A recombinant bacillus subtilis displaying prrsv er protein on spore surface, construction method and application
By using recombinant strains that display the PRRSV ER protein on the surface of Bacillus subtilis spores, the safety concerns and complex vaccination issues of existing vaccines have been addressed, simplifying the immunization procedure and achieving a highly efficient mucosal immune response, thereby enhancing the protective ability against PRRSV.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SICHUAN AGRI UNIV
- Filing Date
- 2025-04-28
- Publication Date
- 2026-07-21
AI Technical Summary
Existing PRRSV vaccines, especially live attenuated vaccines, have safety concerns and difficulty in distinguishing between vaccine virus and wild virus infection, leading to an exacerbation of the PRRSV epidemic. Furthermore, traditional vaccination procedures are complex and result in significant immune stress responses.
A recombinant Bacillus subtilis strain displaying PRRSV ER protein was constructed. The ER gene was fused with the spore capsid protein CotB using genetic engineering methods, and then integrated into Bacillus subtilis 168 using the integrative plasmid pDG364 to achieve the display of the PRRSV ER antigen protein.
It simplifies the immunization process, reduces immune stress, ensures antigen stability and immunization efficacy, maintains immunogenicity under extreme conditions, induces specific mucosal immune responses, and activates humoral and cellular immune responses through oral administration, significantly improving protection against PRRSV.
Smart Images

Figure CN120310816B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant Bacillus subtilis strain displaying PRRSV ER protein on the surface of spores, its construction method, and its application. Background Technology
[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is a major infectious disease that causes reproductive disorders in pregnant sows and respiratory symptoms in pigs of all ages. It is also known as blue ear disease in pigs. In pregnant sows, the disease manifests as decreased farrowing rates, abortions, stillbirths, and weak piglets, with rates reaching 30%–100%. In finishing pigs, the disease presents with respiratory distress, multiple secondary infections, slow growth, and reduced feed efficiency. PRRSV was first discovered in the United States in the 1990s and has since been found worldwide. In recent years, a series of NADC30-type PRRSV strains with Chinese characteristics have been derived from NADC30, HP-PRRSV, NADC34, and QYYZ-type PRRSV strains as backbones or donors. These strains have attracted significant attention due to their high recombination and mutation rates, resulting in the coexistence of multiple strains clinically, which increases the difficulty of PRRS prevention and control in my country.
[0003] Currently, my country has two types of PRRSV vaccines: inactivated vaccines and live attenuated vaccines. Compared to inactivated vaccines, live attenuated vaccines are more widely used, offer stronger protection against susceptible pigs, and have a shorter duration of viremia and shedding period. Live attenuated vaccines provide superior protection compared to inactivated vaccines, and their effectiveness is more pronounced when the strains are homologous. Inactivated vaccines are relatively safe, but their protective efficacy is weak, often requiring multiple immunizations. Live attenuated vaccines, however, pose certain safety risks, as immunized pigs can shed the virus, and the virus virulence may revert to its previous state. In particular, the use of live attenuated vaccines makes it difficult to assess the prevalence of PRRSV, and it is challenging to distinguish whether antibodies in pig populations are produced by the vaccine strain or wild-type virus infection. Furthermore, the virus shed from the animal after immunization can spread in the environment, making differentiation from wild-type viruses even more difficult. Vaccine strains frequently recombine with wild-type viruses to form new pathogenic PRRSV strains, exacerbating PRRSV outbreaks and causing more severe economic losses. Summary of the Invention
[0004] The purpose of this invention is to provide a recombinant Bacillus subtilis strain displaying PRRSV ER protein on the spore surface, its construction method, and its application.
[0005] The present invention adopts the following technical solution: An ER gene, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0006] A recombinant Bacillus subtilis containing the aforementioned ER gene.
[0007] Furthermore, the recombinant Bacillus subtilis was obtained by fusing the spore capsid protein CotB with the ER gene using the integration vector pDG364, and then transferring the resulting fusion gene CotB-ER into Bacillus subtilis 168.
[0008] A method for constructing the above-mentioned recombinant Bacillus subtilis includes the following steps: (1) Synthesize the ER gene and further synthesize it into the pUCm-T vector. Transform the vector into Escherichia coli competent cells DH5α to obtain the recombinant plasmid pUCm-T-ER1. (2) The recombinant plasmid pUCm-T-ER1 and the Escherichia coli expression plasmid pET-32a were digested with KpnI and XhoI, and the ER fragment and linearized plasmid pET-32a were recovered by gel extraction. They were then ligated with DNA ligase and transformed into competent cells of Escherichia coli BL21 strain to obtain the recombinant expression plasmid pET-32a-ER1. (3) Using the recombinant expression plasmid pET-32a-ER1 obtained in step (2) as a template, PCR was performed using ER-F2 primers and ER-R2 primers to change the restriction sites. The obtained product was cloned into the pUCm-T vector by TA and transformed into Escherichia coli competent cells DH5α to obtain the recombinant plasmid pUCm-T-ER2. (4) The recombinant plasmid pUCm-T-ER2 and the recombinant integrative plasmid pDG364-CotB were digested with HindIII and EcoRI, and the ER fragment and pDG364-CotB were recovered by gel extraction, then ligated with DNA ligase and transformed into Escherichia coli DH5α to obtain the recombinant integrative plasmid pDG364-CotB-ER2. (5) The recombinant plasmid pDG364-CotB-ER2 was transformed into Bacillus subtilis 168 competent cells by chemical transformation. Through screening, recombinant Bacillus subtilis displaying PRRSV ER antigen protein on the spore surface was obtained.
[0009] Furthermore, the nucleotide sequence of the ER-F2 primer is shown in SEQ ID No. 4.
[0010] Furthermore, the nucleotide sequence of the ER-R2 primer is shown in SEQ ID No. 5.
[0011] The application of the above-mentioned ER gene in the preparation of a vaccine against porcine reproductive and respiratory syndrome.
[0012] The application of the above-mentioned recombinant Bacillus subtilis in the preparation of a vaccine against porcine reproductive and respiratory syndrome.
[0013] The application of the above-mentioned recombinant Bacillus subtilis in the preparation of oral vaccines and probiotic vaccines against porcine reproductive and respiratory syndrome virus infection.
[0014] The beneficial effects of this invention are as follows: (1) The recombinant Bacillus subtilis displaying PRRSV ER protein on the spore surface in this embodiment of the invention was constructed by genetic engineering based on the integrative plasmid pDG364, which uses the spore capsid protein CotB as an anchor protein to display the PRRSV ER antigen protein on the spore surface. The recombinant vector was then transformed into wild-type Bacillus subtilis 168 by chemical transformation to obtain a genetically engineered Bacillus subtilis strain capable of displaying the porcine PRRSV ER antigen protein on the spore surface. In other words, this invention fuses the ER gene with the spore capsid protein CotB encoding gene using genetic engineering, uses the Bacillus subtilis integrative plasmid as a vector, and transforms it into Bacillus subtilis strain 168, thereby obtaining a genetically engineered Bacillus subtilis strain capable of displaying the PRRSV ER protein on the spore surface.
[0015] (2) The recombinant Bacillus subtilis of the present invention directly displays the antigen protein on the surface of the spores without the need for crushing. It can be directly mixed into feed or administered to animals via drinking water, which can significantly simplify the immunization procedure, reduce immune stress, and save labor costs. At the same time, compared with common genetically engineered bacteria such as lactobacilli, lactococci, or enterococci that use them as expression vectors, the spores of recombinant Bacillus subtilis can maintain immunogenicity under extreme conditions, avoiding antigen inactivation or degradation caused by production, transportation, or the digestive tract environment, ensuring its effective concentration in the body, inducing specific mucosal immunity in the intestine, reducing losses during production and application, and ensuring economic benefits at each stage.
[0016] (3) The Bacillus subtilis used in this invention is an internationally recognized edible probiotic with a clear genetic background and non-invasiveness, which can be used to develop commercial vaccines.
[0017] (4) The present invention uses an integrative recombinant plasmid to display antigen protein on the surface of spores, which can directly integrate the target gene into the genome of Bacillus subtilis strain 168, making it genetically stable and not lost during the passage process.
[0018] (5) Application experiments in mammals, represented by mice, showed that the recombinant Bacillus subtilis could induce a specific immune response in mice, with serum IgG levels and sIgA levels in intestinal contents significantly higher than the control. Feeding the recombinant Bacillus subtilis also had varying degrees of effect on different cytokines in the intestinal mucosa of mice. Flow cytometry experiments showed that the recombinant Bacillus subtilis could also regulate the differentiation ratios of CD3+, CD4+, and CD8+ cells to some extent. This provides a new approach for the prevention and treatment of PRRSV. Attached Figure Description
[0019] Figure 1 This is a schematic diagram of the ER genome and protein structures predicted by Alphfold3 and Pymol in an embodiment of the present invention.
[0020] Figure 2 This is a schematic diagram of agarose gel electrophoresis of ER in an embodiment of the present invention.
[0021] Figure 3 This is a schematic diagram of the SDS-PAGE and WB assay results of prokaryotic expression of ER protein in an embodiment of the present invention.
[0022] Figure 4 This is a schematic diagram of the integrated plasmid pDG364-CotB-ER2 in an embodiment of the present invention.
[0023] Figure 5 This is a schematic diagram illustrating the double enzyme digestion verification results of the integrated plasmid pDG364-CotB-ER2 in an embodiment of the present invention.
[0024] Figure 6 This is a schematic diagram illustrating the process of ER gene integration into the Bacillus subtilis 168 genome in an embodiment of the present invention.
[0025] Figure 7 This is a schematic diagram of the amylase activity screening test of recombinant genetically engineered bacteria in an embodiment of the present invention.
[0026] Figure 8 This is a schematic diagram of the genomic PCR identification results of recombinant genetically engineered bacteria in an embodiment of the present invention.
[0027] Figure 9 This is a schematic diagram of the immunofluorescence assay of recombinant genetically engineered bacteria according to an embodiment of the present invention.
[0028] Figure 10 This is a schematic diagram illustrating the differentiation ratios of CD3+, CD4+, and CD8+ cell populations in the intestinal lymph nodes of mice after oral administration of recombinant Bacillus subtilis, as determined by flow cytometry in an embodiment of the present invention.
[0029] Figure 11This is a schematic diagram showing the serum IgG level and the sIgA level of the intestinal contents of mice induced by oral administration of recombinant Bacillus subtilis in an embodiment of the present invention.
[0030] Figure 12 This is a schematic diagram showing the levels of various cytokines in the ileum tissue of mice after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention.
[0031] Figure 13 This is a schematic diagram showing the levels of various cytokines in the serum of mice after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention.
[0032] Figure 14 This is a schematic diagram showing the results of detecting the level of neutralizing antibodies in mouse serum after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention. Detailed Implementation
[0033] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention. It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other.
[0034] I. Biomaterials involved in this invention (1) Bacillus subtilis strain 168: preserved by the Fermentation Engineering Laboratory of the Microecology Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0035] (2) Escherichia coli BL21 ( Escherichia coli BL21), Escherichia coli DH5α ( Escherichia coli DH5α and plasmid pET-32a(+): both were purchased from TaKaRa Biotechnology (Beijing) Co., Ltd.
[0036] (3) Recombinant integrated plasmid pDG364-CotB: constructed and preserved by the Fermentation Engineering Laboratory of the Microecology Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0037] (4) PRRSV and Marc-145 cells: provided by the Pig Farm Health Testing and Evaluation Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0038] II. ER gene Using the NADC30-Like strain (Gene Bank: KF611905.1) as a template, conserved fragments of ORF1b, GP5, M, and N from the viral genome were selected. The portions containing B-cell and T-cell epitopes were then extracted. These four gene fragments were tandemly linked using a linker peptide to form a new gene fragment with a total length of 1041 bp, named the ER gene. Its nucleotide sequence is shown in SEQ ID No. 1. The protein structure corresponding to the ER gene predicted by Alphfold3 and Pymol is shown below. Figure 1 As shown, the agarose gel electrophoresis of the ER gene is as follows: Figure 2 As shown.
[0039] The sequences of the primers for amplifying the above ER gene sequence are as follows: ER-F1 (SEQ ID No. 2): GGGGTACCATGAGACACCATTTCACACCGT KpnI ER-R1 (SEQ ID No. 3): CCGCTCGAGTGCCCCAATCAAAGTTCGAACCC XhoI.
[0040] III. Construction of Prokaryotic Expression Plasmids (1) The above-mentioned ER gene fragment was directly synthesized by Qingke Biotechnology Co., Ltd.
[0041] (2) The ER gene sequence was synthesized into the pUCm-T vector by the company and transformed into Escherichia coli competent cells DH5α to obtain the recombinant plasmid pUCm-T-ER1.
[0042] (3) The recombinant plasmid pUCm-T-ER1 obtained in step (2) and the Escherichia coli expression plasmid pET-32a were digested with KpnI and XhoI, and the ER fragment and linearized plasmid pET-32a were recovered by gel extraction. They were then ligated with Takara DNA Ligation ligase and transformed into competent cells of Escherichia coli BL21 strain to obtain the recombinant expression plasmid pET-32a-ER1.
[0043] The recombinant plasmid pET-32a-ER1 was transformed into E. coli BL21 competent cells. After successful transformation, the recombinant expression bacteria were... E. coli BL21 / pET-32a-ER1 was streaked overnight on LB solid agar (containing 100 μg / mL ampicillin). The next day, single colonies were selected and inoculated into LB medium (containing 50 μg / mL ampicillin) and incubated overnight at 37 °C and 180 r / min. A 1% transfer was then made to 10 mL of fresh LB medium and cultured at 37 °C with shaking at 250 r / min until OD reached. 600=0.6~1.0 (incubate for about 3 h), take 1 mL of bacterial culture and store at 4 ℃ for later use. Add IPTG to a final concentration of 1.0 mmol / L, and induce culture at 37 ℃. Collect the bacterial culture 6 h after induction, lyse and centrifuge, and use the supernatant for SDS-PAGE electrophoresis analysis and Western blotting. Results are as follows. Figure 3 As shown, the recombinant fusion protein is approximately 43 kDa in size, which is consistent with the theoretical value.
[0044] (4) Using the obtained recombinant expression plasmid pET-32a-ER1 as a template, PCR was performed using ER-F2 and ER-R2 primers to change the restriction sites.
[0045] The primer sequences for ER-F2 and ER-R2 are as follows: ER-F2 (SEQ ID No. 4): CCCAAGCTTATGAGACACCATTTCACACCGT HindIII ER-R2 (SEQ ID No.5): CGGAATTCTGCCCAATCAAAGTTCGAACCC EcoRI The PCR reaction system consisted of: 10 μL of 2×PCR Hero Mix (Dye), 0.5 μL of 10 μmol / L upstream primer ER-F2, 0.5 μL of 10 μmol / L downstream primer ER-R2, 1 μL of plasmid pET-32a-ER1, and DNase / RNase-Free H2O to a final volume of 20 μL.
[0046] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 56℃ annealing for 20 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 5 min; storage at 4℃.
[0047] (5) The obtained product was cloned into the pUCm-T vector via TA and transformed into E. coli competent cells DH5α. After successful verification by PCR and sequencing, the recombinant plasmid pUCm-T-ER2 was obtained. The recombinant plasmid pUCm-T-ER2 and the recombinant integrative plasmid pDG364-CotB were digested with HindIII and EcoRI, and the ER fragment and pDG364-CotB were recovered by gel electrophoresis. They were then ligated with Takara DNA Ligation DNA ligase and transformed into E. coli DH5α. After successful verification by PCR, double digestion, and sequencing, the recombinant integrative plasmid pDG364-CotB-ER2 was obtained, and its structure is shown below. Figure 4 As shown.
[0048] The double enzyme digestion system consisted of: 43 μL pUCm-T-ER2 / pDG364-CotB, 1 μL each of HindIII and EcoRI, 5 μL of 10×QuickCut Buffer, and DNase / RNase-Free H2O to a final volume of 20 μL. The reaction conditions were: 37℃ for 5 min.
[0049] The ligase ligation system consisted of: 2 μL of gel-recovered ER fragment, 3 μL of pDG364-CotB, and 5 μL of DNA Ligation Mix. The reaction conditions were: 25°C for 10 min.
[0050] The results of double enzyme digestion verification of pDG364-CotB-ER2 are as follows: Figure 5 As shown.
[0051] IV. Preparation of chemically transformed competent cells of Bacillus subtilis strain 168 (1) Bacillus subtilis 168 preserved in glycerol was streaked into LB medium and cultured until visible colonies were formed.
[0052] (2) Transfer a single colony to 5 mL of GMI solution and incubate overnight at 30 °C with shaking at 100 r / min.
[0053] GM I solution: 100 μL 10 mg / mL tryptophan solution, 200 μL 50% glucose solution, 80 μL 5% casein peptone, 200 μL 10% yeast extract, 19.42 mL 1× minimum salt solution.
[0054] 10× Minimum Salt Solution: Dissolve 30 g of KH2PO4, 70 g of K2HPO4, 5 g of NaC6H5O7·3H2O, 10 g of (NH4)2SO4, and 1 g of MgSO4·7H2O in distilled water in sequence, and finally bring the volume to 500 mL.
[0055] 10 mg / mL tryptophan solution: Weigh 10 mg of tryptophan powder and dissolve it in 1 mL of distilled water. Filter to remove bacteria and use immediately.
[0056] (3) Take 2 mL of culture and transfer it to 18 mL of preheated GMI solution. Incubate at 37 °C and 200 r / min for 3.5 h with shaking.
[0057] (4) Take another 10 mL of culture and transfer it to 90 mL of preheated GM II solution. Incubate at 30 °C and 100 r / min for 1.5 h with shaking. Collect the cells.
[0058] GM II solution: 500 μL 0.1 M CaCl2, 2.5 mL 0.1 M MgCl2, 1 mL 50% glucose solution, 100 μL 10 mg / mL tryptophan solution, 80 μL 5% casein peptone, 40 μL 10% yeast extract, 95.78 mL 1× minimum salt solution.
[0059] (5) Gently resuspend the bacterial cells in 10 mL of centrifuged supernatant. The bacterial cells at this time become competent cells.
[0060] V. Transform the recombinant plasmid pDG364-CotB-ER2 into Bacillus subtilis 168 competent cells (e.g., Figure 6 ) (1) Expanded culture of cells carrying pDG364-CotB-ER2 E. coli DH5α was extracted from the integrative plasmid vector pDG364-CotB-ER2 using the SanPrep column-based DNA mini-extraction kit. The plasmid was digested with restriction endonuclease Xba I at 37 °C for 15 min. The target fragment was then separated by agarose gel electrophoresis, and the linearized plasmid fragment was recovered using a gel recovery kit.
[0061] (2) Add an appropriate amount of linearized plasmid DNA fragment to 500 μL of Bacillus subtilis 168 competent cells, mix gently, and incubate at 37 ℃ with slow shaking (80 r / min) for 1 h. Spread 100 μL of the transformation product onto LB agar medium (containing 5 μg / mL chloramphenicol) and incubate at 37 ℃ for 16 h. Pick positive clones and inoculate them into LB liquid medium (containing 5 μg / mL chloramphenicol) and incubate at 37 ℃ and 160 r / min for 16 h.
[0062] (3) Positive transformants from chloramphenicol-resistant plates were selected for amplification culture. Simultaneously, the positive transformants and Bacillus subtilis 168 competent cell suspensions were separately inoculated onto nutrient agar containing 1% soluble starch and cultured at 37 ℃ for 24 h. Iodine solution was then added to the plates for amylase activity analysis of the recombinant bacteria. The results are as follows: Figure 7 As shown.
[0063] (4) Expand the culture of the recombinant bacteria that were correctly identified by amylase, extract bacterial DNA using a bacterial genomic DNA extraction kit, and use this DNA as a template, with Bacillus subtilis 168 genome as a control. Perform PCR identification using four primer pairs: ER F2 / R, amyEF / R, amyEF / ER R2, and CotB F / ER R2. The PCR identification results are as follows: Figure 8 .
[0064] The amplification primers for the CotB protein gene are shown below: CotB-F: CGGGATCCAGGATTAGGCCGTTTGTCC BamH I CotB-R:GGGAAGCTTGGATGATTGATCATCTGAAG HindIII The primers for amplifying the amyE amylase gene of Bacillus subtilis strain 168 are shown below: amy EF: CCAATGAGGGTTAAGAGTATTCC amy ER:CGAGAAGCTATCACCGCCCAGC (5) The genetically engineered bacteria were induced to form spores by nutrient depletion method. The spores were then fixed and observed by immunofluorescence microscopy. The primary antibody was mouse anti-ER positive serum (working concentration 1:100), and the secondary antibody was fluorescein Cy3-labeled goat anti-mouse IgG (working concentration 1:100).
[0065] The specific operating steps are as follows: Take the purified spore-forming solution onto a clean glass slide, dry and fix it with hot air. Add 3% BSA blocking solution to the slide, completely covering the spores, and block at room temperature for 30 min. Wash 10 times with PBS. Add mouse anti-ER positive serum (1% BSA 1:100 dilution), incubate at room temperature for 1 h, and wash. Add Cy3-labeled goat anti-mouse IgG (1% BSA 1:100 dilution), incubate at room temperature in the dark for 45 min, and wash. Observe and image under an immunomicroscope. The results are as follows: Figure 9 As shown.
[0066] The above experimental results prove that the recombinant plasmid pDG364-CotB-ER2 was successfully transformed into Bacillus subtilis 168 and double cross-recombination occurred, thus the genetically engineered bacteria were successfully constructed.
[0067] VI. Preparation of spore powder from genetically engineered bacteria (a) The genetically engineered bacteria were cultured in NA liquid medium at 37 °C and 160 r / min for 16 h.
[0068] (b) In a stainless steel pot, pour in distilled water and add 1.3% soybean flour, 1.3% corn flour, 0.5% wheat bran, 0.3% peptone, 0.2% glucose, 0.1% beef jerky, 0.5% sodium chloride, and 1.2% edible agar. Except for the agar, mix all ingredients thoroughly in the pot and boil for 3 hours, observing the water level constantly to ensure it remains constant. Finally, add the edible agar and dissolve it completely, adjusting the pH to 7.0. Then pour the mixture into a sterile, covered porcelain dish, to a thickness of approximately 1 cm.
[0069] (c) After the culture medium solidifies, pour the expanded liquid culture onto a shallow tray of culture medium and ferment at 37°C for 127 h to 153 h. Observe the spore formation rate daily using the spore staining method. When the spore formation rate reaches more than 90%, end the fermentation.
[0070] (d) Gently scrape the bacterial growth on the surface of the culture medium with a sterile glass slide, mix it with an appropriate amount of corn flour as a carrier, and dry it at 65℃ for 2-3 hours to ensure that the particles are fine and uniform.
[0071] (e) The dried mixture is crushed using a crusher and passed through a 120-mesh sieve to obtain recombinant Bacillus subtilis BR spore powder. The viable bacteria in the powder are counted and stored at 4 ℃ for later use.
[0072] VII. Animal Experiments Ninety-six 21-day-old female BALB / c mice (weighing 18.0 ± 2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were pre-fed for 7 days and randomly divided into 4 groups, with 4 cages per group and 6 mice per cage. Mice in each group were marked and weighed. The mice were immunized according to the immunization schedule in Table 1. The CK group served as the blank control group, fed only with the basal diet. The WB and BR groups were fed wild-type Bacillus subtilis 168 and recombinant Bacillus subtilis BR spores respectively, mixed with feed, with 2.0 × 10⁻⁶ spores per gram of feed. 6 The CFU and VR groups were injected with 100 μL of inactivated porcine reproductive and respiratory syndrome virus (PRRSV) vaccine via intraperitoneal injection every week after the start of the experiment. During the experiment, each mouse in each group was fed 3-5 g of feed per day, and the mice had free access to food and water. The ambient temperature was controlled between 18℃ and 23℃.
[0073] Table 1 Immunization Schedule
[0074] At days 0, 14, 28, and 42 of the experiment, six mice were randomly selected from each group. Blood was collected from the retroocular orbital venous plexus. The collected blood was placed in a 2 mL centrifuge tube, incubated at 37 °C for 1 h, then at 4 °C overnight, and centrifuged at 4 °C, 3000 g for 10 min. Serum was collected in a new centrifuge tube, aliquoted into 20 μL, and stored at -80 °C for later use. After blood collection, the mice were euthanized by dislocation, and the small intestine was aseptically dissected. The contents of the small intestine were collected, and 0.5 g of the contents were weighed into a centrifuge tube. 4.5 mL of pre-chilled PBS was added, and the mixture was thoroughly mixed. The mixture was centrifuged at 4 °C, 3000 g for 10 min, and the supernatant was collected in a new centrifuge tube, aliquoted into 50 μL, and stored at -80 °C for later use. Finally, the small intestine tissue, after the contents of the small intestine were removed, was minced and placed in a centrifuge tube, and stored at -80 °C for later use. At 42 days, mice in each group were weighed after fasting (8 hours without food, 2 hours without water). Small intestinal contents were collected, and the thymus and spleen were sampled and weighed, then preserved in 4% paraformaldehyde fixative for later use. Partial contents of the cecum were aseptically collected for later use. A small segment of ileum was also collected and placed in 4% paraformaldehyde fixative for section preparation. Intestinal lymph nodes were aseptically collected and placed in pre-cooled sterile PBS for subsequent flow cytometry analysis.
[0075] (1) Flow cytometry to examine immune cell populations.
[0076] Lymph nodes were placed on a 70 μm sieve and gently ground with a grinding rod. After thorough grinding, the solution from the bottom of the sieve was collected into a 50 mL centrifuge tube and centrifuged at 300 g for 5 min at 4 °C. The supernatant was removed. 1 mL of ACK erythrocyte lysis buffer was added to the centrifuged cell suspension to resuspend the cells, and lysis was performed at room temperature for 5 min. After lysis, 5 mL of RPMI medium containing 2% FCS was added to terminate the lysis, and the mixture was vortexed. The cells were then filtered through a 70 μm filter, and the filtered cell suspension was collected into a centrifuge tube and centrifuged at 300 g for 5 min at 4 °C. The supernatant was removed. The cells were resuspended in staining buffer to adjust the cell concentration to 1 × 10⁻⁶. 7Cells / mL. Add 100 μL of single-cell suspension to a flow cytometry tube, followed by 5 μL of Anti-Mouse CD3 Antibody, 5 μL of Anti-Mouse CD4 Antibody, and 5 μL of Anti-Mouse CD8a Antibody. Vortex to mix, incubate at room temperature in the dark for 15-30 minutes or on ice for 30-60 minutes; add 2 ml of PBS to each tube and vortex to mix. Centrifuge at 300×g for 5 minutes at room temperature, discard the supernatant; resuspend in 500 μL of Flow Cytometry Staining Buffer to each tube, and analyze. Experimental results were analyzed using Flowjo 10.8.1 software, with the following gating logic: A. Use a scatter plot (X:FSC-A;Y:SSC-A) to draw gates to identify the cells to be studied; B. Use a scatter plot (X:FSC-A; Y:FSC-H) to exclude adherent cells; C. Use a scatter plot (X:APC-A750-A;Y:SSC-A) to draw a gating circle to identify total T cells (CD3+); D. Use a scatter plot (X:FITC-A;Y:PC5.5-A) to gating CD4+ T cells (CD3+CD4+CD8-) and CD8+ T cells (CD3+CD4-CD8+).
[0077] Experimental results are as follows Figure 10 As shown, the recombinant Bacillus subtilis strain constructed in this invention exhibits significant advantages in inducing mucosal immune responses. Specifically, this recombinant strain can effectively promote the differentiation and activation of T lymphocytes, B lymphocytes, and dendritic cells. This function is of great significance for constructing a comprehensive and effective immune defense mechanism and is a characteristic not possessed by most currently commercially available vaccines. Therefore, this recombinant strain shows broad application prospects in the field of mucosal vaccine adjuvant development.
[0078] (2) The levels of anti-ER protein IgG and sIgA in mouse serum and intestinal mucus were detected by indirect ELISA.
[0079] The purified ER protein was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer (pH=9.6) and added to 100 μL per well of a 96-well high-adsorption flat-bottom polystyrene microplate (purchased from Wuhan Saiwei Biotechnology Co., Ltd.). The plate was incubated at 37°C until the liquid completely evaporated. The plate was washed three times with PBS (pH=7.4) washing buffer containing 0.05% Tween 20, 300 μL per well each time. 250 μL of blocking buffer (3% BSA-PBS) was added to each well, and the plate was incubated at 37°C for 2 h, followed by three washes with PBST. Mouse serum was diluted 1:100 using blocking buffer, with 100 μL per well, and incubated at 37°C for 2 h, followed by three washes with PBST. Horseradish peroxidase-labeled rabbit anti-mouse IgG (purchased from Santa Cruz Biotechnology, USA) was diluted 1:2000 using blocking buffer and incubated at 37°C for 2 h. Wash three times with PBST; add 100 μL / well of TMB substrate chromogenic solution (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and react at room temperature in the dark for 5-10 min; stop the reaction by adding 100 μL / well of 2 mol / L H2SO4; measure the absorbance of each well at 450 nm using a Thermo Multiskan FC microplate reader. Antibody levels are expressed as P / N values: P / N = OD of sample wells. 450 / PBS OD 450 .
[0080] Experimental results are as follows Figure 11 As shown, the detection of immunoglobulin levels in the small intestinal contents of mice revealed that the recombinant strain treatment group (ER group) exhibited superior effects in inducing specific antibody production. Compared with the blank control group and the non-recombinant Bacillus subtilis strain 168 treatment group, the ER group mice secreted higher levels of specific IgG and sIgA antibodies against ER protein. Indirect enzyme-linked immunosorbent assay (ELISA) results further confirmed that this recombinant strain could elicit a significant humoral immune response, indicating its excellent antigen delivery and immune enhancement capabilities.
[0081] (3) Enzyme-linked immunosorbent assay (ELISA).
[0082] The levels of five cytokines—INF-α, TNF-α, INF-γ, IL-10, and IL-6—in mouse ileal tissue and serum were detected using an enzyme-linked immunosorbent assay (ELISA) kit (purchased from Shanghai Yuanju Biotechnology Center). The entire assay was performed according to the kit's instructions.
[0083] Test results as follows Figure 12 and Figure 13As shown, analysis of cytokine expression levels in mouse ileum tissue revealed significantly elevated levels of interferon-α (IFN-α), tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) in the ER group mice. These differences were statistically significant compared to the control group (P<0.05). These cytokines play a core regulatory role in antiviral immune responses, suggesting that recombinant Bacillus subtilis BR can effectively activate host cellular immune pathways, thereby enhancing the body's antiviral capacity to some extent.
[0084] (4) Detect the titer of neutralizing antibodies in mouse serum.
[0085] Cells were seeded into 96-well plates, with 100 μL of Marc-145 cell suspension added to each well, at a cell density of 1–2 × 10⁶ cells / well. 4 Cells / well; Incubate 96-well plates at 37°C in a 5% CO2 incubator for approximately 24 hours until a cell monolayer forms; Serially dilute the serum to be tested with maintenance medium, preparing 6 replicates for each dilution; Dilute known titer of PRRSV (GenBank: DQ355796.1) to 100 TCID50 / 50 μL, mix 50 μL of diluted serum with 50 μL of virus solution, and incubate at 37°C for 1 hour to allow antibody-virus binding; Aspirate the culture medium from the 96-well plate, gently wash the cells once with PBS, and add 100 μL of virus-serum mixture to each well (inoculate 3 wells for each dilution). In the virus control group, only virus is added, without serum; in the cell control group, only maintenance medium is added, without virus or serum; in the serological control group, only serum is added, without virus. Incubate the 96-well plate at 37°C with 5% CO2 for 1-2 hours to allow virus adsorption. Then, aspirate the virus-serum mixture and add 100 μL of fresh maintenance medium to each well. Observe the cytopathic effect (CPE) daily, record the number of wells in each dilution where no CPE was observed, calculate the neutralizing antibody titer using the Reed-Muench method, and express the final results in Log2 form.
[0086] like Figure 14 As shown, the levels of neutralizing antibodies in mouse serum were measured, and the neutralizing antibody titers in the ER group were significantly higher than those in the control group and the non-recombinant strain treatment group. This result indicates that oral administration of recombinant Bacillus subtilis BR can effectively induce the production of functional neutralizing antibodies, thereby enhancing immune protection against porcine reproductive and respiratory syndrome virus (PRRSV), further validating the application value of this strain in oral vaccine development.
[0087] In summary, this invention is the first to construct a recombinant Bacillus subtilis strain displaying the PRRSV ER protein on the spore surface and systematically evaluate its immunomodulatory effect in a mouse model. Using Bacillus subtilis 168 as the host and the spore capsid protein CotB as the anchoring protein, the fused CotB-ER gene was integrated into the host genome through chemical transformation and homologous double crossover recombination technology. This resulted in a recombinant strain, named BR, that stably inherits within Bacillus subtilis and stably expresses the PRRSV ER protein on the spore surface. Animal experiments showed that oral administration of this recombinant strain induced significant specific humoral and mucosal immune responses in vivo, specifically a significant increase in anti-ER protein-specific IgG and sIgA levels, suggesting good antigen presentation capacity and adjuvant effect. Furthermore, flow cytometry results indicated that this recombinant strain effectively promoted the differentiation and activation of T cells, B cells, and dendritic cells, further demonstrating its important role in the initiation of mucosal immunity. Cytokine detection results showed that the expression levels of antiviral-related cytokines IFN-α, TNF-α, and IFN-γ in the ileum tissue of ER group mice were significantly upregulated, indicating that this strain can not only induce humoral immunity but also activate cellular immune responses, contributing to the establishment of a more comprehensive antiviral protection mechanism. Further detection of neutralizing antibody titers in mouse serum also indicated that the recombinant strain could induce the production of functional neutralizing antibodies, significantly enhancing the body's immune defense against PRRSV. Therefore, this recombinant Bacillus subtilis not only has significant advantages in antigen delivery and immune activation but also possesses the potential and application value as a candidate vector for oral vaccines.
[0088] The recombinant Bacillus subtilis BR constructed in this invention, as an oral subunit vaccine-type microecological immunomodulator, has the following advantages: (1) It can effectively induce the body to produce a specific immune response against PRRSV; (2) It can be administered orally, which is simple to operate and can significantly simplify the traditional immunization procedure; (3) It avoids the immune stress response caused by injection; (4) It has good genetic stability and intestinal colonization ability, and can form an effective immune barrier in the intestinal tract; (5) It helps to reduce the labor cost and management burden in the vaccination process; (6) The Bacillus subtilis used is an internationally recognized edible probiotic with a clear genetic background and non-invasiveness, which can be used to develop commercial vaccines; (7) The integrative recombinant plasmid used displays antigen protein on the spore surface, which can directly integrate the target gene into the genome of Bacillus subtilis strain 168, making it genetically stable and not lost during the passage process.
[0089] It should be noted that all features disclosed in this specification, or all steps in all methods or processes disclosed, may be combined in any way, except for mutually exclusive features and / or steps.
[0090] Furthermore, the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.
Claims
1. An ER gene, characterized in that, Its nucleotide sequence is shown in SEQ ID No.
1.
2. A recombinant Bacillus subtilis, characterized in that, It contains the ER gene as described in claim 1; It was obtained by fusing the spore capsid protein CotB with the ER gene using the integration vector pDG364, and then transferring the resulting fusion gene CotB-ER into Bacillus subtilis 168.
3. A method for constructing recombinant Bacillus subtilis as described in claim 2, characterized in that, Includes the following steps: (1) Synthesize the ER gene and further synthesize it into the pUCm-T vector. Transform the vector into Escherichia coli competent cells DH5α to obtain the recombinant plasmid pUCm-T-ER1. (2) The recombinant plasmid pUCm-T-ER1 and the Escherichia coli expression plasmid pET-32a were digested with KpnI and XhoI, and the ER fragment and linearized plasmid pET-32a were recovered by gel extraction. They were then ligated with DNA ligase and transformed into competent cells of Escherichia coli BL21 strain to obtain the recombinant expression plasmid pET-32a-ER1. (3) Using the recombinant expression plasmid pET-32a-ER1 obtained in step (2) as a template, PCR was performed using ER-F2 primers and ER-R2 primers to change the restriction sites. The obtained product was cloned into the pUCm-T vector by TA and transformed into Escherichia coli competent cells DH5α to obtain the recombinant plasmid pUCm-T-ER2. (4) The recombinant plasmid pUCm-T-ER2 and the recombinant integrative plasmid pDG364-CotB were digested with HindIII and EcoRI, and the ER fragment and pDG364-CotB were recovered by gel extraction, then ligated with DNA ligase and transformed into Escherichia coli DH5α to obtain the recombinant integrative plasmid pDG364-CotB-ER2. (5) The recombinant plasmid pDG364-CotB-ER2 was transformed into Bacillus subtilis 168 competent cells by chemical transformation. Through screening, recombinant Bacillus subtilis displaying PRRSV ER antigen protein on the spore surface was obtained.
4. The construction method according to claim 3, characterized in that, The nucleotide sequence of the ER-F2 primer is shown in SEQ ID No. 4, and the nucleotide sequence of the ER-R2 primer is shown in SEQ ID No.
5.
5. The application of the ER gene as described in claim 1 in the preparation of a vaccine against porcine reproductive and respiratory syndrome.
6. The use of recombinant Bacillus subtilis as described in any one of claims 2 to 4 in the preparation of a vaccine against porcine reproductive and respiratory syndrome.
7. The use of recombinant Bacillus subtilis as described in any one of claims 2 to 4 in the preparation of an oral vaccine or microecological immunizing agent against porcine reproductive and respiratory syndrome virus infection.