A molecular marker of the GPNMB gene related to pigeon breast width and its application
By screening the GPNMB gene molecular marker through whole genome resequencing and combining PCR and Sanger sequencing technology, the problem of slow progress in the selection and breeding of pigeon breast width traits was solved, early selection and efficient breeding were achieved, and breeding efficiency was improved.
Patent Information
- Application Number
- CN202510781398.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2045-06-12
AI Technical Summary
Existing technology makes it difficult to quickly and accurately select the chest width trait of pigeons, resulting in slow breeding progress and difficulty in meeting the needs of modern intensive and standardized production.
The GPNMB gene molecular marker related to the pigeon chest width trait was screened out through whole genome resequencing technology. Specific primers were used for PCR amplification and Sanger sequencing to detect the SNP genotype of the pigeon, and excellent individuals were selected for breeding based on the genotype.
It realizes the early selection of pigeon breast width traits, improves the accuracy and efficiency of breeding, saves breeding costs, and meets the needs of modern production.
Smart Images

Figure CN120290750B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a GPNMB gene molecular marker related to pigeon breast width traits and application thereof, belonging to the field of biotechnology. Background Art
[0002] The mainstream pigeon breeds currently in use are all purebreds imported from abroad, such as the White King Pigeon, Silver King Pigeon, and European Meat Pigeon. The pigeon industry's breeding and seed specialization levels are relatively low, making it difficult to meet the needs of modern intensive and standardized production.
[0003] Breast width is crucial in pigeon breeding and production, serving as a key economic performance indicator and one of the primary body size traits used in pigeon breed improvement and the development of new breeds (complementary lines). Conventional breeding methods, however, are characterized by long generation cycles and slow progress, making precise selection difficult. With the rapid development of modern biotechnology, molecular marker-assisted breeding has gained widespread application in the selection of new plant and animal varieties. Combined with conventional breeding techniques, molecular marker-assisted breeding can improve the accuracy of target trait selection, enable earlier selection, significantly accelerate breeding progress, reduce breeding costs, and improve breeding efficiency. However, relatively few molecular markers are currently associated with breast width in pigeons. Summary of the Invention
[0004] The purpose of the present invention is to address the defects of the existing technology, propose a GPNMB gene molecular marker related to the pigeon chest width trait and its application, and improve the breeding efficiency of pigeons.
[0005] GPNMB (Glycoprotein Non-Metastatic Melanoma Protein B) is a transmembrane protein that belongs to the melanoma-associated antigen family (MAMPs) and plays a key role in multiple physiological and pathological processes, including cell proliferation, differentiation, immune regulation and metabolic control.
[0006] IGF2BP3 (Insulin-like growth factor 2 mRNA-binding protein 3), located downstream of GPNMB, is an RNA-binding protein and member of the IGF2BP family. It plays a key role in regulating mRNA stability, localization, and translation. IGF2BP3 and the IGF2 signaling pathway it regulates play a crucial role in body weight development in mammals, birds, and fish.
[0007] The present invention records the breast width trait of pigeons, performs SNP genotyping using whole-genome resequencing technology, and obtains related GPNMB gene molecular markers through whole-genome association analysis, providing new gene and molecular marker resources for the selection and breeding of pigeons for the breast width trait.
[0008] The present invention solves the technical problem through the following technical solutions: First, a molecular marker of the GPNMB gene related to pigeon chest width and primers thereof are provided. The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The molecular marker is located at base 129265233 of chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 version (National Genome Science Data Center https: / / ngdc.cncb.ac.cn / gwh, accession number GWHFCQQ00000000.1), and the base mutation is C or T. The molecular marker is located at base 313 as shown in SEQ ID NO: 3 or SEQ ID NO: 4.
[0009] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to pigeon breast width traits, and the detection method comprises the following steps:
[0010] The first step is to provide a pigeon DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplified product. The amplified product is 425 bp in length and contains base 129,265,233 of pigeon chromosome 2;
[0011] Step 2: Sanger sequencing of the PCR product;
[0012] The third step is to determine the SNP molecular marker genotype of base 129265233 of chromosome 2 based on the sequencing peak graph.
[0013] The deoxyribonucleotide sequence of the pigeon DNA specific primer pair described in the first step is: Upstream primer: 5'-GCAGCTCCAGTTGTGTCTTC-3' (SEQ ID NO: 1)
[0014] Downstream primer: 5'-CAGACTCCCACTGCTCTAGG-3' (SEQ ID NO: 2)
[0015] The reaction system is based on 50 μl and is as follows:
[0016] 50 ng of pigeon DNA to be tested
[0017] Accurate Taq DNA Polymerase 1.25 IU
[0018] 5 μl 10X PCR reaction buffer containing Mg2+
[0019] 10mM dNTPs 1μl
[0020] 10μM upstream primer F 1μl
[0021] 10μM downstream primer R 1μl
[0022] Add sterile water to 50 μl;
[0023] The reaction conditions for the PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; and storage at 4°C. The nucleotide sequence of the amplified product was as shown in SEQ ID NO:3 or SEQ ID NO:4. The amplified product was 425 bp in length and contained bases 129,265,233 of pigeon chromosome 2.
[0024] In the third step, the judgment standard is that the chest width of pigeons with the T / T genotype at the SNP site is greater than that of the C / T genotype, and the chest width of individuals with the C / T genotype is greater than that of individuals with the C / C genotype.
[0025] The present invention detects the breast width trait of pigeons by the genotype of the GPNMB gene molecular marker, and obtains that the breast width of pigeons with T / T genotype is higher than that of individuals with C / T genotype and C / C genotype, and the breast width of pigeons with C / T genotype is higher than that of individuals with C / C genotype. By taking the genomic DNA of the pigeon to be tested as a template, adopting specific primers to carry out PCR amplification, and then carrying out Sanger sequencing and SNP genotyping of the PCR amplification product, the genotype based on the SNP molecular marker can be used to select the breast width trait of pigeons. For example, in breeding, it is necessary to cultivate pigeon varieties with higher breast width. By eliminating individuals with C / C and C / T genotypes and retaining individuals with T / T genotype, the beneficial effect is that early selection of the breast width trait of pigeons can be achieved, the accuracy of seed selection is improved, the breeding progress is accelerated, the breeding cost is saved, the breeding efficiency is improved, the breeding of pigeons is better served, and the breeding has higher economic application and scientific research value. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the result of genome-wide association analysis of pigeon breast width trait.
[0027] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION
[0028] The pigeon breeds used in the following examples are all commercially available and will not be described in detail.
[0029] Example 1
[0030] In this example, the chest width of three breeds of Danish Silver King pigeon, Thai Deep pigeon, and American Silver King pigeon at 150 weeks of age was measured. Whole-genome SNP genotyping was performed using second-generation sequencing technology, and related GPNMB gene molecular markers were screened through whole-genome association analysis. The results are as follows: Figure 1 shown.
[0031] In this example, the following experiments were conducted to identify and apply the GPNMB gene molecular marker related to the pigeon breast width trait.
[0032] 1. Phenotypic and genotypic testing
[0033] (1) Experimental materials and chest width phenotype determination
[0034] A total of 389 pairs of breeding pigeons were selected, including Danish Silver King Pigeon, Thai Deep Pigeon, and American Silver King Pigeon. The three breeds were similar in number and raised under the same feeding conditions with free access to food and water throughout the whole process. When the breeding pigeons were 150 weeks old, the body size of each pigeon was recorded after fasting for 12 hours after laying eggs, which was used as the phenotypic data of the pigeon's chest width.
[0035] (2) Genomic DNA extraction
[0036] Blood was collected from the subwing vein of the above pigeons and stored in EDTA anticoagulant, and genomic DNA was extracted using an Omiga brand blood extraction kit.
[0037] (3) PCR amplification
[0038] The fragment containing the 129265233rd base site of chromosome 2 was amplified using the genomic DNA extracted as a template.
[0039] Upstream primer: 5'-GCAGCTCCAGTTGTGTCTTC-3' (SEQ ID NO: 1)
[0040] Downstream primer: 5'-CAGACTCCCACTGCTCTAGG-3' (SEQ ID NO: 2)
[0041] The reaction system is based on 50 μl and is as follows:
[0042] 50 ng of pigeon DNA to be tested
[0043] Accurate Taq DNA Polymerase 1.25 IU
[0044] 10X PCR reaction buffer (containing Mg2+) 5μl
[0045] 10mM dNTPs 1μl
[0046] 10μM upstream primer F 1μl
[0047] 10μM downstream primer R 1μl
[0048] Add sterile water to 50 μl;
[0049] The reaction conditions for the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 60 sec, for a total of 27 cycles; 72°C extension for 5 min; and storage at 4°C. The sequence of the amplified product is shown in SEQ ID NO: 3
[0050] GCAGCTCCAGTTGTGTCTTCTTGGGGTAGATACTGTTTTGGTCAGCAATTAGGCAACTCGTCATGTTGCTTATCTGAGAGTAGCTTTTTCTGAGACAAAGGAAGTGTACTCTTTAAAATCTTTAGGTGGTTTATTTGTCAATGCAGCAGTTAGATTCCATTGTATAAAACTAAAGATGGGTGAAATGGAAGTTACAGCTGAAAATGCAAAAT CAAATTATAAAAATTTAATATTCTGACATGATATTTAAAGGAAGATAGTGCAAGCCATTCTGTGTACTTAGGTTAAAGGATAAAGAAAGTTCTTAAAATACACCCAAAATTTGGTTTCTATGCAAAAGCCTAAGATGTCTCTGAGTTCCTAACATGCAGCGTTTTACTGAAACAAGATGCTTTCTGCATATAACCTAGAGCAGTGGGAGTCTG
[0051] or SEQ ID NO:4
[0052] GCAGCTCCAGTTGTGTCTTCTTGGGGTAGATACTGTTTTGGTCAGCAATTAGGCAACTCGTCATGTTGCTTATCTGAGAGTAGCTTTTTCTGAGACAAAGGAAGTGTACTCTTTAAAATCTTTAGGTGGTTTATTTGTCAATGCAGCAGTTAGATTCCATTGTATAAAACTAAAGATGGGTGAAATGGAAGTTACAGCTGAAAATGCAAAAT CAAATTATAAAAATTTAATATTCTGACATGATATTTAAAGGAAGATAGTGCAAGCCATTCTGTGTACTTAGGTTAAAGGATAAAGAAAGTTCTTAAAATATACCCAAAATTTGGTTTCTATGCAAAAGCCTAAGATGTCTCTGAGTTCCTAACATGCAGCGTTTTACTGAAACAAGATGCTTTCTGCATATAACCTAGAGCAGTGGGAGTCTG
[0053] shown.
[0054] (4) Sanger sequencing and genotyping
[0055] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram was as follows: Figure 2 As shown, the genotyping data of the SNP molecular marker at base 129265233 of chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 version were obtained.
[0056] 2. Correlation Analysis
[0057] Correlation analysis was performed on 389 pairs of pigeons at 150 weeks of age with clear body phenotype records. Statistical analysis was performed using the ANOVA function in GraphPad Prism 9 statistical software, selecting the pairwise mean comparison mode for statistical analysis of genotypes and traits within the experimental pigeon population. P < 0.05 indicated significant differences. The results showed that breast width differed significantly among the three genotypes (P < 0.05). The average breast width of pigeons with the T / T genotype was 7.27 cm, significantly greater than that of the C / T genotype (6.95 cm) and the C / C genotype (6.66 cm) (P < 0.05). The C / T genotype had a larger breast width than the C / C genotype (P < 0.05). The results showed that the site at base 129265233 on chromosome 2 of the pigeon reference genome Cliv_NAU_1.0 was significantly associated with the pigeon chest width phenotype. According to actual breeding goals, T / T genotype individuals can be selected to breed pigeons with larger chest width, thereby improving the overall chest width and uniformity and improving breeding efficiency.
[0058] See Tables 1 and 2 for data.
[0059] genotype Number of individuals 150 weeks chest width / cm CV / % C / C 697 <![CDATA[6.66±0.40 a ]]> 6.0 C / T 68 <![CDATA[6.95±0.45 b ]]> 6.5 T / T 13 <![CDATA[7.27±0.44 c ]]> 6.1 Note: Data in the same column with the same letters indicate no significant difference, while data with different letters indicate significant difference (P<0.05).
[0060] genotype Male / only 150 weeks chest width / cm Female 150 weeks chest width / cm C / C 357 <![CDATA[6.71±0.42 a ]]> 340 <![CDATA[6.61±0.37 b ]]> C / T 32 <![CDATA[7.01±0.40 b ]]> 36 <![CDATA[6.89±0.49 ac ]]> T / T 6 <![CDATA[7.48±0.53 c ]]> 7 <![CDATA[7.09±0.28 a ]]> Note: Data in the same column with the same letters indicate no significant difference, while data with different letters indicate significant difference (P<0.05).
[0061] Example 2
[0062] Genotype frequencies of different varieties
[0063] 1. Blood Sample Collection
[0064] Blood samples were collected using the subwing vein blood collection method from six commercial pigeon breeds, including Danish Silver King, American Silver King, Taishen Pigeon, White Feather King Pigeon, Yellow Cardinal Pigeon, and Gray Feather King Pigeon; two domestic local breeds, including Tarim Pigeon and Shiqi Pigeon; and five lighter ornamental pigeon breeds, including Lady Pigeon, Angel Pigeon, Taihu Dove, Hibiscus Pigeon, and Fantail Pigeon. A total of 13 breeds of pigeons were collected and stored at -20℃ for future use.
[0065] 2. Extraction of Genomic DNA
[0066] Take the tissue sample obtained in step 1 and use the Omega brand tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure of the Omega brand.
[0067] 3. Genotype detection
[0068] Using the genomic DNA obtained in step 2 as a template, PCR amplification and Sanger sequencing were performed using a primer pair consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the individual's C / C genotype, C / T genotype, and T / T genotype.
[0069] 4. Results Analysis
[0070] Danish Silver King, American Silver King, Taishen, and White King are all popular meat pigeon breeds. After selective breeding for breast width, the T allele frequency in their populations accounts for a certain proportion. However, ornamental pigeon breeds such as Lady, Angel, Hibiscus, and Taihu Dove, which have not been bred for breast width, have lower T allele frequencies in their populations than these meat pigeon breeds. These results confirm that this SNP locus can be used as a molecular marker for the pigeon breast width trait.
[0071] variety C allele frequency T allele frequency Number of individuals Danish Silver King Pigeon 0.87 0.13 50 Thai Deep Pigeon 0.99 0.01 50 American Silver King Pigeon 0.97 0.03 50 Yellow Cardinal Pigeon 0.92 0.08 23 Gray King Pigeon 0.90 0.10 18 White-feathered king pigeon 0.85 0.15 9 Shiqi Pigeon 0.99 0.01 36 Tarim pigeon 0.98 0.02 28 Taihu Point Pigeon 1.00 0.00 15 Hibiscus Pigeon 1.00 0.00 15 Lady Pigeon 1.00 0.00 16 fantail pigeon 1.00 0.00 10 Angel Pigeon 1.00 0.00 18 .
[0072] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.
Claims
1. A primer for a molecular marker of the GPNMB gene associated with the pigeon breast width trait, characterized in that: The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO: 1 and SEQ ID NO:
2. The molecular marker is located at the 313th base shown in SEQ ID NO: 3 or SEQ ID NO: 4, and the base is C or T.
2. The application of a primer for the GPNMB gene molecule marker associated with the pigeon breast width trait according to claim 1, characterized in that: The primers are used for detecting the breast width trait of pigeons, and the detection method comprises the following steps: Step 1: PCR amplify the pigeon DNA sample using the primers shown in SEQ ID NOs: 1-2 to obtain an amplified product. The amplified product is 425 bp in length and contains base 313 of SEQ ID NO: 3 or SEQ ID NO:
4. Step 2: Sanger sequencing of the PCR product; The third step is to determine the molecular marker genotype of the 313th base shown in SEQ ID NO: 3 or SEQ ID NO: 4 based on the sequencing results of the second step.
3. The application of the primers for the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 2, characterized in that: The reaction system is 50 μl. 50 ng of pigeon DNA to be tested Accurate Taq DNA Polymerase 1.25 IU 5 μl 10X PCR reaction buffer containing Mg2+ 10mM dNTPs 1μl 10 μM upstream primer F 1 μl 10μM downstream primer R 1μl Make up to 50 μl with sterile water.
4. The application of the primers for the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 3, characterized in that: The reaction conditions of the PCR amplification were as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 sec, annealing at 60° C. for 30 sec, and extension at 72° C. for 60 sec, for a total of 30 cycles; extension at 72° C. for 5 min; and storage at 4° C.
5. The application of the primers for the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 3, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:
4.
6. The application of the primers for the GPNMB gene molecular marker related to the pigeon breast width trait according to claim 2, characterized in that: The judgment criterion of the third step is that the chest width of pigeons with the T / T genotype at the SNP site is greater than that of individuals with the C / T genotype and the C / C genotype, and the chest width of individuals with the C / T genotype is greater than that of individuals with the C / C genotype.
Citation Information
Patent Citations
IGF2BP3 gene molecular marker primer related to pigeon body weight character and application of IGF2BP3 gene molecular marker primer
CN120174116A