-60 ℃, pour it into petri dishes, about 15-20 mL per dish. Allow to cool and solidify before storing for later use.

[0062] Example 1: Morphological observation of strain Y-3

[0063] 1. Source of microbial strains

[0064] The strain was isolated from black mud in the salt lake of Yuncheng, Shanxi Province. The specific isolation method is as follows:

[0065] Black mud was added to the coarse salt culture medium in a clean bench, at a volume of 5% of the medium. The mixture was thoroughly shaken and incubated in a 30°C shaker incubator for 48 hours. Afterward, it was transferred to a 30°C incubator. Once the supernatant became turbid, the bacterial culture was diluted with sterile water to a concentration of 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 Different concentrations of diluted solutions were taken at 100 μL and added to crude salt solid medium. The solutions were spread evenly using a disposable spreader and allowed to dry before being incubated upside down in a 30 ℃ constant temperature incubator. Once distinct colonies appeared on the medium, they were transferred for further culture. Strains exhibiting typical characteristics such as orange-red rounded edges, neat margins, and a glossy surface were selected and streaked onto crude salt solid medium plates for isolation. The resulting orange-red Y-3 bacteria is the strain involved in this invention. The purified strain was stored in 20% glycerol at -80 ℃ for later use.

[0066] 2. Cultivation characteristics and morphological features

[0067] The isolated Y-3 strain was streaked onto crude salt solid medium and incubated at 30 °C. Its colony morphology is shown below. Figure 1 As shown, the colonies appear as orange-red, round, opaque colonies with a raised center, and the colony edges are regular, with stable size and shape. Gram staining of the smear reveals the following bacterial morphology: Figure 2 As shown, the bacterium is Gram-positive, non-flagellated, and short rod-shaped, with a length ranging from 1.5 to 1.8 μm and a width ranging from 0.3 to 0.4 μm.

[0068] 3. Oceanobacillus sp Growth characteristics of Y-3

[0069] The growth temperature range of strain Y-3 is 30~37℃. Figure 3 It can tolerate a salinity of 0-5%. Figure 4 The optimal growth pH range is 7.0-7.2, with a growth pH range of 6.5-9.0. It is a facultative anaerobic bacterium, growing well under both anaerobic and aerobic conditions. It can utilize various sugars such as starch, glucose, sucrose, and maltose as its sole carbon source for growth. Figure 5 ).

[0070] Example 2: Classification and identification of 16S rRNA and physiological and biochemical characteristics of strain Y-3

[0071] Molecular biological identification was performed on strain Y-3 from Example 1. Its 16S rRNA gene was amplified by PCR, and sequencing was performed after passing electrophoresis. The primers used for PCR were as follows: 27F primer sequence (SEQ ID NO.1) (5'-3'): AGAGTTTGATCCTGGCTCAG and 1492R primer sequence (SEQ ID NO.2) (5'-3'): GGTTACCTTGTTACGACTT.

[0072] Sequencing results showed the sequence as shown in SEQ ID NO.3. Blast sequence alignment analysis was performed on the NCBI database, ultimately identifying strain Y-3 as *Bacillus oceanus*. Oceanobacillus (sp.), with a homology score of 99.73%.

[0073] The Bacillus oryzae Y-3 of this invention was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

[0074] Oceanobacillus The 16S rDNA sequence of sp. Y-3 is shown below (SEQ ID NO.3):

[0075]

[0076] Referring to the "Handbook of Systematic Identification of Common Bacteria", for Oceanobacillus The physiological and biochemical characteristics of sp. Y-3 were detected. The results showed that... Oceanobacillus sp. Y-3 showed positive results for catalase, starch hydrolysis, cellulose decomposition, glucose oxidation and fermentation, but was negative for protease, positive for esterase, and positive for indole.

[0077] Example 3: Oceanobacillus Preparation of sp. Y-3 bacterial lysate

[0078] Fresh culture medium: 20 g crude salt, 20 g MgSO4·7H2O, 2.0 g KCl, 3.0 g sodium citrate, 0.2 g anhydrous calcium chloride, 2.0 g yeast extract, 10.0 g peptone, add distilled water to a final volume of 1 L, and adjust the pH to 7.2.

[0079] (1) The obtained Oceanobacillus Samples were taken from cryopreservation tubes of sp. Y-3 and inoculated into crude salt liquid medium. The culture was incubated at 30 °C in a shaking incubator for 3 days. When the culture medium turned into a cloudy, opaque red liquid, single colonies were picked and inoculated onto crude salt solid medium plates for 4 days to activate the strain. Single colonies were then inoculated into Erlenmeyer flasks containing 100 mL of crude salt liquid medium and incubated at 30 °C in a shaking incubator for 3 days. OD values ​​were then measured. 600 When the OD reaches 0.5, it can be used as a crude salt seed culture. Add the cultured crude salt seed culture to a sterile conical flask containing 300 mL of the above fresh culture medium at a volume ratio of 10%, and incubate at 30 ℃ with shaking for at least 4 days, until the OD reaches 0.5. 600 The concentration is set to 0.4-0.5 to obtain a well-cultured fermentation broth.

[0080] (2) The fermentation broth obtained in step (1) (in OD) 600 (0.4 for subsequent detection) was centrifuged at 4 ℃ and 8000 rpm for 10 min, the supernatant was removed, the bacterial precipitate was washed with PBS, centrifuged again to remove the liquid phase, washed twice more with PBS, and then resuspended in 1% anhydrous ethanol (liquid culture medium volume) to obtain the bacterial solution. The bacterial solution was subjected to ultrasonic disruption for 3 cycles, centrifuged, and the supernatant was collected to obtain the ethanol extract of bacterial lysate.

[0081] (3) Combine the obtained ethanol extracts of bacterial lysate, concentrate under reduced pressure, and dry to obtain the final product. Oceanobacillus sp. Y-3 bacterial lysate was stored at -80 ℃ for later use.

[0082] Example 4: OceanobacillusDetermination of antioxidant activity of sp. Y-3 bacterial somatic lysates

[0083] 1. Determination of DPPH free radical (DPPH·) scavenging ability

[0084] First, the sample obtained in Example 3 Oceanobacillus Sp. Y-3 bacterial lysate was prepared with anhydrous ethanol at concentrations of 24, 12, 6.0, 3.0, 1.5, 0.75, 0.38, and 0.19 mg / mL. Oceanobacillus An ethanol solution of sp. Y-3 bacterial lysate was prepared; then, a 0.3 mmol / L 2,2-biphenyl-1-picrylhydrazine (DPPH) solution was prepared with anhydrous ethanol. 100 μL of the bacterial lysate ethanol solution was transferred to a 96-well plate, followed by the addition of 100 μL of DPPH-ethanol solution. The mixture was thoroughly mixed and reacted in the dark for 30 min. The absorbance (A) of the mixture at 517 nm was then measured. 样品 .

[0085] The control group used an equal volume of anhydrous ethanol instead of the sample solution (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above), and the blank group used an equal volume of anhydrous ethanol instead of the DPPH solution. The specific steps were the same as above, and the absorbance A was measured at 517 nm. 对照 and A 空白 .

[0086] Each experimental group needs to be repeated 3 times, and the average result is taken to calculate the DPPH free radical scavenging rate.

[0087] Ascorbic acid solutions of 0.08, 0.04, 0.02, and 0.01 mg / mL were used as positive controls, following the same procedures as above. The control group used an equal volume of ultrapure water instead of ascorbic acid solution, and the blank group used an equal volume of ultrapure water instead of DPPH solution. A was obtained. 样品 A 对照 and A 空白 Calculate its DPPH free radical scavenging rate.

[0088] The formula for calculating the DPPH free radical scavenging rate is shown below, and the results are shown in Table 1.

[0089] DPPH free radical scavenging rate / % = [1 - (A 样品 -A 空白 ) / A 对照 )]×100%

[0090] Table 1 Oceanobacillus DPPH free radical scavenging effect of sp. Y-3 bacterial lysate

[0091]

[0092] 2. ABTS cationic free radical (ABTS) + • Determination of scavenging ability

[0093] Weigh 6.6 mg of potassium persulfate and dissolve it in 10 mL of distilled water to obtain a potassium persulfate solution with a concentration of 2.45 mmol / L; weigh 7.7 mg of ABTS and dissolve it in 2 mL of potassium persulfate solution. After reacting in the dark for 16 h, dilute it to prepare a working solution of 2,2'-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) with an absorbance of 0.7 at 734 nm.

[0094] First, the result obtained in Example 3 Oceanobacillus Sp. Y-3 bacterial lysate was prepared with anhydrous ethanol at concentrations of 20 mg / mL, 10 mg / mL, 5.0 mg / mL, 2.5 mg / mL, 1.25 mg / mL, 0.63 mg / mL, and 0.31 mg / mL, respectively. Oceanobacillus Ethanol solutions of sp. Y-3 bacterial lysate. 10 μL of different concentrations of ethanol solutions of bacterial lysate were transferred to 96-well plates, followed by the addition of 190 μL of ABTS working solution. After reacting in the dark for 15 min, the absorbance (A) at 734 nm was measured. 样品 .

[0095] The control group used an equal volume of anhydrous ethanol instead of the sample solution (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above), and the blank group used anhydrous ethanol instead of the ABTS working solution. The specific steps were the same as above, and the absorbance A was measured at 734 nm. 对照 and A 空白 .

[0096] Each test group needs to be repeated 3 times, and the average result is taken to calculate the ABTS cationic free radical scavenging rate.

[0097] Ascorbic acid solutions at concentrations of 4.0, 2.0, 0.80, 0.12, 0.10, 0.08, 0.05, and 0.025 mg / mL were used as positive controls, following the same procedures as above. The control group used an equal volume of ultrapure water instead of ascorbic acid solution, and the blank group used an equal volume of ultrapure water instead of DPPH solution. A was obtained. 样品 A 对照 and A 空白 Calculate the ABTS cationic radical scavenging rate.

[0098] The formula for calculating the ABTS cationic free radical scavenging rate is as follows, and the results are shown in Table 2.

[0099] ABTS cationic radical scavenging rate / % = [1 - (A 样品 -A 空白 ) / A 对照 )]×100%

[0100] Table 2 Oceanobacillus ABTS cationic free radical scavenging effect of sp. Y-3 bacterial cell lysate

[0101]

[0102] 3. Determination of hydroxyl radical (·OH) scavenging ability

[0103] The result obtained in Example 3 Oceanobacillus Sp. Y-3 bacterial lysate was prepared in anhydrous ethanol at concentrations of 0.63 mg / mL, 1.25 mg / mL, 2.5 mg / mL, 5.0 mg / mL, and 10 mg / mL, respectively. Oceanobacillus Ethanol solution of sp. Y-3 bacterial lysate. Take 50 μL of each of the above concentration gradient solutions, add 50 μL each of 9 mmol / L H2O2 solution, 9 mmol / L FeSO4 solution, and 9 mmol / L salicylic acid-anhydrous ethanol solution, vortex until homogeneous, and incubate at 37 ℃ for 35 min. Measure the absorbance at 510 nm, and record it as A. 样品 .

[0104] Replace the sample solution with distilled water (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above), and follow the same steps as above, denoted as A. 空白 The H2O2 solution is replaced with distilled water, following the same steps as above, and denoted as A. 对照 Calculate the hydroxyl radical scavenging rate.

[0105] Ascorbic acid solutions with concentrations of 0.84, 0.42, 0.21, 0.10, and 0.05 mg / mL were used as positive controls, following the same procedures as above. The control group used an equal volume of ultrapure water instead of H₂O₂ solution, and the blank group used an equal volume of ultrapure water instead of ascorbic acid solution. A was obtained. 样品 A 对照 and A 空白 Calculate the hydroxyl radical scavenging rate.

[0106] Each experiment was performed in triplicate, and the average value was taken. The formula for calculating the hydroxyl radical scavenging rate is as follows, and the results are shown in Table 3.

[0107] Hydroxyl radical scavenging rate / % = [A 空白 -(A 样品 -A 对照 )] / A 空白 ×100%

[0108] Table 3 Oceanobacillus Hydroxyl radical scavenging effect of sp. Y-3 bacterial lysate

[0109]

[0110] As can be seen from Tables 1, 2, and 3, Oceanobacillus Ethanol solution of sp. Y-3 bacterial lysate has a high scavenging effect on DPPH free radicals, ABTS cationic free radicals and hydroxyl free radicals.

[0111] 4. Determination of Ferrous Reducing Power (FRAP)

[0112] The TPTZ working solution was prepared by mixing 25 mL of acetate buffer (pH=3.6), 2.5 mL of 10 mmol / L 2,4,6-tripyridyltriazine (TPTZ) solution, and 2.5 mL of 20 mmol / L ferric chloride solution.

[0113] The result obtained in Example 3 Oceanobacillus Sp. Y-3 bacterial lysate was prepared in anhydrous ethanol at concentrations of 16 mg / mL, 8.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.50 mg / mL, and 0.25 mg / mL, respectively. Oceanobacillus sp. Y-3 bacterial cell lysate ethanol solution. Add 10 μL of the above-mentioned bacterial cell lysate ethanol solution at different concentrations, followed by 190 μL of TPTZ working solution to a 96-well plate. Shake for 10 s using a microplate reader, incubate at 37 ℃ for 10 min, and measure the absorbance at 593 nm. (A) 样品 .

[0114] The control group used acetate buffer instead of TPTZ working solution, and the blank group used anhydrous ethanol instead of sample solution (sample solution refers to the ethanol solution of the bacterial lysate mentioned above). The specific steps were the same as above, and the absorbance A was measured at 593 nm. 对照 and A 空白 .

[0115] Each experimental group needs to be repeated 3 times, and the average value of the results is taken.

[0116] Ferrous sulfate standard solutions with concentrations ranging from 0.1 to 1 mmol / L were prepared, and their absorbance was measured under the same conditions. A standard curve was plotted with ferrous sulfate concentration on the x-axis and absorbance on the y-axis, yielding the regression equation: y = 0.675x + 0.019 (R²). 2 =0.999). The iron-reducing capacity of the sample was calculated based on the regression equation and expressed as the equivalent concentration of ferrous ions (FRAP value) in mmol / L.

[0117] y=A 样品 -A 对照 -A 空白 Substituting this into the equation, we obtain the value of x, which is the FRAP value.

[0118] Ascorbic acid solutions with concentrations of 11, 5.5, 1.38, 0.69, 0.34, 0.02, and 0.01 mg / mL were used as positive controls, following the same procedures as above. The control group used acetate buffer instead of TPTZ working solution, and the blank group used an equal volume of ultrapure water instead of ascorbic acid solution. A was obtained. 样品 A 对照 and A 空白 Calculate its FRAP value.

[0119] The results are shown in Table 4.

[0120] As shown in Table 4, when Oceanobacillus When the concentration of the ethanol solution of sp. cell lysate was 16 mg / mL, its FRAP value was 4.28 mmol / L, which is close to the highest FRAP value of vitamin C (4.68 mmol / L), proving that... Oceanobacillus sp. bacterial lysates have a high reducing ability.

[0121] Table 4 Oceanobacillus Iron reducing power of sp. Y-3 bacterial lysate

[0122]

[0123] Example 5: Oceanobacillus Qualitative analysis of the idebenone-producing capacity of sp. Y-3

[0124] Qualitative and quantitative analysis of idebenone in Oceanobacillus sp. Y-3 bacterial lysates was performed using ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF / MS).

[0125] Liquid chromatography conditions: Column: ACQUITY UPLC BEH C 18 Column (2.1 mm × 100 mm, 1.7 μm); mobile phase: A is 0.1% formic acid-water solution, B is acetonitrile; gradient elution program is shown in Table 5, flow rate is 0.3 mL / min; diode array (PDA) detector; column temperature 45 ℃; injection volume 5.0 μL.

[0126] Table 5 Gradient elution program

[0127]

[0128] Mass spectrometry conditions: positive ion mode, electrospray ionization source, multiple reaction monitoring mode, ion source temperature 100 ℃, capillary voltage 3.5 kV, cone voltage 20 V, desolvation gas temperature 400 ℃, IMS gas flow rate 24 mL / min, collision energy 6 / 20 eV.

[0129] The total ion chromatogram of the idebenone standard solution is shown below. Figure 6 As shown, the peak at 4.62 min is idebenone, and its first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) are shown below. Figure 7 As shown, the maximum proton number m / z is 339.2154, which is [M+H]. + Ion peak.

[0130] A series of standard working solutions with concentrations of 1.25, 2.5, 5, and 10 μg / mL, prepared from idebenone standard solutions, were injected and analyzed. A regression equation was plotted with idebenone concentration on the x-axis and peak area on the y-axis. Analysis under the aforementioned chromatographic conditions showed a good linear relationship between peak area and mass concentration in the range of 0.5–8.0 μg / mL. Y =29753.2598 X – 3710.2124 (R 2 =0.997). The content of idebenone in the sample was then calculated using the above standard curve.

[0131] Obtain 500 mL of cultured product according to step (1) of Example 3. Oceanobacillus The sp. Y-3 fermentation broth was then processed according to steps (2) to (3) of Example 3 to finally obtain Oceanobacillus 65.6 mg of sp. Y-3 bacterial lysate was added to 1 mL of methanol and reconstituted by sonication. After centrifugation at 8000–9000 rpm, the supernatant was collected to obtain the sample for testing. Using the above chromatographic and mass spectrometric conditions, the sample was injected into the chromatograph for chromatographic separation. The chromatographic eluent was directly introduced into the mass spectrometer for detection, and qualitative and quantitative analysis of idebenone was performed using mass spectrometry.

[0132] Oceanobacillus The total ion chromatogram of sp. Y-3 bacterial lysate solution is shown below. Figure 8 As shown, the first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) of the substance eluting at 4.62 min are as follows. Figure 9 As shown, the maximum proton number m / z is 339.2187, which is [M+H]. + Ion peak. Figure 8 , 9 and Figure 6 , 7 The comparison showed that the peak elution time of the substance in the sample at 4.62 min was consistent with that of the idebenone standard, and [M+H]... + The ion peak was consistent with that of idebenone standard, therefore the substance eluting at 4.62 min was identified as idebenone. OceanobacillusThe sp. Y-3 bacterial lysate solution contains idebenone.

[0133] Example 6: Oceanobacillus Quantitative analysis of sp. Y-3's ability to produce idebenone

[0134] Fresh culture medium: 20 g crude salt, 20 g MgSO4·7H2O, 2.0 g KCl, 3.0 g sodium citrate, 0.2 g anhydrous calcium chloride, 2.0 g yeast extract, 10.0 g peptone, add distilled water to a final volume of 1 L, and adjust the pH to 7.2.

[0135] The crude salt seed culture prepared in Example 3 was added to a sterile Erlenmeyer flask containing 300 mL of the above-mentioned fresh culture medium (salinity 2%, pH 7.2) at a volume ratio of 10%, and incubated in a shaking incubator at 30 ℃ for 5 days. OD 600 The concentration was set to 0.7-0.8 to obtain a well-cultured fermentation broth. The obtained fermentation broth (expressed as OD...) 600 (0.7 for subsequent detection) was centrifuged and washed according to step (2) of Example 3 to obtain ethanol extract of bacterial lysate. The obtained ethanol extracts of bacterial lysate were combined, concentrated under reduced pressure, and then diluted to 1 mL with methanol.

[0136] The determination method and standard curve of Example 5 were used to obtain the results. Oceanobacillus The idebenone content in the ethanol extract of sp. Y-3 bacterial cell lysate was 81.4 μg / L. Due to... Oceanobacillus The mass of sp. Y-3 cells after freeze-drying was 0.1809 g. The calculated values ​​were... Oceanobacillus The ability of sp. Y-3 strain to produce idebenone is 0.45 μg / g.

[0137] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Bacillus aureus ( Oceanobacillus sp.)Y-3, characterized in that, The aforementioned Bacillus aquaticus was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

2. A microbial inoculant, characterized in that, The bacterial agent contains Bacillus oceanicus Y-3 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent uses Bacillus oryzae Y-3 as the main microorganism.

4. The microbial agent according to claim 2, characterized in that, The bacterial agent contains live cells of Bacillus oryzae Y-3, freeze-dried Bacillus oryzae Y-3, immobilized Bacillus oryzae Y-3 cells, liquid Bacillus oryzae Y-3, solid Bacillus oryzae Y-3, or Bacillus oryzae Y-3 in any other form.

5. A product composition with antioxidant properties, characterized in that, The method for preparing the product composition includes: adding live bacteria of Bacillus oryzae Y-3 as described in claim 1 or its lysate to a product matrix to obtain the product composition, wherein the product composition is a pharmaceutical product.

6. The use of Bacillus oryzae Y-3 of claim 1, a bacterial agent containing Bacillus oryzae Y-3 of claim 1, or the product composition of claim 5 in the preparation of a product having free radical scavenging ability or antioxidant function, wherein the product is a pharmaceutical product.

7. The application according to claim 6, characterized in that, The medicine also contains pharmaceutically acceptable excipients.

8. The application according to claim 7, characterized in that, The excipients include at least one of the following: diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, cosolvent, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, or buffer.

9. The application according to claim 8, characterized in that, The medicines include injections, oral liquids, tablets, capsules, pellets, and sprays.

10. A method for producing idebenone, characterized in that, The method utilizes the Bacillus oryzae Y-3 described in claim 1 to produce idebenone.

11. A cosmetic product, characterized in that, The cosmetic product contains the bacterial lysate of Bacillus oryzae Y-3 as described in claim 1.

12. The cosmetic product according to claim 11, characterized in that, The cosmetics mentioned are skincare products.

13. The cosmetic product according to claim 12, characterized in that, The cosmetic also contains at least one cosmetically acceptable carrier.

14. The cosmetic product according to claim 13, characterized in that, The carrier is oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

Citation Information

Patent Citations

  • Moisturizing cream prepared from lysate extract produced by fermentation of bacillus subtilis

    CN120360923A