RPA primer / probe combination for detecting rhizoctonia solani AG-3 TB and application of RPA primer / probe combination

Abstract

The invention provides an RPA primer / probe combination for detecting rhizoctonia solani AG-3TB and application of the RPA primer / probe combination, and belongs to the technical field of phytopathogen detection. The RPA primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 2; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 5; the nucleotide sequence of the probe is as shown in SEQ ID NO. 7. According to the present invention, based on the AG-3TB subgroup strain whole gene series, the specific fluorescent primer and the probe are autonomously designed, the efficient and sensitive method suitable for rapid detection is developed, the specificity is strong, and the AG-3TB subgroup can be distinguished.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant pathogen detection, and particularly relates to an RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB and its application. Background Art

[0002] RPA (Recombinase Polymerase Amplification) amplification has been widely used in the detection of various plant pathogens. By integrating with the lateral flow dipstick (LFD) technology, the detection results can be visually read out. Rhizoctonia solani includes R. solani AG-3, which consists of three subgroups: AG-3 TB, AG-3 TM, and another subgroup of AG-3, AG-3PT (causing potato black scurf), and the genetic relationship among them is relatively close. It is found that tobacco target spot disease is mainly composed of two subgroups (AG-3 TB and AG-3 TM), and shows obvious north-south distribution differences. However, currently, for the rapid detection methods of LAMP, LFD-RPA, and LFD-RAA for tobacco target spot disease (Li Ping, Yin Xiujuan, Wang Ying, Zhou Xiangping, Liu Tianbo, Zhong Jie, Xiao Yansong. 2024. Rapid and accurate detection of tobacco target spot pathogen based on loop-mediated isothermal amplification technology (English) [J]. Agricultural Science & Technology. 25(4): 27–32; Li Yanyan, Qiu Mengjuan, Li Xihong, Zhang Yiqian, Xu Tingting, Xu Rubing, Ma Pan, Zheng Lu, Li Lunan, Huang Junbin. 2023. Establishment of a rapid LFD-RPA detection method for tobacco target spot disease [J]. Chinese Tobacco Science. 44(5): 62–69; Xiao Yansong, Li Hongguang, Li Sijun, Wu Wenxin, Zhou Lusu, Zhong Jie, Su Jiaen, Yang Zhijuan. 2024. Establishment of a rapid LFD-RAA detection method for tobacco wildfire pathogen (English) [J]. Agricultural Science & Technology. 25(2): 38–43), the subgroups are not clearly identified, that is, they are non-specific, or there is a problem of low detection rate in field detection. After analysis, it is found that, in fact, these detection techniques are only for AG-3 and do not distinguish subgroups. For example, detecting the AG-3 PT subgroup that causes potato black scurf in the field also belongs to AG-3, but it is not the pathogen of tobacco target spot disease. Tobacco target spot disease caused by AG-3 TB is mainly distributed in the southern tobacco-growing areas (south of the Yellow River). Therefore, it is urgent to develop an RPA molecular detection technology that can distinguish the AG-3TB subgroup of Rhizoctonia solani. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide an RPA primer / probe combination for detecting Rhizoctonia solani AG-3 TB and its application. Based on the whole genome sequences of AG-3 TB subgroup strains, the present invention independently designs specific fluorescent primers and probes, and develops a highly efficient, sensitive method suitable for rapid field detection, with extremely high specificity and capable of specifically distinguishing the AG-3 TB subgroup from Rhizoctonia solani AG-3.

[0004] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides an RPA primer / probe combination for detecting Rhizoctonia solani AG-3 TB, and the RPA primer includes an upstream primer and a downstream primer;

[0006] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2;

[0007] The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.5;

[0008] The nucleotide sequence of the probe is as shown in SEQ ID NO.7.

[0009] Preferably, the 31st base at the 5' end of the probe is linked to a fluorescent group, the 32nd base at the 5' end of the probe is linked to a quenching group, and a tetrahydrofuran is linked between the 31st base and the 32nd base at the 5' end.

[0010] Preferably, the 3' end of the probe is labeled with C3spacer.

[0011] Preferably, the fluorescent group is FAM and the quenching group is BHQ1.

[0012] The present invention provides an RPA kit for detecting Rhizoctonia solani AG-3 TB, and the kit includes the above-mentioned RPA primer / probe combination, buffer solution and water.

[0013] The present invention also provides a detection method for Rhizoctonia solani AG-3 TB, including the following steps:

[0014] (6.1) Extract genomic DNA of the sample to be tested;

[0015] (6.2) Perform an amplification reaction on the genomic DNA of the sample to be tested using the above-mentioned RPA kit, collect fluorescence signals, and if a fluorescence value appears, it indicates that the test sample is positive.

[0016] Preferably, in a 50 μL amplification reaction system, it includes: 29.4 μL of buffer A, 0.6 μL of probe, 8.5 μL of water, 2.5 μL of buffer B, 2 μL of upstream primer, 2 μL of downstream primer, and 5 μL of genomic DNA of the sample to be tested.

[0017] Preferably, buffer A is a buffer agent with the main component of PEG; buffer B is an activator with the main component of magnesium acetate.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an RPA primer / probe combination for detecting Rhizoctonia solani AG-3 TB and its application. Based on the whole genome sequence of AG-3 TB subgroup strains, the present invention independently designs specific fluorescent primers and probes, and develops a highly efficient, sensitive method suitable for rapid field detection, with extremely high specificity, and can specifically distinguish the AG-3 TB subgroup from Rhizoctonia solani AG-3, and distinguish the AG-3 TB subgroup from AG-3 TM and AG-3 PT. Moreover, when using the RPA primer / probe combination of the present invention to detect AG-3 TB, the concentration range is between 0.02 ng / μL and 0.08 ng / μL. Description of the Drawings

[0019] Figure 1 For primer screening of RPA for detecting Rhizoctonia solani AG-3 TB, where Sample 1 is SN-1-R1 + SN-1-F3 + SN-1-Probe; Sample 2 is SN-1-R2 + SN-1-F3 + SN-1-Probe;

[0020] Figure 2 For the specificity of RPA for detecting Rhizoctonia solani AG-3 TB, where Sample 1 is AG-3-TB; Sample 2 is ddH2O; Sample 3 is AG-4; Sample 4 is AG-2-1; Sample 5 is AG-K; Sample 6 is AG-8; Sample 7 is AG-3 TM; Sample 8 is AG-3 PT; Sample 9 is AG-5;

[0021] Figure 3Primer screening and specificity for the detection of Rhizoctonia solani AG-3TB by RPA. Here, Sample 1 is AG-3-TB; Sample 2 is ddH2O; Sample 3 is AG-4; Sample 4 is AG-2-1; Sample 5 is AG-K; Sample 6 is AG-8; Sample 7 is AG-3TM; Sample 8 is AG-3PT; Sample 9 is AG-5;

[0022] Figure 4 Sensitivity of RPA for the detection of Rhizoctonia solani AG-3TB. Here, A is the detection result at an initial concentration of 800 ng / μL; B is the detection result at an initial concentration of 0.8 ng / μL; C is the detection result at an initial concentration of 0.2 ng / μL; D is the detection result at an initial concentration of 0.1 ng / μL; E is the detection result at an initial concentration of 0.08 ng / μL; F is the detection result at an initial concentration of 0.02 ng / μL; G is the detection result at an initial concentration of 0.002 ng / μL;

[0023] Figure 5 Specificity detection results of RPA for Rhizoctonia solani AG-3TB. Here, A is YN-159 (AG-3TB); B is 59 (AG-3PT); C is 112 (AG-3PT); D is JL-20 (AG-3TM); E is LN-10 (AG-3TM); F is Corynespora cassiicola; G is Botrytis cinerea; H is Phytophthora parasitica var. nicotianae; I is Thielaviopsis basicola;

[0024] Figure 6 Specificity detection results of RPA for Rhizoctonia solani AG-3TB. Here, A is YN-159 (AG-3TB); B is SC-11 (AG-3TB); C is CQ-39 (AG-3TB); D is GZ-6 (AG-3TB); E is HN-13 (AG-3TB); F is GX-2-3 (AG-3TB); G is AG-1-ⅠA; H is AG-9; I is AG-P; J is AG-6; K is AG-Fa; L is AG-A; M is ddH2O;

[0025] Figure 7The RPA specific detection results for Rhizoctonia solani AG-3TB, where A is YN-1(AG-3TB); B is YN-29(AG-3TB); C is YN-128(AG-3TB); D is YN-85(AG-3TB); E is HN-20(AG-3TB); F is HN-58(AG-3TB); G is HN-85(AG-3TB); H is SC-24(AG-3TB); I is SC-31(AG-3TB); J is CQ-1(AG-3TB); K is CQ-16(AG-3TB); L is GZ-1(AG-3TB); M is GX-4-2(AG-3TB); N is 43(AG-3PT); O is 622(AG-3PT); P is LN-2(AG-3TM); Q is HLJ-4(AG-3TM); R is Alternaria alternata (Fr.) Keissl. Detailed implementation mode

[0026] The present invention provides an RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB, and the RPA primer includes an upstream primer and a downstream primer;

[0027] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, specifically as follows:

[0028] TTCAACTTGAAGTGAACAATTTCTGGGCT;

[0029] The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.5, specifically as follows:

[0030] TTAGCTAAAACAACTGAAATTCAAGTCAA;

[0031] The nucleotide sequence of the probe is as shown in SEQ ID NO.7, specifically as follows:

[0032] CAGATGAGGATGACATGAACTTCAAACAAT[FAM-dT][THF][BHQ1-dT]GACTTGATTAGTGA-C3spacer.

[0033] In the present invention, the 31st base at the 5' end of the probe is linked to a fluorescent group, the 32nd base at the 5' end of the probe is linked to a quenching group, and tetrahydrofuran is linked between the 31st base and the 32nd base at the 5' end; the 3' end of the probe is labeled with C3spacer; the fluorescent group is FAM, and the quenching group is BHQ1.

[0034] The present invention provides an RPA kit for detecting Rhizoctonia solani AG-3TB, and the kit includes the RPA primer / probe combination, buffer, and water.

[0035] In the present invention, the buffer includes buffer A and buffer B, where buffer A is a buffer agent with the main component being PEG; buffer B is an activator with the main component being magnesium acetate.

[0036] The present invention also provides a method for detecting Rhizoctonia solani AG-3TB, including the following steps:

[0037] (6.1) Extract the genomic DNA of the sample to be tested;

[0038] (6.2) Use the RPA kit to perform an amplification reaction on the genomic DNA of the sample to be tested, collect the fluorescence signal, and the presence of a fluorescence value indicates that the test sample is positive.

[0039] In the present invention, extract the genomic DNA of the sample to be tested; after activating and culturing the strain on water agar medium at 23°C for 24 h, pick the tip hyphae, inoculate them into a new water agar medium, repeat three times, pick the marginal hyphae purified in the last time, place them in the center of a layer of cellophane laid on a PDA plate, and culture them in the dark in an incubator at 28°C for 3 d. When the hyphae are about to cover the dish, collect the hyphae under sterile conditions. Use the CTAB method to extract genomic DNA.

[0040] In the present invention, use the RPA kit to perform an amplification reaction on the genomic DNA of the sample to be tested, collect the fluorescence signal, and the presence of a fluorescence value indicates that the test sample is positive; use TwistAmp Liquid exo Kit for isothermal amplification. The amplification reaction system is calculated based on 50 μL and includes: 29.4 μL of buffer A, 0.6 μL of probe, 8.5 μL of water, 2.5 μL of buffer B, 2 μL of upstream primer, 2 μL of downstream primer, and 5 μL of genomic DNA of the sample to be tested; the amplification program is: constant temperature at 39°C; reaction time is 20 min; collect the fluorescence signal every 30 s; buffer A is a buffer agent with the main component being PEG; buffer B is an activator with the main component being magnesium ion.

[0041] The following combines examples to detail the technical solutions provided by the present invention, but they cannot be understood as limiting the protection scope of the present invention.

[0042] Preparation of PDA medium: Weigh 200 g of potato, 20 g of glucose, and 18 g of agar powder, place them in 1 L of water, sterilize at 120°C for 20 min, and perform high-temperature and high-pressure sterilization to obtain PDA medium.

[0043] Preparation of water agar medium: Weigh 20 g of 1% water agar medium (WA) agar powder (Agar) and dissolve it in 1 L of water. Sterilize it at 120 °C for 20 min by high-temperature and high-pressure sterilization to obtain the water agar medium.

[0044] The PDA medium or plate and water agar medium used in the subsequent examples were all prepared by this method.

[0045] Examples

[0046] 1. Test strains and reagents

[0047] Test strains: Select 19 R. solani AG-3TB strains from different sampling areas to verify specificity. Control strains are: 4 R. solani AG-3PT, 4 R. solani AG-3TM, other anastomosis groups (R. solani AG-1-ⅠA, AG-6, AG-A, AG-9, AG-P, AG-Fa, AG-4, AG-5, AG-8, AG-K or AG-2-1); the main pathogenic bacteria on tobacco include Alternaria alternata, Fusarium oxysporum, Phytophthora parasitica var. nicotianae, Corynespora cassiicola, and Botrytis cinerea (control strain of other fungi); negative control ddH2O.

[0048] Reagents: TwistAmp Liquid exo Kit (fluorescent type) constant temperature rapid amplification kit was purchased from Amp Future (Changzhou) Biotechnology Co., Ltd.

[0049] 2. Extraction of pathogen genome

[0050] Activate the above strain on water agar medium. After culturing at 23 °C for 24 h, pick the tip hyphae and activate them on a new water agar medium, repeating three times. Pick the edge hyphae purified in the last time and place them in the center of a layer of cellophane laid on a PDA plate. Culture them in the dark in an incubator at 28 °C for 3 d. When the hyphae are about to cover the dish, collect the hyphae under sterile conditions. Use the CTAB method to extract genomic DNA (Kerényi Z, Zeller K, Hornok L, Leslie JF. 1999. Molecular standardization of mating type terminology in the gibberella fujikuroi species complex[J]. Applied and Environmental Microbiology. 65(9):4071–4076.).

[0051] 3. Primer design and probe design

[0052] Based on the whole genome of AG-3TB, sequence alignment was performed to screen out specific multi-copy sequences for RPA molecular detection. Sequences with a fragment length exceeding 150 bp and containing more than 2 high-confidence hits (E value < 0.01) were screened. The overlapping multi-copy sequences were merged using bedtools (v2.30.0). According to the folded region, potential multi-copy sequences were obtained using samtools (1.9). The aligned multi-copy sequences were respectively aligned in NCBI to find sequences with a large number of copies and strong specificity in the AG-3TB genome (Method reference: Wang Rongsheng, Shan Weixing. 2019. Construction of a detection system for Phytophthora parasitica based on multi-copy sequence amplification[C] / / Proceedings of the 2019 Annual Conference of the Chinese Society of Plant Pathology).

[0053] The specific multi-copy sequence aligned by the above method is: AGCAACAAAATTCACTTGATTTTCACACCTTTTCAACTTGAAGTGAACAATTTCTGGGCTGATTTTCAGGTTTTGTGAAAAAAAAAATCACATGTGAATTTTAACTTTGGGAGTAGTAAGTGAATTGGAAATTGCAAAAATCAGATGAGGATGACATGAACTTCAAACAATTATGACTTGATTAGTGAAACTCCCAGTTTTTTGACTTGAATTTCAGTTGTTTTAGCTAACCCAGAG (SEQ ID NO.1), the copy number is 19, and the fragment length is 237 bp.

[0054] To screen out the best primer and probe combinations for AG-3, 1 probe, 3 forward primers, and 2 reverse primers were designed based on the SEQ ID NO.1 sequence for the optimization of the RPA reaction system. The design of the primers and probes is shown in Table 1. The primers were designed using Primer Premier 5.0 software (method reference: Ren L, Zhu BQ, Zhang YB, Wang HY, Li CY, Su Y, Ba CF. 2004. The research of applying primer premier 5.0 to design PCR primer[J]. J Jinzhou Med Coll. 25:43–46.).

[0055] Table 1 Design of primers and probes for AG-3TB RPA reaction

[0056]

[0057] 4. RPA detection method

[0058] Isothermal amplification was performed using the TwistAmp Liquid exo Kit. The amplification system was calculated as 50 μL: 29.4 μL of buffer A (A buffer), 0.6 μL of probe, 8.5 μL of ddH2O, 2.5 μL of buffer B (B buffer), 2 μL of each upstream and downstream primer, and 5 μL of DNA template (2. DNA extracted in the genomic DNA extraction of pathogens). The amplification program was: constant temperature at 39°C; fluorescence signals were collected every 30 s; the reaction time was 20 min.

[0059] 5. Screening of primers

[0060] Using the primers and probes designed in Table 1, the RPA detection method was used to screen the primers. The results are shown in Figures 1 to 3 .

[0061] It can be seen from Figures 1 to 3 that in the initial screening of the designed primers, the one with the best amplification performance is SN-1-R2 + SN-1-F3 + SN-1-Probe ( Figure 1 Sample 2 in), but the primer-probe combination with the best amplification performance has positive results in the detection of multiple specific samples ( Figure 2 ), so it needs to be eliminated; after screening, the SN-1-R1 + SN-1-F1 + SN-1-Probe combination detected that the original concentration of HN-2 nucleic acid (AG-3TB) was a positive result, and the nucleic acids of other specific samples were all negative results. Therefore, the SN-1-R1 + SN-1-F1 + SN-1-Probe ( Figure 3 ) primers were selected for subsequent experiments.

[0062] 6. Evaluation of RPA Detection Sensitivity

[0063] Select YN-159 (R. solani AG-3 TB) as the DNA template and dilute it with ddH2O. The initial concentration is 800 ng / μL, and the final diluted concentrations are 0.8 ng / μL, 0.2 ng / μL, 0.1 ng / μL, 0.02 ng / μL, 0.08 ng / μL, and 0.002 ng / μL. Each treatment has 2 replicates, and the results are shown in Figure 4 .

[0064] As can be seen from Figure 4 , the initial concentration was diluted successively and the operation was repeated 2 times. The results showed that the concentration range detected by RPA was between 0.02 ng / μL and 0.08 ng / μL.

[0065] 7. Evaluation of RPA Detection Specificity

[0066] Select common tobacco fungal diseases similar to the symptoms of tobacco target spot disease, as well as the pathogen DNAs of different anastomosis groups (1. Test strains and strains in the reagents), and carry out specificity detection. The results are shown in Figures 5 to 7 .

[0067] As can be seen from Figures 5 to 7 , 19 AG-3-TB strains, 4 AG-3-TM strains, 4 AG-3-PT strains and other test strains were subjected to specificity detection. The results showed that only the AG-3TB strain had an amplification curve, and the other strains had no reaction. The primers and probes of the present invention can efficiently amplify the AG-3-TB strain.

[0068] The present invention first develops a new molecular detection technology (RPA isothermal amplification technology) for the three subgroups of R. solani AG-3. According to the R. solani AG-3TB genome, multi-copy specific sequences are found, and the AG-3TB subgroup is detected sensitively, efficiently and specifically. The results show that the primers and probes of the present invention have high sensitivity and can detect DNA concentrations between 0.02 ng / μL and 0.08 ng / μL.

[0069] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB, characterized in that, The RPA primers include a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.5; The nucleotide sequence of the probe is shown in SEQ ID NO.

7.

2. The RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB according to claim 1, wherein The 31st base at the 5'-end of the probe is linked to a fluorophore, the 32nd base at the 5'-end of the probe is linked to a quencher, and a tetrahydrofuran is linked between the 31st base at the 5'-end and the 32nd base at the 5'-end.

3. The RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB according to claim 2, wherein The 3'-end of the probe is labeled with C3spacer.

4. The RPA primer / probe combination for detecting Rhizoctonia solani AG-3TB according to claim 2, characterized in that, The fluorophore is FAM and the quencher is BHQ1.

5. An RPA kit for detecting Rhizoctonia solani AG-3TB, characterized in that, The kit includes the RPA primer / probe combination, buffer, and water as claimed in claim 1.

6. A detection method for Rhizoctonia solani AG-3TB, characterized in that, It includes the following steps: (6.1) Extract genomic DNA of the sample to be tested; (6.2) Use the RPA kit as claimed in claim 5 to perform an amplification reaction on the genomic DNA of the sample to be tested, collect fluorescence signals, and the presence of a fluorescence value indicates that the test sample is positive.

7. The detection method according to claim 6, characterized in that, The system of the amplification reaction is calculated as 50 μL and includes: 29.4 μL of buffer A, 0.6 μL of probe, 8.5 μL of water, 2.5 μL of buffer B, 2 μL of forward primer, 2 μL of reverse primer, and 5 μL of genomic DNA of the sample to be tested.

8. The detection method according to claim 7, characterized in that, Buffer A is a buffer agent, and its main component is PEG; buffer B is an activator, and its main component is magnesium acetate.

Images