Application of bone marrow SELENOP positive macrophage and GAS6-AXL axis in bone marrow hematopoiesis regulation

Abstract

The invention discloses an application of a bone marrow SELENOP positive macrophage and a GAS6-AXL axis in bone marrow hematopoiesis regulation and control. The invention provides a bone marrow SELENOP + macrophage (the immunophenotype is CD14 + CD68 + SELENOP +) and an application of the macrophage in diagnosing whether a subject has a potential risk of hematopoietic injury or not. The invention also provides an application of a substance capable of activating a GAS6-AXL signal axis in preparation of a product for treatment or adjuvant treatment of bone marrow hematopoietic injury diseases. The novel bone marrow SELENOP + macrophage subgroup identified by the invention is of great significance to reveal a new subtype of bone marrow macrophages and the effect of the bone marrow macrophages in promoting normal bone marrow hematopoietic reconstruction, and is helpful to further explore a new target for treating bone marrow hematopoietic injury diseases; therefore, the method is beneficial to patients with implantation malfunction and other bone marrow hematopoietic injury diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of bone marrow SELENOP-positive macrophages and the GAS6-AXL axis in bone marrow hematopoietic regulation. Background Art

[0002] Macrophages are an important component of the innate immune system, with powerful phagocytic and antigen-presenting capabilities, and play important roles in physiological processes such as inflammation, defense, repair, and metabolism. In recent years, more and more studies have found that the phenotypes and functions of macrophages are highly heterogeneous, and can respond to complex microenvironmental stimuli to make regulatory responses, thus polarizing into different types of macrophage subsets. Among them, classically activated pro-inflammatory macrophages (M1) and alternatively activated anti-inflammatory macrophages (M2) are typical representatives of macrophage polarization [Reference: PMID 27813830]. However, the roles of macrophages with different polarization types in hematopoietic regulation are still unclear.

[0003] Poor engraftment function after transplantation is not only one of the important reasons for transplantation failure, but also an ideal disease model for studying hematopoietic injury regulation. Hematopoietic stem cell transplantation is an effective method for treating myeloid failure diseases such as hematological malignancies and aplastic anemia. The homing and engraftment of donor hematopoietic stem cells in the patient's body and their interaction with the patient's bone marrow microenvironment to reconstruct the hematopoietic and immune systems are the keys to the success of hematopoietic stem cell transplantation. In recent years, with the continuous improvement and development of the clinical technical system of hematopoietic stem cell transplantation, most patients can rapidly achieve stable donor-derived hematopoietic reconstitution after transplantation. However, poor hematopoietic reconstitution after transplantation, including delayed platelet engraftment and poor engraftment function, remains a serious complication of hematopoietic stem cell transplantation, and there is no effective clinical prevention and treatment method, which is one of the important reasons for the treatment failure of blood disease patients. Poor engraftment function refers to the failure to achieve stable engraftment of donor-derived hematopoietic cells in more than two of the three lineages in the patient's peripheral blood at +28 days after transplantation on the premise of complete donor chimerism (neutrophils ≤ 0.5×10 9 / L, platelets ≤ 20×10 9 / L and / or hemoglobin ≤ 70 g / L). Delayed platelet engraftment refers to the situation where neutrophils and hemoglobin have achieved stable engraftment (neutrophils > 0.5×10 9 / L, hemoglobin > 70 g / L) at +60 days after transplantation on the premise of complete donor chimerism, while platelets still continue to be lower than 20×10 9 / L or dependent on platelet transfusion. Patients with poor engraftment function are prone to fatal infections due to lack of granulocytes, and persistent thrombocytopenia can easily lead to severe bleeding. In short, poor hematopoietic reconstitution after transplantation is one of the important reasons for transplantation failure. Patients often suffer from a variety of serious transplantation complications. Due to the lack of effective clinical prevention and treatment strategies, the effect of symptomatic treatment is poor, the patient's hospitalization time is prolonged, and the mortality rate is increased, which not only seriously endangers the life, health and quality of life of the Chinese people, but also brings huge economic burden and social pressure to our country. Therefore, the in-depth elucidation of the pathogenesis of poor hematopoietic reconstitution after transplantation and the establishment of new prevention and treatment strategies are important clinical scientific issues that need to be urgently solved in the field of hematopoietic stem cell transplantation.

[0004] The rapid development of single-cell transcriptome sequencing technology and its analysis algorithms has provided us with new technologies to comprehensively characterize the transcriptome maps of cell subpopulations and the interactions between cells at the single-cell scale, making it possible to more accurately analyze the heterogeneity of cell subpopulations. Summary of the invention

[0005] The purpose of the present invention is to provide application of bone marrow SELENOP positive macrophages and GAS6-AXL axis in bone marrow hematopoiesis regulation.

[0006] In a first aspect, the present invention claims a macrophage.

[0007] The macrophages claimed in the present invention are isolated (ex vivo) macrophages, specifically bone marrow SELENOP + Macrophages, whose immunophenotype is CD14 + CD68 + SELENOP + .

[0008] Bone marrow SELENOP claimed in the present invention + Macrophages (immunophenotype CD14 + CD68 + SELENOP + ) have stronger phagocytic ability and stronger hematopoietic support function than macrophages reported in the prior art.

[0009] In the second aspect, the present invention claims to protect bone marrow SELENOP + Use of macrophages and / or substances capable of activating the GAS6-AXL signaling axis in any of the following:

[0010] (A1) Preparation of products for the treatment or adjuvant treatment of bone marrow hematopoietic damage diseases;

[0011] (A2) Preparation of products for improving or delaying the progression of bone marrow hematopoietic damage diseases;

[0012] (A3) Preparing a product for repairing damaged bone marrow macrophages;

[0013] (A4) Preparing a product for reducing complications in patients with blood diseases;

[0014] The bone marrow SELENOP + macrophages are isolated (ex vivo) bone marrow SELENOP + macrophages, and their immunophenotype is CD14 + CD68 + SELENOP + .

[0015] In the GAS6-AXL signaling axis, the GAS6 protein is a ligand with an agonistic effect, and the AXL protein is the corresponding receptor.

[0016] Furthermore, the substance capable of activating the GAS6-AXL signaling axis can be an AXL receptor agonist.

[0017] In one embodiment of the present invention, the AXL receptor agonist is the GAS6 protein.

[0018] Among them, the product can be a drug.

[0019] In the third aspect, the present invention claims the application of a substance capable of activating the GAS6-AXL signaling axis in any of the following:

[0020] (B1) Preparing a product for enhancing the phagocytic ability of specific bone marrow macrophages;

[0021] (B2) Enhancing the phagocytic ability of specific bone marrow macrophages in vitro;

[0022] (B3) Preparing a product for enhancing the hematopoietic support ability of specific bone marrow macrophages;

[0023] (B4) Enhancing the hematopoietic support ability of specific bone marrow macrophages in vitro;

[0024] (B5) Preparing a product for enhancing the promoting effect of specific bone marrow macrophages on the colony-forming ability of CD34 + cells;

[0025] (B6) Enhancing the promoting effect of specific bone marrow macrophages on the colony-forming ability of CD34 + cells in vitro;

[0026] (B7) Preparing a product for enhancing the promoting effect of specific bone marrow macrophages on the proliferation ability of CD34 + cells;

[0027] (B8) Enhance the promoting effect of specific bone marrow macrophages on the proliferation ability of CD34 + cells in vitro;

[0028] (B9) Prepare a product for enhancing the inhibitory effect of specific bone marrow macrophages on the apoptosis ability of CD34 + cells;

[0029] (B10) Enhance the inhibitory effect of specific bone marrow macrophages on the apoptosis ability of CD34 + cells in vitro;

[0030] The specific bone marrow macrophages are bone marrow macrophages derived from patients with bone marrow hematopoietic injury diseases or bone marrow macrophages from healthy people treated with an AXL receptor inhibitor or bone marrow macrophages from healthy people after targeted knockout or knockdown of AXL gene expression.

[0031] The bone marrow SELENOP + macrophage immunophenotype is CD14 + CD68 + SELENOP + .

[0032] Further, the substance capable of activating the GAS6 - AXL signaling axis can be an AXL receptor agonist.

[0033] In one embodiment of the present invention, the AXL receptor agonist is GAS6 protein.

[0034] In one embodiment of the present invention, the AXL receptor inhibitor is Bemcentinib. Correspondingly, the bone marrow macrophages from healthy people treated with the AXL receptor inhibitor are bone marrow macrophages from healthy people treated with 1.5 μM Bemcentinib for 1 day.

[0035] In one embodiment of the present invention, the CD34 + cells in (B5)-(B10) are from healthy people.

[0036] In (B5) and (B6), the colonies may include all or part of the following: colony-forming unit erythroid (CFU-E), burst-forming unit erythroid (BFU-E), colony-forming unit granulocyte-macrophages (CFU-GM), colony-forming unit-granulocyte, erythroid, macrophage and megakaryocyte (CFU-GEMM).

[0037] Wherein, the product may be a drug or a reagent.

[0038] In a fourth aspect, the present invention claims any one of the following methods:

[0039] Method I: A method for enhancing the phagocytic ability of specific bone marrow macrophages in vitro, which may include the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, so as to improve the phagocytic ability of the specific bone marrow macrophages.

[0040] This method is also a method for constructing a cell model of specific bone marrow macrophages with enhanced phagocytic ability in vitro.

[0041] Method II: A method for enhancing the hematopoietic support ability of specific bone marrow macrophages in vitro, which may include the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, so as to enhance the hematopoietic support ability of the specific bone marrow macrophages.

[0042] This method is also a method for constructing a cell model of specific bone marrow macrophages with enhanced hematopoietic support ability in vitro.

[0043] Method III: A method for enhancing the promoting effect of specific bone marrow macrophages on the colony-forming ability of CD34 + cells in vitro, which may include the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, so as to promote the colony formation of CD34 + cells.

[0044] This method is also a method for constructing in vitro a [CD34]+ Method for a cell model of specific bone marrow macrophages with enhanced promotion of colony-forming ability of cells.

[0045] Method IV: A method for enhancing the promotion of the proliferation ability of specific bone marrow macrophages on CD34 + cells in vitro, which may include the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, thereby promoting the proliferation of CD34 + cells.

[0046] This method is also a method for constructing a cell model of specific bone marrow macrophages with enhanced promotion of the proliferation ability of CD34 + cells in vitro.

[0047] Method V: A method for enhancing the inhibitory effect of specific bone marrow macrophages on the apoptosis ability of CD34 + cells in vitro, including the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, thereby inhibiting the apoptosis of CD34 + cells.

[0048] This method is also a method for constructing a cell model of specific bone marrow macrophages with enhanced inhibitory effect on the apoptosis ability of CD34 + cells in vitro.

[0049] In the above Methods I - V, the specific bone marrow macrophages can be bone marrow macrophages derived from patients with bone marrow hematopoietic injury diseases or bone marrow macrophages from healthy people treated with an AXL receptor inhibitor or bone marrow macrophages from healthy people after targeted knockout or knockdown of AXL expression.

[0050] Furthermore, the substance capable of activating the GAS6-AXL signaling axis can be an AXL receptor agonist.

[0051] In one embodiment of the present invention, the AXL receptor agonist is GAS6 protein. Correspondingly, treating the specific bone marrow macrophages cultured in vitro with GAS6 protein is treating the specific bone marrow macrophages with GAS6 protein at a concentration of 500 ng / ml for 1 day.

[0052] In one embodiment of the present invention, the AXL receptor inhibitor is Bemcentinib. Accordingly, the bone marrow macrophages from healthy individuals treated with the AXL receptor inhibitor are bone marrow macrophages from healthy individuals treated with 1.5 μM Bemcentinib for 1 day.

[0053] In Methods III - V, in one embodiment of the present invention, the CD34 + cells are from healthy individuals.

[0054] Furthermore, the co - culture is to co - culture the treated specific bone marrow macrophages with the CD34 + cells for 4 days. Then, harvest the CD34 + cells after co - culture and continue to culture to observe the colony formation or detect the proliferation or apoptosis of the CD34 + cells.

[0055] Among them, the colonies may include all or part of the following: colony - forming unit erythroid (CFU - E), burst - forming unit erythroid (BFU - E), colony - forming unit granulocyte - macrophages (CFU - GM), colony - forming unit - granulocyte, erythroid, macrophage and megakaryocyte (CFU - GEMM).

[0056] Enhancing the phagocytosis ability, hematopoietic support ability, promoting effect on the colony formation ability of CD34 + cells, and inhibitory effect on the apoptosis ability of CD34 + cells of specific bone marrow macrophages in vitro has great application value in the industry, which can be specifically reflected in the following aspects (but not limited to this):

[0057] (1) Cell therapy industry

[0058] Hematopoietic stem cell transplantation: enhancing the hematopoietic support ability of the specific bone marrow macrophages and the CD34 +The promotion of the colony-forming ability of cells can significantly improve the success rate of hematopoietic stem cell transplantation. Before transplantation, co-culturing these enhanced specific macrophages with hematopoietic stem cells can help the hematopoietic stem cells better expand in vitro and maintain their stemness, enabling faster recovery of hematopoietic function after transplantation, reducing the time of hematopoietic hypofunction in patients, and reducing the risk of complications such as infection. Inhibiting the apoptosis ability of CD34 + cells contributes to preserving more viable hematopoietic stem cells, improving the quality and quantity of stem cells, thereby enhancing the transplantation effect and improving the prognosis of patients.

[0059] Immune cell therapy: Enhancing the phagocytic ability of the specific bone marrow macrophages enables them to better recognize and eliminate tumor cells or pathogens. In immune cell therapy, such as CAR-T cell therapy, etc., when used in combination with modified immune cells, it can create a microenvironment more conducive to the function of immune cells and improve the effect of immune cell therapy.

[0060] (2) Tissue engineering and regenerative medicine industry

[0061] Constructing tissue engineering scaffolds: Combining the specific bone marrow macrophages with enhanced functions with biomaterials to construct tissue engineering scaffolds. Macrophages can secrete various growth factors and cytokines, promoting cell adhesion, proliferation, and differentiation within the scaffolds, especially having a guiding effect on the differentiation of CD34 + cells into specific cell types, which helps construct tissues and organs closer to the physiological state for tissue repair and regeneration.

[0062] Promoting tissue repair: During the process of tissue injury repair, implanting biomaterials or cell preparations containing macrophages with enhanced functions can accelerate the subsidence of the inflammatory response at the injury site, promote the clearance of necrotic tissue, and at the same time provide a good microenvironment for the homing and differentiation of hematopoietic stem cells, attracting CD34 + cells to migrate to the injury site, promoting angiogenesis and tissue regeneration, and improving the quality and speed of tissue repair.

[0063] Fifthly, the present invention claims the application of a substance for detecting bone marrow SELENOP + macrophages in any of the following:

[0064] (C1) Preparing a product for diagnosing or assisting in diagnosing bone marrow hematopoietic injury diseases;

[0065] (C2) Preparing a product for differentiating or assisting in differentiating patients with bone marrow hematopoietic injury diseases from healthy people;

[0066] The immune phenotype of the bone marrow SELENOP + macrophages is CD14 + CD68+ SELENOP + 。

[0067] Among them, the substance for detecting bone marrow SELENOP + macrophages can be a substance that can directly bind to the bone marrow SELENOP + macrophages as a target, such as an antibody combination against CD14, CD68, and SELENOP.

[0068] Among them, the product can be a reagent.

[0069] In a sixth aspect, the present invention claims the use of a specific substance in any of the following:

[0070] (C1) Preparing a product for diagnosing or assisting in diagnosing bone marrow hematopoietic injury diseases;

[0071] (C2) Preparing a product for differentiating or assisting in differentiating patients with bone marrow hematopoietic injury diseases from healthy people;

[0072] The specific substance is any of the following: a substance capable of detecting the intensity of the GAS6-AXL signaling axis in bone marrow SELENOP + macrophages, a substance capable of detecting the expression level of AXL in bone marrow SELENOP + macrophages, a substance capable of detecting the proportion of AXL-positive cells in bone marrow SELENOP + macrophages, a substance capable of detecting the proportion of AXL-positive bone marrow SELENOP + macrophages in bone marrow mononuclear cells, a substance capable of detecting bone marrow SELENOP + AXL in macrophages + CD163 + the proportion of cells. The specific substance can be a target-specific primer or antibody, etc.

[0073] Among them, the product is a reagent.

[0074] In a seventh aspect, the present invention claims any of the following methods:

[0075] Method VI: A method for constructing a bone marrow macrophage model with reduced phagocytic ability, comprising the following steps: treating bone marrow macrophages derived from healthy people with an AXL receptor inhibitor to obtain a bone marrow macrophage model with reduced phagocytic ability.

[0076] Method VII: A method for constructing a bone marrow macrophage model with reduced hematopoietic support ability, comprising the following steps: treating bone marrow macrophages derived from healthy people with an AXL receptor inhibitor to obtain a bone marrow macrophage model with reduced hematopoietic support ability.

[0077] Method VIII: A method for constructing a macrophage model with reduced hematopoietic support ability, comprising the following steps: knocking down the expression of AXL in macrophages to obtain a macrophage model with reduced hematopoietic support ability.

[0078] Method IX: A method for constructing an animal model with reduced bone marrow hematopoietic ability, comprising the following steps: specifically knocking down the expression of AXL gene in animal bone marrow macrophages to obtain an animal model with reduced bone marrow hematopoietic ability.

[0079] Furthermore, in method VI and method VII, in one embodiment of the present invention, the AXL receptor inhibitor is Bemcentinib. Accordingly, treating bone marrow macrophages from healthy subjects with the AXL receptor inhibitor is treating bone marrow macrophages from healthy subjects with Bemcentinib at a concentration of 1.5 μM for 1 day.

[0080] Further, in method VIII, in an embodiment of the present invention, the knockdown of AXL expression in macrophages is achieved by infecting the macrophages with an AXL knockdown lentivirus. The AXL knockdown lentivirus carries shRNA for knocking down AXL, and the sequence of the shRNA is GATCCGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTTG (corresponding to shRNA2 in the embodiment). The macrophages are macrophages induced from THP-1 cell line.

[0081] Furthermore, in method IX, the animal is a mammal, such as a mouse. In one embodiment of the present invention, the animal model is a bone marrow macrophage AXL-specific knockdown mouse model constructed using adeno-associated virus (macrophage-specific) and F4 / 80 macrophage-specific promoter (as shown in SEQ ID No. 1).

[0082] In addition to being used as a drug screening model to screen drugs that can reverse the corresponding phenotype, the bone marrow macrophage model and / or animal model constructed using the above method also has the following application values ​​(but not limited to):

[0083] (1) Simulating disease states: Many blood system diseases and immune diseases may be accompanied by abnormal bone marrow macrophage function. Constructing such a model with reduced function can simulate the functional changes of macrophages in disease states and help researchers gain a deeper understanding of the mechanisms of disease occurrence and development. For example, in diseases such as aplastic anemia, bone marrow macrophage function may be defective. This model can be used to study how reduced macrophage function affects the hematopoietic microenvironment, thereby leading to impaired hematopoietic function, providing important clues for the pathophysiological study of the disease.

[0084] (2) Evaluating the risks of cell therapy: During cell therapy, such as hematopoietic stem cell transplantation or adoptive immunotherapy with macrophages, it is crucial to understand the impact of reduced macrophage function on the therapeutic effect. This model can be used to evaluate the risks that cell therapy may face when macrophage function is not ideal, such as delayed hematopoietic reconstitution and the risk of graft-versus-host disease, etc., so as to provide a reference for optimizing cell therapy regimens and improving the safety and effectiveness of treatment.

[0085] In an eighth aspect, the present invention claims the use of the bone marrow macrophage model or animal model constructed by the method described in the seventh aspect above in any of the following:

[0086] (D1) Screening drugs that can treat or assist in treating bone marrow hematopoietic injury diseases;

[0087] (D2) Screening drugs that can improve or delay the progression of bone marrow hematopoietic injury diseases;

[0088] (D3) Screening drugs that can repair damaged bone marrow macrophages;

[0089] (D4) Screening drugs that can reduce the complications of blood disease patients.

[0090] In a ninth aspect, the present invention claims a kit product for screening drugs, including the following:

[0091] (E1) The bone marrow macrophage model or animal model constructed by the method described in the seventh aspect above;

[0092] (E2) A positive control; the positive control is a substance that can activate the GAS6-AXL signaling axis or a substance that can increase the expression level of the AXL receptor;

[0093] The drug is any of the following: a drug that can treat or assist in treating bone marrow hematopoietic injury diseases, a drug that can improve or delay the progression of bone marrow hematopoietic injury diseases, a drug that can repair damaged bone marrow macrophages, a drug that can reduce the complications of blood disease patients.

[0094] Furthermore, the substance that can activate the GAS6-AXL signaling axis can be an AXL receptor agonist.

[0095] In an embodiment of the present invention, the AXL receptor agonist is GAS6 protein.

[0096] In an embodiment of the present invention, the substance that can increase the expression level of the AXL receptor is an overexpression lentivirus carrying the AXL receptor encoding gene.

[0097] In the above related aspects, the myelopoietic injury diseases may be selected from any of the following: poor hematopoietic reconstitution after hematopoietic stem cell transplantation (such as poor engraftment function after transplantation), aplastic anemia, and poor hematopoietic reconstitution after remission of leukemia by chemotherapy (such as myelosuppression after chemotherapy).

[0098] In the above related aspects, the complication of the hematological disease patient is bone marrow macrophage injury.

[0099] In the above related aspects, the bone marrow macrophage injury may be manifested as all or part of the following: bone marrow SELENOP + decrease in the number of macrophages, weakening of the phagocytic ability of bone marrow macrophages, inhibition of the GAS6-AXL signaling axis in bone marrow macrophages, and decline in the hematopoietic support ability of bone marrow macrophages.

[0100] Among them, the immune phenotype of the bone marrow SELENOP + macrophages is CD14 + CD68 + SELENOP + .

[0101] In the tenth aspect, the present invention also claims to protect a pharmaceutical composition.

[0102] The pharmaceutical composition claimed by the present invention comprises (or is): (1) a substance capable of increasing the expression level of the AXL receptor; and (2) an AXL receptor agonist.

[0103] In an embodiment of the present invention, the substance capable of increasing the expression level of AXL is an overexpressing lentivirus carrying the AXL receptor-encoding gene.

[0104] In an embodiment of the present invention, the AXL receptor agonist is GAS6 protein.

[0105] This pharmaceutical composition can solve the abnormality of bone marrow macrophages caused by the decrease of AXL.

[0106] Among them, the abnormality of the bone marrow macrophages is SELENOP + and / or abnormal function of the GAS6-AXL axis. Specifically, it can be, for example: aplastic anemia, hematopoietic injury after chemotherapy (such as myelosuppression after chemotherapy), bone marrow macrophage injury / abnormality with poor hematopoietic reconstitution after hematopoietic stem cell transplantation, bone marrow macrophage injury / abnormality complicated with diabetes, or ischemic bone marrow macrophage injury / abnormality. The ischemic disease is, for example, an ischemic disease such as ischemic heart disease or progressive atherosclerosis.

[0107] After treatment with the pharmaceutical composition of the present invention, one or more of the following conditions may be presented in the bone marrow microenvironment of the subject: reduced damage to bone marrow macrophages, increased hematopoietic tissue, or improved hematopoietic recovery response. In the present invention, when referring to a subject, the subject may be a human subject or a mammalian subject (such as a mouse subject). The bone marrow macrophages of the human subject have a CD14 + phenotype. The bone marrow macrophages of the mouse subject have an F4 / 80 + phenotype.

[0108] In the above relevant aspects, the present invention does not particularly limit the use concentration or dosage of the AXL receptor agonist, as long as it can achieve, for example, a favorable response and the subject can tolerate or accept it. Those skilled in the art are capable of selecting a suitable concentration according to the specific circumstances under the guidance of the disclosure of the present application.

[0109] In some specific embodiments, the subject is a patient with aplastic anemia, a patient with hematopoietic injury after chemotherapy (such as myelosuppression after chemotherapy), or a patient with poor hematopoietic reconstitution after transplantation (such as poor engraftment function after transplantation).

[0110] The present invention's research found that reduced SELENOP protein expression and / or inhibition of the GAS6-AXL signaling axis are important characteristics of bone marrow macrophages in patients with aplastic anemia, poor hematopoietic reconstitution after transplantation, and hematopoietic suppression in the bone marrow after chemotherapy. SELENOP + deletion and / or AXL deletion can be used as biomarkers for the status of bone marrow macrophages to diagnose whether the bone marrow macrophages of a subject, such as a patient, are normal, and AXL receptor agonists can be used to treat bone marrow hematopoietic injury diseases. Bone marrow hematopoietic injury diseases include poor hematopoietic reconstitution after hematopoietic stem cell transplantation, aplastic anemia, poor hematopoietic reconstitution after remission of leukemia after chemotherapy, etc. These diseases have high medical costs and high mortality rates, and currently, the efficacy of bone marrow hematopoietic injury diseases is limited. Therefore, further in-depth clarification of the pathogenesis of such diseases and the establishment of new prevention and treatment strategies are important clinical scientific problems that need to be solved urgently. The present invention uses single-cell transcriptome sequencing technology and in vitro functional experiments, taking the bone marrow microenvironment of patients with poor engraftment function as a representative research model, and discovers a class of bone marrow SELENOP + macrophages with hematopoietic regulation function and clarifies its key biological property, the GAS6-AXL axis. Activating the GAS6-AXL axis of macrophages can assist in restoring normal bone marrow hematopoietic function. The practical significance lies in: providing a new perspective for the study of the pathogenesis of bone marrow hematopoietic injury diseases represented by poor engraftment function and potentially providing a new approach for their clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1For bone marrow SELENOP + Discovery of macrophages. Among them, A is the flow chart of single-cell transcriptome sequencing from sample acquisition to library construction and identification; B is the visual display of each cell subset; C are the characteristic cell markers of each subset, where bone marrow SELENOP + Macrophages are characterized by high expression of CD14, CD68, and SELENOP; D is the distribution of each cell subset in patients with poor graft function (PGF), patients with good graft function (GGF), and healthy donors; E is the pseudotime analysis of myeloid cells, which verifies the development process from HSC to myeloid progenitor cells, and then to mature neutrophils and mononuclear macrophages; F is a heat map showing the expression of characteristic genes of each cell subset; G is the comparison of the cell proportions of the mononuclear macrophage subset (labeled as MD in the figure) in PGF patients, GGF patients, and healthy donors; H is the expression of the characteristic gene SELENOP, the classical macrophage markers CD14 and CD68, and the classical M2 marker CD163; I is a bar chart showing the proportion of bone marrow SELENOP + Macrophage subsets in PGF patients; J are the differential genes of the SELENOP + Cell subsets in PGF patients relative to those in GGF patients or HD; K is the GO enrichment analysis of the functional differences of the SELENOP + Cell subsets in PGF patients relative to GGF or HD.

[0112] Figure 2 For bone marrow SELENOP + Discovery of the key biological properties of bone marrow SELENOP + Macrophages. Among them, A is a bubble chart showing the ligand-receptor pairs that are increased in bone marrow SELENOP + Macrophages in GGF patients (left) and HD (right) compared to PGF patients; B is the cell relationship pair with the GAS6-AXL interaction relationship in GGF and HD, which is absent in PGF; C is the expression of GAS6, AXL, MERTK, and TYRO3 in each cell subset; D is a pie chart showing the proportions of AXL-positive, MERTK-positive, AXL- and MERTK-double-positive, and double-negative cells in bone marrow SELENOP + Macrophages in PGF patients, GGF patients, and HD; E are the differential genes among AXL-positive, MERTK-positive, AXL- and MERTK-double-positive, and double-negative cells in bone marrow SELENOP

[0113] Figure 3 For bone marrow SELENOP +Immunological identification of macrophages and in vitro pharmacological experiments clarified the effect of the GAS6-AXL axis on the phagocytic function of bone marrow macrophages. Among them, A is the gating strategy of flow cytometry for bone marrow macrophages (CD14 + CD68 + SELENOP + ) and biological property-related markers (CD163, AXL, MERTK); B is the proportion of AXL-positive cells in SELENOP + macrophages detected by flow cytometry in the bone marrow of PGF patients, GGF patients and HD; C is the proportion of SELENOP + AXL + macrophages in bone marrow mononuclear cells detected by flow cytometry in the bone marrow of PGF patients, GGF patients and HD; D is the expression level of AXL in SELENOP + macrophages in the bone marrow of PGF patients, GGF patients and HD detected by flow cytometry, and the evaluation standard is the mean fluorescence intensity (Mean Fluorescence Intensity, MFI); E is the proportion of CD163 + AXL + cells in SELENOP + macrophages detected by flow cytometry in the bone marrow of PGF patients, GGF patients and HD; F is the proportion of CD163-positive cells in AXL-positive and AXL-negative cells in the bone marrow of HD; G is the CD163 expression level in AXL-positive and AXL-negative cells, and the evaluation standard is the mean fluorescence intensity (Mean Fluorescence Intensity, MFI); H is the SELENOP + macrophages in the bone marrow and their biological properties (CD14 + SELENOP + CD163 + AXL +) Identification; I is the experimental flow chart for detecting the phagocytic ability of bone marrow macrophages; J is a typical graph showing the phagocytic function of bone marrow macrophages from healthy donors after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib); K is an enlarged typical graph of the phagocytic function of HD bone marrow macrophages; L is the phagocytic function of bone marrow macrophages from healthy donors after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib). In J and L, the Control group (or labeled C) is the co-culture of bone marrow macrophages treated only with the control solvent (DMSO) and apoptotic neutrophils; the GAS6 group (or labeled G) refers to the co-culture of bone marrow macrophages treated with GAS6 protein and apoptotic neutrophils; the Bemcentinib group (or labeled B) refers to the co-culture of bone marrow macrophages treated with AXL inhibitor (Bemcentinib) and apoptotic neutrophils; the GAS6 + Bemcentinib group (or labeled BG) refers to the co-culture of bone marrow macrophages treated first with AXL inhibitor (Bemcentinib) and then with GAS6 protein and apoptotic neutrophils.

[0114] Figure 4 In vitro pharmacological experiments were performed to clarify that the GAS6 - AXL axis can regulate the hematopoietic support ability of bone marrow macrophages from healthy donors. Among them, A is the flow chart of the hematopoietic support ability of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib); B is the colony formation of CD34 + cells after co-culture of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib) and CD34 + cells; C is the typical apoptosis graph of CD34 + cells after co-culture of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib) and CD34 + cells; D is the apoptosis ratio of CD34 + cells after co-culture of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib) and CD34 + cells; E is the typical EdU proliferation graph of CD34 + cells after co-culture of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib) and CD34 + cells; F is the typical EdU proliferation graph of CD34 + cells after co-culture of bone marrow macrophages from healthy donors treated with GAS6 protein and / or AXL inhibitor (Bemcentinib) and CD34 +The proportion of EdU-positive cells in the cells. In B-F, the Control group (or labeled C) was the co-culture of bone marrow macrophages treated only with the control solvent (DMSO) and CD34 + cells; the GAS6 group (or labeled G) referred to the co-culture of bone marrow macrophages treated with GAS6 protein and CD34 + cells; the Bemcentinib group (or labeled B) referred to the co-culture of bone marrow macrophages treated with the AXL inhibitor (Bemcentinib) and CD34 + cells; the GAS6 + Bemcentinib group (or labeled BG) referred to the co-culture of bone marrow macrophages treated first with the AXL inhibitor (Bemcentinib) and then with GAS6 protein and CD34 + cells.

[0115] Figure 5 To clarify that the GAS6-AXL axis can regulate the hematopoietic support ability of macrophages in an in vitro cell line model. Among them, A is the flow chart for establishing the in vitro cell line model; B is the detection of the expression of the viral fluorescence tag (ZsGreen) in each group after inducing the THP-1 cell line into M0 macrophages (TDM) and successfully transfecting lentivirus in groups; C is the expression of AXL protein and gene in each group; D is the co-culture of macrophages in each group with CD34 + cells for 4 days, and the colony formation of CD34 + cells; E is the co-culture of macrophages in each group with CD34 + cells for 4 days, and the apoptosis proportion and typical figure of CD34 + cells; F is the co-culture of macrophages in each group with CD34 + cells for 4 days, and the EdU-positive proportion and typical figure of CD34 + cells. In B-F, the T-kA group referred to the co-culture of TDM transfected with AXL knockdown virus and CD34 + cells, the T-kA / oA group referred to the co-culture of TDM transfected first with AXL knockdown virus and then with AXL overexpression virus and CD34 + cells, and the T-C group referred to the co-culture of TDM transfected with control virus and CD34 + cells.

[0116] Figure 6 To clarify that the GAS6-AXL axis can regulate the hematopoietic support ability of macrophages in an in vivo animal model. Among them, A is the schematic diagram for constructing a mouse model with specific knockdown of AXL in bone marrow macrophages; B is the typical figure of the HE staining results of the femurs of mice in each group; C is the detection of the positive proportion of the viral fluorescence tag (ZsGreen) in bone marrow macrophages of mice in each group by flow cytometry and ZsGreen +Mean Fluorescence Intensity (MFI) of AXL in macrophages; D is a typical graph of flow cytometry detecting bone marrow hematopoietic stem cells of mice in each group; E is the quantitative result of flow cytometry detecting the proportion of bone marrow hematopoietic stem cells of mice in each group; F is the quantitative result of flow cytometry detecting the proportion of M2 macrophages in the bone marrow of mice in each group; G is a typical graph of flow cytometry detecting M2 macrophages in the bone marrow of mice in each group; H is a typical graph of immunofluorescence detecting the distribution of M2 macrophages in the femurs of mice in each group. In the figure, AAV-F4 / 80-AXL represents the AXL knockdown mouse group; AAV-F4 / 80 represents the mouse group infected with the control virus.

[0117] Figure 7 For a prospective case-control study to explore bone marrow SELENOP + The key biological property of macrophages, the GAS6-AXL axis, is involved in the occurrence of patients with poor implantation function and may become a new therapeutic target. Among them, A shows the phagocytic function of bone marrow macrophages in PGF patients and GGF patients after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib); B shows the proportion of EdU-positive cells of CD34 + cells after co-culture of bone marrow macrophages from PGF patients and GGF patients with CD34 + cells after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib); C shows the proportions of early apoptosis, late apoptosis, and total apoptosis of CD34 + cells after co-culture of bone marrow macrophages from PGF patients and GGF patients with CD34 + cells after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib); D shows the colony formation of CD34 + cells after co-culture of bone marrow macrophages from PGF patients and GGF patients with CD34 + cells after treatment with GAS6 protein and / or AXL inhibitor (Bemcentinib). In the figure, those labeled C are the Control group, that is, the co-culture of bone marrow macrophages treated only with the control solvent (DMSO) and CD34 + cells; those labeled G are the GAS6 group, that is, the co-culture of bone marrow macrophages treated with GAS6 protein and CD34 + cells; those labeled B are the Bemcentinib group, that is, the co-culture of bone marrow macrophages treated with AXL inhibitor (Bemcentinib) and CD34 + cells; those labeled BG are the GAS6 + Bemcentinib group, that is, the co-culture of bone marrow macrophages treated first with AXL inhibitor (Bemcentinib) and then with GAS6 protein and CD34 + cells. Detailed implementation manners

[0118] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0119] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0120] The plasmid pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO involved in the following embodiments is recorded in the article "Zhou C, Cui Y, Yang Y, et al. Runx1 protects against the pathological progression of osteoarthritis. Bone Res. 2021;9(1):50. Published 2021 Dec 7. doi:10.1038 / s41413-021-00173-x". The public can obtain it from the applicant and can only be used for repeating the experiments of the present invention and cannot be used for other purposes.

[0121] The plasmid pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO involved in the following embodiments is recorded in the article "Zhang C, Wang XY, Zhang P, et al. Cancer-derived exosomal HSPC111 promotes colorectal cancer liver metastasis by reprogramming lipid metabolism in cancer-associated fibroblasts. Cell Death Dis. 2022;13(1):57. Published 2022 Jan 13." The public can obtain it from the applicant and can only be used for repeating the experiments of the present invention and cannot be used for other purposes.

[0122] General method :

[0123] Treatment of human bone marrow specimens (extraction of bone marrow mononuclear cells)

[0124] For freshly collected hematopoietic stem cell transplantation, the bone marrow of healthy donors, patients with good graft function (GGF), and patients with poor graft function (PGF) was centrifuged at 1500 rpm for 5 minutes at room temperature. Lymphocyte separation medium (GE Healthcare Milwaukee, WI, USA) was added in a 1:1 ratio, and gradient centrifugation was performed at 1800 rpm for 18 minutes at room temperature. The white foggy mixture in the middle layer, i.e., mononuclear cells, was gently aspirated, washed twice with 1×PBS, and then awaited detection or culture.

[0125] Identification of novel bone marrow macrophage phenotypes and functions by single-cell transcriptome sequencing

[0126] Single-cell transcriptome libraries were constructed using the 10×Genomics Chromium platform. The expression profile matrix was obtained by alignment using the Cellranger 4.0.0 software. The R package Seurat V4 was further used to filter out low-quality cells (cells with at least 200 detected genes and no more than 40% of the total detected genes being mitochondrial genes were screened and retained). The DouletFinder was used to remove doublet droplets. The "NormalizeData" function was used to normalize the expression profile. 3000 genes were selected as "anchored genes", and the RPCA algorithm was used to cluster and integrate samples to remove batch effects. The cell - to - cell distance was calculated to construct an SNN similarity graph for classifying cell subpopulations, and the PHATE algorithm was used for dimensionality reduction and visualization. The R package U Cell was used to quantify cell functional phenotypes and assign cell function scores. The Python package scanpy 1.9.1 was used for cell pseudotime analysis. The R package CellChat was used to predict cell - to - cell interaction relationships. When defining cell phenotypes by a certain gene, in the calculation of the present invention, as long as 1 read of the gene is detected in a certain cell, that cell is considered a positive - expressing cell of that gene.

[0127] Detection of the proportion of novel bone marrow macrophage subsets

[0128] Take 1×10 bone marrow mononuclear cells 6Transfer 200 μL to a flow cytometry tube, add novel flow cytometry antibodies for the cell surface of bone marrow macrophages (1 μL of CD14-PE and 2 μL of CD68-BV711), and incubate in the dark at room temperature for 15 min; add 1 mL of PBS, centrifuge at 1500 rpm at room temperature for 5 min, and discard the supernatant; add 100 μL of Reagent A (Reagent A, Fixation medium), and incubate at room temperature for 15 min; add 1 mL of PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 100 μL of Reagent B (Reagent B, Perm medium), pipette to mix well; add the primary antibody (1 μL of SELENOP), mix well, and incubate at room temperature for 15 min; add 1 mL of 1×PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 1 μL of the secondary antibody PerCP AffiniPure F(ab’)2 Fragment Goat Anti-Rabbit IgG(H+L), and incubate in the dark at room temperature for 10 min; add 1 mL of 1×PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 200 μL of 1×PBS, shake to mix well, and perform the detection on the machine within 4 h. Flow cytometry image analysis uses Diva 7.0 software (BD Biosciences, USA); gating strategy: select all bone marrow mononuclear cells in the side scatter (SSC) and forward scatter (FSC), and circle SELENOP + CD68 + cells within the cell population, and the cells are bone marrow SELENOP + macrophages. +

[0129] Antibody catalog numbers: Monoclonal antibodies: CD14-PE (301806, Biolegend), CD68-BV711 (565594, Becton Dickinson), Anti-SEPP1 (ab277526, abcam).

[0130] Detection of the biological properties of novel bone marrow macrophage subsets

[0131] Take 1×10 bone marrow mononuclear cells 6 ​Transfer 200 μL to a flow cytometry tube, add the novel bone marrow macrophage cell surface flow antibody (the same as above) and 2 μL of CD163-PE-Cy7 (M2 macrophage marker), 1 μL of MERTK-APC, and 1 μL of AXL-BV605 (ligand-receptor pair discovered by Cellchat), and incubate at room temperature in the dark for 15 min; add 1 mL of PBS, centrifuge at 1500 rpm at room temperature for 5 min, and discard the supernatant; add 100 μL of Reagent A (Fixation medium), and incubate at room temperature for 15 min; add 1 mL of PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 100 μL of Reagent B (Perm medium) and pipette to mix well; add the anti-SELENOP primary antibody and mix well, and incubate at room temperature for 15 min; add 1 mL of 1×PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 1 μl of the secondary antibody PerCP AffiniPure F(ab’)2 Fragment Goat Anti-Rabbit IgG(H+L), and incubate at room temperature in the dark for 10 min; add 1 mL of 1×PBS, centrifuge at 2000 rpm at room temperature for 3 min, and discard the supernatant; add 200 μL of 1×PBS, shake to mix well, and perform on-machine detection within 4 h. Flow cytometry image analysis was performed using Diva 7.0 software (BD Biosciences, USA); gating strategy: select all bone marrow mononuclear cells in the side scatter (SSC) and forward scatter (FSC), CD14 + CD68 + Circle out SELENOP within the cell population + cells, which are bone marrow SELENOP + macrophages, and analyze the expression of CD163, MERTK, and AXL on bone marrow SELENOP + macrophages.

[0132] Antibody catalog numbers: Monoclonal antibodies: CD163-PE-Cy7 (326514, Biolegend), MERTK-APC (367612, Biolegend), AXL-BV605 (747861, Becton Dickinson).

[0133] Flow imaging analysis of novel bone marrow macrophages

[0134] Take 1×10 bone marrow mononuclear cells 6Transfer 200 μL of the cells to a flow cytometry tube, and add novel flow antibodies and biological property markers for bone marrow macrophages (1 μL of CD14-PE, 2 μL of CD163-FITC, 1 μL of AXL-BV421). Incubate in the dark at room temperature for 15 min. Add 1 mL of PBS, centrifuge at 1500 rpm for 5 min at room temperature, and discard the supernatant. Add 100 μL of Reagent A (Fixation medium), incubate at room temperature for 15 min. Add 1 mL of PBS, centrifuge at 2000 rpm for 3 min at room temperature, and discard the supernatant. Add 100 μL of Reagent B (Perm medium) and pipette to mix evenly. Add the primary antibody (1 μL of SELENOP), mix well, and incubate at room temperature for 15 min. Add 1 mL of 1×PBS, centrifuge at 2000 rpm for 3 min at room temperature, and discard the supernatant. Add 1 μL of the secondary antibody PerCP AffiniPure F(ab’)2 Fragment Goat Anti-Rabbit IgG(H+L), incubate in the dark at room temperature for 10 min. Add 1 mL of 1×PBS, centrifuge at 2000 rpm for 3 min at room temperature, and discard the supernatant. Add 200 μL of 1×PBS, vortex to mix evenly, and perform the detection on the machine within 4 h. Flow imaging analysis of the immunophenotype of bone marrow macrophages was performed using IDEAS software (Amins, Germany).

[0135] Antibody catalog number: Monoclonal antibodies: CD14-PE (301806, Biolegend), CD163-FITC (563697, Becton Dickinson), AXL-BV421 (747864, Becton Dickinson), Anti-SEPP1 (ab277526, abcam).

[0136] In vitro induction, differentiation and culture of human bone marrow mononuclear macrophages

[0137] Resuspend bone marrow mononuclear cells at a cell concentration of 1×10 6 / mL in RPMI 1640 (11875093, Gibco) + 10% FBS (A5670701, Gibco) liquid medium containing 50 ng / mL M-CSF. After inoculating 2 mL in a 6-well plate, place it in an incubator at 37 °C with 5% CO2 for culture; change the cell medium on the 4th day; culture until the 7th day, wash away the suspended cells, and the adherent cells are human bone marrow macrophages. The cells can be digested for subsequent experiments after digestion.

[0138] Macrophage phagocytosis experiment

[0139] Remove the culture medium from the bone marrow macrophages cultured for 7 days, wash them 3 times with 1×PBS, with the action as close to the wall as possible and gentle, without pipetting; add 1 mL of 1 μM CellTracker Orange CMTMR dye (C2927, Invitrogen) diluted with RPMI 1640 liquid medium, and incubate in an incubator at 37°C with 5% CO2 for 30 min. TM Take the bone marrow neutrophils and resuspend them at a cell concentration of 1×10 / mL in a liquid medium containing DMEM (21013024, Gibco) + 10% FBS (A5670701, Gibco). After irradiating with ultraviolet light at 254 nM for 5 min to induce apoptosis, add 1 mL of 1 μM CellTracker Green CMFDA dye (C2925, Invitrogen) diluted with DEME medium, and incubate in an incubator at 37°C with 5% CO2 for 30 min.

[0140] Take the bone marrow neutrophils and resuspend them at a cell concentration of 1×10 6 / mL in a liquid medium containing DMEM (21013024, Gibco) + 10% FBS (A5670701, Gibco). After irradiating with ultraviolet light at 254 nM for 5 min to induce apoptosis, add 1 mL of 1 μM CellTracker Green CMFDA dye (C2925, Invitrogen) diluted with DEME medium, and incubate in an incubator at 37°C with 5% CO2 for 30 min. TM Take the bone marrow neutrophils and resuspend them at a cell concentration of 1×10 / mL in a liquid medium containing DMEM (21013024, Gibco) + 10% FBS (A5670701, Gibco). After irradiating with ultraviolet light at 254 nM for 5 min to induce apoptosis, add 1 mL of 1 μM CellTracker Green CMFDA dye (C2925, Invitrogen) diluted with DEME medium, and incubate in an incubator at 37°C with 5% CO2 for 30 min.

[0141] Centrifuge the stained neutrophils at 1500 rpm for 5 min, remove the culture medium, and resuspend them with DMEM + 10% FBS. Aspirate the culture medium with the fluorescent dye from the macrophages, gently wash them once with 1×PBS, and then add the neutrophils for co-culture for 3 days.

[0142] After the co-culture, aspirate the supernatant and the non-phagocytosed neutrophils, gently wash them 3 times with 1×PBS; add 4% pre-cooled paraformaldehyde and fix for 10 min; remove the 4% paraformaldehyde and wash 3 times with 1×PBS; add 200 μl of PBS and 1 μl of DAPI (Abcam, ab228549, 10 mM) to each well, stain in the dark for 15 min, and then wash 3 times with 1×PBS. Observe under a fluorescence microscope, randomly select three fields of view to take pictures, calculate the proportion of macrophages that phagocytose neutrophils among the total macrophages, and perform statistics.

[0143] Cell co-culture experiment

[0144] According to the instructions of the CD34 MicroBead kit (Miltenyi Biotec, Bergisch Gladbach, Germany), perform CD34 magnetic bead positive sorting on the bone marrow mononuclear cells of healthy donors; co-culture the bone marrow macrophages with the sorted CD34 cells in StemSpanTM SFEM (StemCell Technologies, Vancouver, BC, Canada) medium in an incubator at 37°C with 5% CO2 for 4 days. + Co-culture the bone marrow macrophages with the sorted CD34 cells in StemSpanTM SFEM (StemCell Technologies, Vancouver, BC, Canada) medium in an incubator at 37°C with 5% CO2 for 4 days.

[0145] Experiment of treating bone marrow macrophages with AXL inhibitor (Bemcentinib) and GAS6 protein

[0146] Macrophages were processed according to the grouping. The Control group was bone marrow macrophages treated only with the control solvent (DMSO); the GAS6 group referred to bone marrow macrophages treated with GAS6 protein (Proteintech, Ag5158) for 1 day (working concentration: 500 ng / ml); the Bemcentinib group referred to bone marrow macrophages treated with the AXL inhibitor (Bemcentinib) for 1 day (working concentration: 1.5 μM); the GAS6 + Bemcentinib group referred to bone marrow macrophages treated with the AXL inhibitor (Bemcentinib, working concentration: 1.5 μM) for 1 day first and then treated with GAS6 protein (working concentration: 500 ng / ml) for 1 day.

[0147] Colony formation experiment

[0148] Harvest the CD34 + cells after co-culture and seed them at 2×10 3 cells / well in a 24-well plate, and add MethoCult TM H4434 Classic (Stem Cell Technologies) medium. On the 7th day of culture, count the colony-forming unit erythroid (CFU-E) under a microscope; on the 14th day of culture, count the burst-forming unit erythroid (BFU-E), colony-forming unit granulocyte-macrophages (CFU-GM), and colony-forming unit-granulocyte, erythroid, macrophage and megakaryocyte (CFU-GEMM) under a microscope.

[0149] Flow cytometry detection of co-cultured CD34 + Cell apoptosis

[0150] Use a flow tube to take 1×10 + CD34 6 cells / 200 μL per tube; add 2 μL of the surface flow antibody CD34, and incubate at room temperature for 15 min; add 2 mL of PBS to wash the cells once, and centrifuge at 1500 rpm for 5 min; make them into 1×10 6Cell suspension at a density of cells / 200 μL; add 2 μL of Annexin-V-FITC and 5 μL of 7-AAD, incubate at room temperature for 15 min; add 200 μL of binding buffer, mix well by shaking, and perform on-machine detection within 4 h. Flow cytometry image analysis was performed using Diva 7.0 software (BD Biosciences, USA). Antibody catalog numbers: CD34-FITC (343504, Biolegend), Annexin-V-APC (640920, Biolegend), 7-AAD (51-68981E, Becton Dickinson).

[0151] EdU proliferation experiment

[0152] Staining was performed using an EdU kit (RiboBio, C10310-3). On the third day of the co-culture experiment of macrophages and CD34 + cells, add the EdU solution (Reagent A, diluted with cell culture medium at a ratio of 5000:1, working concentration is 10 μM) and incubate overnight. After incubating for 24 h, collect the CD34 + cells into a flow cytometry tube, centrifuge at 350 g for 5 min, and discard the supernatant. Resuspend the cells with 1 mL of PBS, centrifuge at 350 g for 5 min, and discard the supernatant. Add 1 mL of 4% paraformaldehyde to each tube and fix for 10 min, centrifuge at 600 g for 10 min, and discard the supernatant. Add 2 - 3 mL of 2 mg / mL glycine (Sigma, G1377) to each tube to neutralize for 5 min, centrifuge at 600 g for 10 min, and discard the supernatant. Wash once with 2 mL of PBS. Add 1 mL of 0.5% Triton X-100 permeabilizer (Sangon biotech, 9002-93-1, diluted with PBS) to each tube and incubate at room temperature for 10 min, centrifuge at 600 g for 10 min, and discard the supernatant. Wash once with 2 mL of PBS. Add 100 μl of 1× Apollo staining solution (reagent included in the kit) to each tube for staining, resuspend the cells thoroughly, incubate in the dark at room temperature for 10 min, then centrifuge at 600 g for 10 min, and discard the supernatant. After washing once with 2 mL of PBS, resuspend with 500 μl of PBS, and detect the proportion of EdU-positive cells by flow cytometry. Flow cytometry image analysis was performed using Diva 7.0 software (BD Biosciences, USA).

[0153] Knockdown of AXL by lentiviral transfection after THP-1 cell line was induced into adherent macrophages (TDM)

[0154] The THP1 cell line at a density of 1×10 6The cells with a concentration of / ml were resuspended in RPMI 1640 medium containing 10% FBS; after adding PMA (final concentration: 320 nM) (ab120297, Sigma) for 24 hours, the adherent cells were TDM. To up-regulate or down-regulate the expression of AXL in THP-1 cells, lentiviruses for AXL overexpression and knockdown were constructed in the present invention. The complete CDS sequence of AXL (transcript number NM_021913.5) was synthesized and cloned into the MCS (multiple cloning site) region of the pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO plasmid to construct the h-AXL overexpression lentiviral plasmid (Hanheng Biotechnology (Shanghai) Co., Ltd., product number: LV011). Short hairpin RNAs (shRNAs) targeting AXL were designed, and the shRNAs carrying gene silencing targets or negative controls were inserted into the MCS (multiple cloning site) region of pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO (Hanheng Biotechnology (Shanghai) Co., Ltd., product number: LV021) to construct the h-AXL knockdown lentiviral plasmid. The coding sequence of shRNA1 was (5'-3'): GATCCGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTTTG; the coding sequence of shRNA2 was (5'-3'): GATCCGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTTG; the coding sequence of shRNA3 was (5'-3'): GATCCGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTTTG; the coding sequence of shNC was (5'-3'): GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC. The target fragment was ligated to the vector, transformed using DH5a competent cells, positive clones were selected for PCR verification, and recombinant plasmids were extracted for sequencing. According to the manufacturer's instructions, the above constructed lentiviral plasmids (carrying the target gene or shRNA), pSPAX2, and pMD2.G were co-transfected after high-purity endotoxin-free extraction, and the plasmids were co-transfected into 293T cells using Hanheng's Lipofiter transfection reagent. The virus supernatants were collected at 48 and 72 hours after transfection, ultracentrifuged, and the virus precipitate was resuspended to obtain a lentiviral suspension. The lentiviral titer was detected by the dilution counting method. After measurement, the titer of the overexpression lentivirus HBLV-h-AXL-3×flag-ZsGreen-PURO was 3×10 8TU / mL. The titer of the lentivirus HBLV-h-AXL shRNA1-ZsGreen-PURO for knockdown was 1×10 9 TU / mL. The titer of HBLV-h-AXL shRNA2-ZsGreen-PURO was 1.3×10 9 TU / mL. The titer of HBLV-h-AXL shRNA3-ZsGreen-PURO was 1.3×10 9 TU / mL. The titer of the blank lentivirus HBLV-shNC-ZsGreen-PURO was 1.6×10 9 TU / mL. After transfecting the constructed AXL knockdown lentivirus, AXL overexpression lentivirus and blank virus into TDM for 72 hours, the cells successfully transfected with the lentivirus were purified by puromycin (2 μg / mL) drug screening and the cells were amplified. Finally, the efficiency of AXL knockdown and overexpression was evaluated by fluorescence microscopy, western blot and qPCR analysis.

[0155] Quantitative real-time reverse transcription polymerase chain reaction (qPCR)

[0156] Take the TDM macrophages transfected with AXL knockdown lentivirus, AXL overexpression lentivirus and blank virus. Use the RNeasy Mini Kit (QIAGEN) to extract the RNA of the cells, use the RT Kit with gDNA eraser (Takara) to reverse transcribe the RNA into cDNA, and detect the AXL mRNA expression level by SYBR Green qRT-PCR Kit (Thermo Fisher). The above gene expression levels were evaluated after being normalized to the 18s mRNA expression level. All the sequences of the primers used are as follows (all sequences are in the 5'-3' direction). 18s: forward primer GTAACCCGTTGAACCCCATT, reverse primer CCATCCAATCGGTAGTAGCG; AXL: forward primer GAACCTTCAACTCCTGCCTTCTCG, reverse primer CTCCATAACGGGTCTCCTTCTTTCG.

[0157] Western blot experiment

[0158] In SDS protein lysis buffer (1% SDS), protease inhibitor and phosphatase inhibitor were added, with the cell number of 1×10 7Add 1 mL of lysis buffer, and use a pipette tip to thoroughly pipette up and down to resuspend the cells. Incubate on ice for 10 min, boil for 10 min for denaturation, and centrifuge at 13,000 rpm for 30 min. Take the supernatant and detect the protein concentration using a BCA protein quantification kit and a microplate reader. Add 4×loading buffer and boil for 10 min. Prepare a 10% separating gel, load 30 μg of protein per well, add a prestained protein marker, run the gel, transfer the membrane, and block with a washing buffer (Tris Buffered Saline with Tween20, TBST) containing 5% non-fat milk for 1 h. Incubate with the primary antibody overnight at 4°C. After washing the membrane 3 times, incubate with the secondary antibody for 1 h, wash the membrane 3 times, 10 min each time, and develop the film.

[0159] Construction of a mouse model with specific knockdown of AXL in bone marrow macrophages

[0160] To prepare the adeno-associated virus vector, first construct a shuttle plasmid with a knockdown sequence fragment. Use the F4 / 80 macrophage-specific promoter (shown in SEQ ID No. 1) to achieve specific transcription of the knockdown sequence in macrophages. Design primers to amplify the target fragment, and amplify a template fragment containing the target sequence CGTGGAGAACAGCGAGATTTA of the mir30 structure (the complete sequence is: 5’-AAGGTATATTGCTGTTGACAGTGAGCGCGTGGAGAACAGCGAGATTTATAGTGAAGCCACAGATGTA TAAATCTCGCTGTTCTCCACGTGCCTACTGCCTCG-3’) as the target fragment. Use the HBinfusionTM one-step cloning and ligation system to insert the target fragment into the pHBAAV-F480-MCS-3flag-T2A-ZsGreen plasmid (Hanheng Biotechnology (Shanghai) Co., Ltd., product number: AAV135) digested with EcoRI. After transformation, verification by colony PCR, and screening of positive clones for sequencing, the recombinant plasmid pHBAAV2 / 2-F480-mir30-AXL-ZsGreen is obtained.

[0161] The adeno-associated virus shuttle plasmid pHBAAV2 / 2-F480-mir30-AXL-ZsGreen, pAAV-RC vector plasmid, and pHelper vector plasmid (all products of Hanheng Biotechnology (Shanghai) Co., Ltd.) were respectively subjected to high-purity endotoxin-free extraction. Then, the three plasmids were co-transfected into AAV-293 cells (products of Hanheng Biotechnology (Shanghai) Co., Ltd.) using LipofiterTM transfection reagent (products of Hanheng Biotechnology (Shanghai) Co., Ltd.). 72 hours after transfection, the cells containing AAV particles were gently scraped off with a cell scraper, centrifuged, and cell lysis was performed to collect cell precipitates. A high-titer adeno-associated virus preservation solution was obtained by column purification method, and this recombinant adeno-associated virus was named HBAAV2 / 2-F480-mir30-AXL-ZsGreen. The SYBR Green method was used to detect the genomic content of the adeno-associated virus, and it was determined that the genomic titer of the adeno-associated virus HBAAV2 / 2-F480-mir30-AXL-ZsGreen in this application was 1.1×10 13 vg / mL.

[0162] C57BL / 6J female mice (6 - 8 weeks old) were divided into 3 groups, named Group 1, Group 2, and Group 3 respectively, with 6 mice in each group. Through in-situ injection of mouse bone marrow, on the 28th day, normal saline, AXL knockdown, and control AAV viruses were respectively injected into the bone marrow cavities of the mice in Group 1, Group 2, and Group 3 (30 μL / femur). (The construction process of the control AAV virus is the same as above. The difference between the AAV virus for AXL knockdown and the control AAV virus is that the vector plasmid does not contain the target sequence, that is, the shuttle plasmid used is pHBAAV-F480-MCS-3flag-T2A-ZsGreen plasmid), and mice with specific knockdown of AXL in bone marrow macrophages were constructed. 4 weeks after injection (day 0), the proportion of Zsgreen + cells / bone marrow macrophages in each group of mice was detected by flow cytometry, and the AAV virus infection efficiency was calculated. Femurs of mice in each group were taken for in-situ HE staining of bone marrow; bone marrow cells were flushed out from the femurs for detection of the proportions of bone marrow hematopoietic stem cells and M2 macrophages.

[0163] In the following examples, a total of 6 patients with poor graft function (PGF), 6 paired patients with good graft function (GGF) Patients (primary diseases were AML and MDS) and 6 healthy controls (HD).

[0164] Inclusion criteria for PGF patients: 1. More than two of the three blood cell lines in the peripheral blood of patients on +28 days after transplantation still did not reach stable engraftment of donor-derived hematopoietic cells (neutrophils ≤ 0.5×10 9 / L, platelets ≤ 20×10 9 / L and / or hemoglobin ≤ 70 g / L); 2. The donor and recipient were in a chimeric state; 3. Excluding patients with severe graft-versus-host disease (GVHD) and infections.

[0165] Inclusion criteria for paired GGF patients: 1. For 3 consecutive days after transplantation +28 days, the patient's peripheral blood neutrophils > 0.5×10 9 / L, platelets > 20×10 9 / L for 7 consecutive days, and hemoglobin > 70 g / L), and not dependent on granulocyte colony-stimulating factor, platelet, or red blood cell transfusion; 2. Clinical characteristics (such as age, gender, diagnosis, and time after transplantation, etc.) are matched with PGF patients.

[0166] Inclusion criteria for HD: Healthy donors matched with PGF patients in terms of age and gender.

[0167] HE staining experiment of mouse femur

[0168] The femurs of mice in each group were placed in 4% paraformaldehyde for fixation, and the paraffin sections were dewaxed. They were dewaxed in environmental dewaxing agent (1), environmental dewaxing agent (2), and environmental dewaxing agent (3) for 10 minutes respectively, and then passed through absolute ethanol, 95% ethanol, 85% ethanol, and 75% ethanol for 5 minutes each. Rinsed with tap water for 1 minute. Stained with hematoxylin staining solution (Harris) for 4 minutes, rinsed with tap water for 2 minutes until no excess staining solution escaped from the sections. Differentiated with 0.8% hydrochloric acid alcohol for 2 seconds, rinsed with tap water, and could also be blued with lithium carbonate aqueous solution, and then rinsed with water for 2 minutes. Immersed in eosin staining solution (alcohol-soluble) for 20 seconds, without rinsing with water, directly adjusted the color in 95% ethanol for 5 seconds, and dehydrated in absolute ethanol (1) and absolute ethanol (2) for 2 minutes. Transparented with environmental transparenting agent, sealed, and examined under the microscope (reagents and technical services provided by Hubei Bioscience Co., Ltd.).

[0169] Example 1. Single-cell transcriptome sequencing combined with flow cytometry first discovered bone marrow SELENOP + Macrophages

[0170] Single-cell transcriptome sequencing was performed on immune cells and hematopoietic cells in the bone marrow blood of healthy donors (HD), patients with poor graft function (PGF), and patients with good graft function (GGF) whose clinical characteristics (such as age, gender, diagnosis, and time after transplantation, etc.) were matched ( Figure 1 in A). After unsupervised clustering of the standardized single-cell expression matrix, cell populations were initially identified. After dimensionality reduction and visualization, a total of 46 cell subsets including hematopoietic stem and progenitor cells, innate and adaptive immune cells, etc. were obtained ( Figure 1 in B), and the characteristic genes of each subset were shown ( Figure 1 in C) and their distribution in PGF, GGF, and HD ( Figure 1 in D). Further characterization of myeloid innate immune cells in bone marrow mononuclear cells included the developmental process from hematopoietic stem cells to myeloid stem and progenitor cells, and then to mature neutrophils and mononuclear macrophages ( Figure 1In E, F). By calculating the proportions of monocyte-macrophage and myeloid dendritic cells (MD) cell types, it was found that compared with GGF patients and HD, SELENOP in the bone marrow of PGF patients + The proportion of the macrophage (MD:SELENOP) cell subset was significantly reduced ( Figure 1 In G). According to the characteristics of its expression of CD14, CD68, CD163, and SELENOP genes ( Figure 1 In H), flow cytometry was used to detect SELENOP in the bone marrow of PGF patients, GGF patients, and HD + The proportion of macrophages, and it was found that the trend was consistent with the aforementioned bioinformatics results ( Figure 1 In I). In addition, by comparing the differences in the expression profiles of the MD:SELENOP cell subset among PGF patients, GGF patients, and HD, it was found that this cell was highly expressed in GGF patients and HD in genes related to "angiogenesis" and "regulation of endothelial cell migration", while in PGF patients, genes related to "inflammatory response", "IFNγ response", etc. were highly expressed ( Figure 1 In J, K).

[0171] Example 2. Single-cell transcriptome sequencing data suggests that the key biological property of bone marrow SELENOP + Macrophages is the GAS6-AXL axis

[0172] In this example, by analyzing single-cell transcriptome sequencing data through Cellchat of cell-cell interactions, it was found that: compared with HD and GGF patients, the GAS6-AXL signal was significantly reduced in the MD:SELENOP cell subset of PGF patients ( Figure 2 In A, B), and the expression level of the AXL gene was also significantly reduced in the MD:SELENOP cell subset of PGF patients ( Figure 2 In C). In addition, compared with the bone marrow SELENOP + Macrophages of GGF patients and HD, the proportion of AXL single-positive cells in the bone marrow SELENOP + Macrophages of PGF patients was significantly reduced ( Figure 2 In D). Compared with AXL-negative SELENOP + Macrophages, AXL-positive cells highly expressed CD163 and IGF1 molecules ( Figure 2 In E).

[0173] Example 3. Immunophenotypic identification of bone marrow SELENOP + Macrophages and exploration of the regulatory effect of the GAS6-AXL axis on macrophage phagocytosis

[0174] Flow cytometry results showed that the proportion of AXL + cells in the bone marrow of PGF patients among SELENOP + macrophages, the proportion of AXL + cells among bone marrow mononuclear cells, the expression level of AXL on SELENOP + cells, and the proportion of CD163 + cells in SELENOP + cells decreased significantly ( + in A, B, C, D, E in ). In addition, the positive proportion and expression level of CD163 on AXL + cells in the SELENOP Figure 3 cells of HD were significantly higher than those of AXL + cells ( + in F, G in ). Finally, the immunophenotype of bone marrow SELENOP - macrophages was determined to be CD14 Figure 3 CD68 + SELENOP + CD68 + SELENOP + . Combining flow imaging to detect the immunophenotype markers (CD14 + SELENOP + SELENOP + ) and biological property markers (CD163 + AXL + ) of bone marrow SELENOP Figure 3 macrophages as shown in H in . In vitro phagocytosis experiments showed that AXL inhibitors could significantly damage the phagocytic ability of healthy bone marrow macrophages, while GAS6 protein could repair this damage ( Figure 3 in I, J, K, L in ).

[0175] Example 4. Regulation of the hematopoietic support ability of primary bone marrow macrophages by the GAS6-AXL axis

[0176] After co-culturing bone marrow macrophages with CD34 + cells for 4 days ( Figure 4 in A in ), colony formation experiments ( + in B in ), apoptosis experiments ( Figure 4 in C, D in ), and EdU proliferation experiments ( Figure 4 in E, F in ) were performed on CD34 Figure 4 cells. The results showed that AXL inhibitors significantly reduced the promoting effect of healthy human bone marrow macrophages on the colony formation ability of CD34 + cells, and GAS6 protein could compensate for this reduction; AXL inhibitors significantly reduced the promoting effect of healthy human bone marrow macrophages on CD34 +The promoting effect on the proliferation ability of cells, and GAS6 protein can compensate for this decrease; AXL inhibitor significantly reduces the ability of healthy human bone marrow macrophages to CD34 + The inhibitory effect on the apoptosis (mainly early apoptosis) ability of cells, and GAS6 protein can compensate for this decrease. The above results indicate that AXL inhibitor can significantly damage the hematopoietic support ability of healthy bone marrow macrophages, while GAS6 protein can repair this damage.

[0177] Example 5. In vitro model verifies the regulatory effect of GAS6-AXL axis on the hematopoietic support ability of macrophages

[0178] After inducing the THP-1 cell line into M0 macrophages (TDM), lentivirus was transfected according to the grouping ( Figure 5 as shown in A). After transfection, immunofluorescence was used to verify the expression of the viral tag fluorescent protein ( Figure 5 as shown in B), and Western blot and PCR were used to confirm that the expression level of AXL was knocked down or overexpressed ( Figure 5 as shown in C), and it was confirmed that the model was successfully constructed. After the TDM transfected with lentivirus successfully was co-cultured with CD34 + cells for 4 days, colony formation assay ( + as shown in D), apoptosis assay ( Figure 5 as shown in E) and EdU proliferation assay ( Figure 5 as shown in F) were performed on CD34 Figure 5 cells. The results showed that knocking down AXL significantly reduced the promoting effect of macrophages on the colony formation ability of CD34 + cells, and overexpressing AXL could compensate for this decrease; knocking down AXL significantly reduced the promoting effect of macrophages on the proliferation ability of CD34 + cells, and overexpressing AXL could compensate for this decrease; knocking down AXL significantly reduced the inhibitory effect of macrophages on the apoptosis (mainly early apoptosis) ability of CD34 + cells, and overexpressing AXL could compensate for this decrease. The above results indicate that knocking down AXL can significantly damage the hematopoietic support ability of macrophages, while overexpressing AXL can repair this damage.

[0179] Example 6. In vivo model shows that specific knockdown of AXL in bone marrow macrophages damages murine bone marrow hematopoiesis

[0180] To further verify the regulatory effect of GAS6-AXL axis on the hematopoietic support ability of bone marrow macrophages, an in vivo model was constructed by in situ injection of macrophage-specific AXL knockdown virus into the bone marrow ( Figure 6 as shown in A). HE experiment found that 28 days after virus injection, the hematopoietic area of AXL knockdown mice was severely damaged ( Figure 6In B). By collecting the bone marrow cells of each group of mice, the fluorescence tag ZsGreen of the virus and the expression level of AXL were first detected by flow cytometry to confirm the successful construction of the model ( Figure 6 In C). In addition, the proportion of bone marrow hematopoietic stem cells in AXL-specific knockdown mice decreased significantly ( Figure 6 In D and E). The polarization of macrophages in each group of mice was detected by flow cytometry combined with in-situ immunofluorescence of bone marrow. The results showed that the proportion of M2 cells in the knockdown mice decreased significantly ( Figure 6 In F, G, and H).

[0181] Example 7. A prospective case-control study suggests that the key biological property of bone marrow SELENOP + macrophages, the GAS6-AXL axis, may be involved in the occurrence of poor engraftment and provides new ideas for treatment.

[0182] The present inventors included 6 PGF patients, 6 paired GGF patients, and 6 HDs in a prospective case-control study. Through phagocytosis experiments, it was found that the phagocytic ability of bone marrow macrophages in PGF patients was significantly reduced and could be restored by GAS6 protein ( Figure 7 In A); through in vitro co-culture experiments with CD34 + cells, it was found that the hematopoietic support ability of bone marrow macrophages in PGF patients was significantly reduced and could be restored by GAS6 protein ( Figure 7 In B, C, and D), specifically manifested as: AXL inhibitors significantly reduced the promoting effect of macrophages on the colony-forming ability of CD34 + cells, and GAS6 protein could compensate for this reduction; AXL inhibitors significantly reduced the promoting effect of macrophages on the proliferation ability of CD34 + cells, and GAS6 protein could compensate for this reduction; AXL inhibitors significantly reduced the inhibitory effect of macrophages on the apoptosis (mainly early apoptosis) ability of CD34 + cells, and GAS6 protein could compensate for this reduction. The above evidence suggests that the key biological property of bone marrow SELENOP + macrophages, the GAS6-AXL axis, may be involved in the occurrence of poor engraftment and provides new ideas for treatment.

[0183] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. A macrophage, characterized in that: The macrophage is bone marrow SELENOP + macrophage, and its immunophenotype is CD14 + CD68 + SELENOP + .

2. Bone marrow SELENOP + Use of macrophages and / or substances capable of activating the GAS6-AXL signaling axis in any of the following: (A1) Preparation of a product for the treatment or adjuvant treatment of bone marrow hematopoietic injury diseases; (A2) Preparation of a product for improving or delaying the progression of bone marrow hematopoietic injury diseases; (A3) Preparation of a product for repairing bone marrow macrophage injury; (A4) Preparation of a product for reducing complications in patients with blood diseases; The bone marrow SELENOP + Macrophage immunophenotype is CD14 + CD68 + SELENOP + .

3. Use of a substance capable of activating the GAS6-AXL signaling axis in any of the following: (B1) Preparation of a product for enhancing the phagocytic ability of specific bone marrow macrophages; (B2) Enhancing the phagocytic ability of specific bone marrow macrophages in vitro; (B3) Preparation of a product for enhancing the hematopoietic support ability of specific bone marrow macrophages; (B4) Enhancing the hematopoietic support ability of specific bone marrow macrophages in vitro; (B5) Preparation of a product for enhancing the promoting effect on the colony-forming ability of specific bone marrow macrophages against CD34 + cells; (B6)Enhance the promoting effect of specific bone marrow macrophages on the colony-forming ability of CD34 + cells in vitro; (B7) Preparation of a product for enhancing the promoting effect on the proliferation ability of specific bone marrow macrophages against CD34 + cells (B8)Enhance the promoting effect of specific bone marrow macrophages on the proliferation ability of CD34 + cells in vitro; (B9) Preparation of a product for enhancing the inhibitory effect on the apoptotic ability of specific bone marrow macrophages against CD34 + cells; (B10)Enhance the inhibitory effect of specific bone marrow macrophages on the apoptosis ability of CD34 + cells in vitro; The specific bone marrow macrophages are bone marrow macrophages derived from patients with bone marrow hematopoietic injury diseases or bone marrow macrophages treated with an AXL receptor inhibitor or bone marrow macrophages with targeted knockout or knockdown of AXL gene expression; The bone marrow SELENOP + macrophage immunophenotype is CD14 + CD68 + SELENOP + .

4. Any of the following methods: Method I: A method for enhancing the phagocytic ability of specific bone marrow macrophages in vitro, comprising the steps of: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, thereby improving the phagocytic ability of the specific bone marrow macrophages; Method II: A method for enhancing the hematopoietic support ability of specific bone marrow macrophages in vitro, comprising the steps of: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, thereby enhancing the hematopoietic support ability of the specific bone marrow macrophages; Method III: A method for enhancing the promoting effect of specific bone marrow macrophages on the colony-forming ability of CD34 + cells in vitro, comprising the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, thereby promoting the colony formation of CD34 + cells; Method IV: A method for enhancing the promoting effect of specific bone marrow macrophages on the proliferation ability of CD34 + cells in vitro, comprising the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, thereby promoting the proliferation of CD34 + cells; Method V: A method for enhancing the inhibitory effect of specific bone marrow macrophages on the apoptotic ability of CD34 + cells in vitro, comprising the following steps: treating specific bone marrow macrophages cultured in vitro with a substance capable of activating the GAS6-AXL signaling axis, and co-culturing the treated specific bone marrow macrophages with CD34 + cells, thereby inhibiting the apoptosis of CD34 + cells; The specific bone marrow macrophages are bone marrow macrophages derived from patients with bone marrow hematopoietic injury diseases or bone marrow macrophages treated with an AXL receptor inhibitor or bone marrow macrophages with targeted knockout or knockdown of AXL expression.

5. Use of a substance for detecting SELENOP in bone marrow + macrophages in any of the following: (C1) Preparation of a product for the diagnosis or adjuvant diagnosis of bone marrow hematopoietic injury diseases; (C2) Preparation of a product for differentiating or adjuvant differentiating patients with bone marrow hematopoietic injury diseases from healthy people; The bone marrow SELENOP + The immunophenotype of macrophages is CD14 + CD68 + SELENOP + .

6. Use of a specific substance in any of the following: (C1) Preparation of a product for the diagnosis or adjuvant diagnosis of bone marrow hematopoietic injury diseases; (C2) Preparation of a product for differentiating or adjuvant differentiating patients with bone marrow hematopoietic injury diseases from healthy people; The specific substance is any one of the following: a substance capable of detecting SELENOP in bone marrow + a substance capable of detecting the intensity of the GAS6 - AXL signaling axis in macrophages, a substance capable of detecting SELENOP in bone marrow + a substance capable of detecting the expression level of AXL in macrophages, a substance capable of detecting SELENOP in bone marrow + a substance capable of detecting the proportion of AXL - positive cells in macrophages, a substance capable of detecting AXL - positive SELENOP in bone marrow + a substance capable of detecting the proportion of macrophages in bone marrow mononuclear cells, a substance capable of detecting SELENOP in bone marrow + AXL in macrophages + CD163 + a substance capable of detecting the proportion of cells 7. Any of the following methods: Method VI: A method for constructing a bone marrow macrophage model with reduced phagocytic ability, comprising the steps of: treating bone marrow macrophages derived from healthy people with an AXL receptor inhibitor, thereby obtaining a bone marrow macrophage model with reduced phagocytic ability; Method VII: A method for constructing a bone marrow macrophage model with reduced hematopoietic support ability, comprising the steps of: treating bone marrow macrophages derived from healthy people with an AXL receptor inhibitor, thereby obtaining a bone marrow macrophage model with reduced hematopoietic support ability; Method VIII: A method for constructing a macrophage model with reduced hematopoietic support ability, comprising the steps of: knocking down the expression of AXL in macrophages, thereby obtaining a macrophage model with reduced hematopoietic support ability; Method IX: A method for constructing an animal model with reduced bone marrow hematopoietic ability, comprising the following steps: specifically knocking down the expression of the AXL gene in bone marrow macrophages of an animal, thereby obtaining an animal model with reduced bone marrow hematopoietic ability.

8. Use of the bone marrow macrophage model or animal model constructed by the method according to claim 7 in any one of the following: (D1) Screening for drugs capable of treating or assisting in the treatment of bone marrow hematopoietic injury diseases; (D2) Screening for drugs capable of improving or delaying the progression of bone marrow hematopoietic injury diseases; (D3) Screening for drugs capable of repairing bone marrow macrophage damage; (D4) Screening for drugs capable of reducing complications in patients with blood diseases.

9. A kit for screening drugs, comprising the following: (E1) The bone marrow macrophage model or animal model constructed by the method according to claim 7; (E2) A positive control; the positive control is a substance capable of activating the GAS6-AXL signaling axis or a substance capable of increasing the expression level of the AXL receptor; The drug is any one of the following: a drug capable of treating or assisting in the treatment of bone marrow hematopoietic injury diseases, a drug capable of improving or delaying the progression of bone marrow hematopoietic injury diseases, a drug capable of repairing bone marrow macrophage damage, a drug capable of reducing complications in patients with blood diseases.

10. The application, method or kit product according to any one of claims 2-9, characterized in that: The bone marrow hematopoietic injury diseases are selected from any one of the following: poor hematopoietic reconstitution after hematopoietic stem cell transplantation, aplastic anemia, poor hematopoietic reconstitution after remission of leukemia by chemotherapy; or The substance capable of activating the GAS6-AXL signaling axis is an AXL receptor agonist; Furthermore, the AXL receptor agonist is GAS6 protein.

Images