Transcription factor CsKr-h1 gene of coccinella septempunctata as well as inhibitor and application thereof

Abstract

The invention relates to the technical field of bioengineering, in particular to a coccinella septempunctata transcription factor CsKr-h1 gene as well as an inhibitor and application thereof. The invention provides a nucleotide sequence of a coccinella septempunctata juvenile hormone downstream response transcription factor CsKr-h1 gene as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2; the invention also provides an application of the transcription factor CsKr-h1 gene inhibitor in induction of biological diapause. The transcription factor CsKr-h1 gene provided by the invention can induce the diapause of the coccinella septempunctata after dsRNA inhibition expression, the dsRNA of the CsKr-h1 gene can be used as a related preparation and product for inducing the diapause of the coccinella septempunctata, the development of the natural enemy insect industry and the green biological control thereof is promoted, and the transcription factor CsKr-h1 gene has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and specifically relates to the transcription factor CsKr-h1 gene of Coccinella septempunctata, its inhibitor and application. Background Art

[0002] Coccinella septempunctata is a typical natural enemy of predatory agricultural pests, which can prey on various pests such as aphids, whiteflies, thrips and Spodoptera frugiperda, and occupies an important position in biological control. It is widely used and has great commercial value. However, as a natural enemy insect, there are bottlenecks in the industrial application technology, and the short shelf life limits large-scale production and application. Diapause is a state in which insects enter a state of growth and development stagnation in response to changes in the external environment. Using diapause to regulate natural enemy insects can extend their product shelf life. Therefore, carrying out research on the diapause regulation technology of Coccinella septempunctata helps to develop a control agent for inducing diapause of Coccinella septempunctata and promote the development of the natural enemy industry.

[0003] RNA interference (RNAi) technology has the advantages of high specificity, environmental friendliness and wide applicability. This technology efficiently and specifically degrades the mRNA of the corresponding sequence through double-stranded RNA (dsRNA), thereby causing the expression of the target gene to be silenced. RNAi can efficiently screen the target genes required for biological control, and lays a solid foundation for the development and application of pest biological control and economic insect products such as natural enemy insects. At present, this technology has become a new means of regulating insect growth and development in the field of plant protection. This technology uses the insect's own gene fragments to inhibit the expression of key genes in insect growth and development or biochemical metabolism through RNAi, and then controls pest damage or regulates the development progress of economic insects to meet the needs of production applications. RNAi technology has broad development prospects in the field of agricultural plant protection control. The key problem in achieving effective control of pests based on RNAi is to screen specific target genes that have an obvious inhibitory effect on the growth and development of target insects.

[0004] Transcription factors can control gene expression in cells by affecting the interaction between RNA polymerase complexes and promoters, play a key role in a variety of biological processes, and are of great significance in regulating insect growth and development, molting and metamorphosis, reproductive behavior, and adapting to environmental changes. Insect transcription factors have become a key area in the research and development of special economic insects. The regulation of transcription factor expression function mediated by RNAi technology has become the main technical means for controlling insect growth and development and metabolic changes. However, the technical difficulty lies in selecting which transcription factor. Summary of the Invention

[0005] The object of the present invention is to provide a transcription factor CsKr-h1 gene of Coccinella septempunctata, its encoded protein, and a transcription factor CsKr-h1 gene inhibitor, which can be used to induce diapause in organisms.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] The present invention provides a transcription factor CsKr-h1 gene of Coccinella septempunctata, having any one of the following nucleotide sequences:

[0008] (1) The nucleotide sequence shown in SEQ ID NO.1;

[0009] (2) A coding nucleotide sequence of a protein with the same function obtained by substitution, deletion or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1.

[0010]

[0011] Another object of the present invention is to provide a protein encoding the above-mentioned Coccinella septempunctata transcription factor CsKr-h1 gene, which has an amino acid sequence as shown in SEQ ID NO.2, or an amino acid sequence having at least 95% homology with the amino acid sequence shown in SEQ ID NO.2. It should be understood that those skilled in the art can substitute, delete and / or add one or several amino acids without affecting its activity according to the amino acid sequence disclosed in the present invention to obtain a mutant sequence of the protein. Therefore, the Coccinella septempunctata transcription factor CsKr-h1 protein of the present invention also includes a protein derived from the Coccinella septempunctata transcription factor CsKr-h1 protein, which has the same activity as the Coccinella septempunctata transcription factor CsKr-h1 protein, and is obtained by substituting, replacing and / or adding one or several amino acids to the amino acid sequence shown in SEQ ID NO.2.

[0012] MDQKINPEESNAENQQTKLTTNKNENWQMLEMVGFYNETSLSVSPIQPVVEEVPLVKKVVCSPDLPLTDFTAAPVSTKSTEQNVCMICQKMFNNKSSLQTHQRSHGVKVTEDQYRCNICSKTFAVPARLTRHYRTHTGEKPFRCEFCNKSFSVKENLSVHRRIHTKERPYKCEVCSRAFEHSGKLHRHMRIHTGERPHKCTVCSKTFIQSGQLVIHMRTHTGEKPYVCQVCQKGFTCSKQLKVHSRTHTGEKPYSCEICGKSFGYNHVLKLHQVAHYGEKVYKCTICNDTFNSKKSMEAHIKSHSENVPTPPTSTFSNESSCSSLEKEIRQAPSTSPIPKQESPINYDSNIRYYLYARDRSYLSPDYGVPSSAGVELLAAAASVTEQEDRYSNSDVFDMIKSPQDVIAVLRHPAYLTASPTVPYTPINAGDDIRRRVEAALAVDEIHSEEDPILTPPSSNPVSPAPSLSPDPELSLPPRKRSKMILKSMESSKDLSPVRYSSVIHYARAS(SEQ ID NO.2)

[0013] Another object of the present invention is to provide an inhibitor of the transcription factor CsKr-h1 gene, and the inhibitor of the transcription factor CsKr-h1 gene is used to inhibit the expression of the transcription factor CsKr-h1 gene, or reduce the protein level of the transcription factor CsKr-h1, or reduce the transcription factor CsKr-h1 protein or inhibit the dsRNA, miRNA, siRNA, ribozyme or shRNA of the transcription factor CsKr-h1 gene.

[0014] The dsRNA described above is a double-stranded RNA composed of the nucleotide sequences of the forward primer T7-dsCsKr-h1-F and the reverse primer T7-dsCsKr-h1-R shown in Table 1.

[0015] The sequence of dsCsKr-h1 is shown in SEQ ID NO.3 (provided in the form of the sense strand).

[0016] CGAAGACTTTCGCCGTACCGGCTAGATTAACTAGGCATTATCGCACACACACTGGTGAAAAACCCTTTAGGTGTGAGTTCTGTAACAAAAGTTTTAGTGTGAAGGAAAACCTGAGTGTACACAGAAGAATTCACACCAAAGAGAGACCGTACAAGTGTGAGGTCTGTTCTAGGGCTTTCGAGCATTCCGGAAAATTACATCGACATATGAGAATCCACACGGGAGAGAGACCGCATAAATGTACAGTTTGTTCAAAAACTTTTATCCAGTCTGGACAGCTCGTTATACATATGCGAACACATACAGGCGAAAAACCTTACGTCTGTCAAGTATGCC(SEQ ID NO.3)

[0017] The present invention provides a method for preparing the above-mentioned inhibitor of the transcription factor CsKr-h1 gene, which includes the following steps: using the ORF sequence of the transcription factor CsKr-h1 gene as a template, and performing in vitro transcription synthesis of dsRNA after amplification with the primers T7-dsCsKr-h1-F and T7-dsCsKr-h1-R.

[0018] Another object of the present invention is to provide the application of the above-mentioned inhibitor of the transcription factor CsKr-h1 gene in inducing diapause, and by introducing the above-mentioned inhibitor of the transcription factor CsKr-h1 gene into an organism, the purpose of inducing diapause in the organism is achieved.

[0019] The present invention provides a method for inducing diapause, which includes the following steps: introducing the above-mentioned inhibitor of the transcription factor CsKr-h1 gene into an organism.

[0020] The CsKr-h1 gene of the transcription factor of Coccinella septempunctata in the present invention, as proved by RNA interference experiments, after injecting the dsRNA sequence of the CsKr-h1 gene into the intersegmental membrane of the abdomen of newly emerged Coccinella septempunctata, it was shown that the ovarian development of Coccinella septempunctata was inhibited, indicating that knocking down the CsKr-h1 gene can induce diapause in Coccinella septempunctata, and its dsRNA can be used as a related preparation and product for inducing diapause in Coccinella septempunctata, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 For the interference effect of the CsKr-h1 gene of Coccinella septempunctata, where A is the RNA interference efficiency of CsKr-h1, and Figure B is the effect of RNA interference of CsKr-h1 on the expression of the Vg gene;

[0022] Figure 2 For the effect of the CsKr-h1 gene inhibitor on the ovarian development of female insects, where A and B are the effects of double-stranded injection of dsGFP and dsCsKr-h1 on ovarian development in sequence; C and D are the length and width of the ovaries of female insects 5 days after injection of double-stranded dsGFP and dsCsKr-h1 in sequence. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the specification. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts shall fall within the protection scope of the present invention. For those embodiments where specific techniques or conditions are not indicated, they are all conventional methods or are carried out according to the techniques or conditions described in the literature in this field, or according to the product specifications. For those reagents and instruments etc. where the manufacturer is not indicated, they are all conventional products that can be obtained through regular channels.

[0024] The sequencing primers of the CsKr-h1 gene, the primers for making dsRNA of the CsKr-h1 gene, and the RT-qPCR primers of the CsKr-h1 gene in the embodiments are shown in Table 1. The primers and sequencing were all synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0025] Table 1 Primer sequences and their functions

[0026]

[0027] The following is introduced through specific embodiments.

[0028] Example 1 Obtaining the ORF sequence of the transcription factor (CsKr-h1) gene of Coccinella septempunctata

[0029] The sequence of the CsKr-h1 gene was screened using the NCBI database. And the cloning primers for the CsKr-h1 gene, namely primer CsKr-h1-F and CsKr-h1-R, were designed using Primer premier 6.0 software. Using the cDNA obtained by reverse transcription of the total RNA of adult Coccinella septempunctata as a template, PCR Master Mix (With Dye) (purchased from Yeasen Biotech Co., Ltd.) was used to clone the CsKr-h1 gene.

[0030] The reaction system included: 22 μL of PCR-Grade H2O, 25 μL of PCR Master Mix (With Dye), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), and 1 μL of cDNA template.

[0031] The PCR thermal cycling conditions included: pre-denaturation at 98°C for 2 min; (denaturation at 98°C for 10 sec; annealing at 58°C for 15 sec, extension at 72°C for 15 sec) × 35 cycles; final extension at 72°C for 5 min.

[0032] The PCR product was sent to the company for sequencing, and the sequencing result was compared with the sequence of the CsKr-h1 gene screened to verify and obtain the nucleotide sequence encoding the CsKr-h1 gene. Its nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by CsKr-h1 is shown in SEQ ID NO.2.

[0033] Example 2 Obtaining dsRNA of the transcription factor CsKr-h1 gene of Coccinella septempunctata

[0034] Based on the ORF sequence of the transcription factor CsKr-h1 gene obtained in Example 1 (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by CsKr-h1 is shown in SEQ ID NO.2), dsRNA primers were designed using Primer premier 6.

[0035] Amplify the DNA of CsKr-h1 gene. The forward primer is T7-dsCsKr-h1-F and the reverse primer is T7-dsCsKr-h1-R. The template is the cDNA obtained by extracting the total RNA of the whole body of adult ladybugs and reverse transcription. The reaction system (total volume 50 μL) includes: 2 μL of template cDNA, 2 μL of T7-dsCsKr-h1-F (10 μM), 2 μL of T7-dsCsKr-h1-R (10 μM), 25 μL of 2×TransFast TaqPCR SuperMix (+dye) (TransGen Biotech, Beijing), and 19 μL of Nase free water. The reaction conditions include: 94°C for 3 min; 94°C for 10 s, 55 - 60°C for 20 s, 72°C for 30 s, for 35 cycles; 72°C for 5 min.

[0036] Amplify the DNA of GFP (the sequence is shown in SEQ ID NO.14). The forward primer is T7-dsGFP-F and the reverse primer is T7-dsGFP-R. The template is the cDNA of the strain containing GFP stored in the laboratory where the inventors are located (which can be obtained by the public and is only used for non-commercial purposes to repeat the examples described in the present invention). The reaction system (total volume 50 μL) includes: 2 μL of template, 2 μL of T7-dsGFP-F (10 μM), 2 μL of T7-dsGFP-R (10 μM), 25 μL of 2×TransFast Taq PCR SuperMix (+dye) (TransGen Biotech, Beijing), and 19 μL of RNase free water. The reaction conditions include: 94°C for 3 min; 94°C for 10 s, 55 - 60°C for 20 s, 72°C for 30 s, for 35 cycles; 72°C for 5 min.

[0037] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG(SEQ ID NO.14)

[0038] After purifying the amplified PCR products, dsRNAs were synthesized by in vitro transcription using the T7 RiboMAX TM Express RNAi System (Promega) kit, named dsCsKr-h1 (the sequence is shown in SEQ ID NO.3) and dsGFP respectively. After measuring the concentration of the synthesized dsRNAs using NanoDrop 2000 (Invitrogen), they were diluted with DEPC water to a final concentration of 2000 ng / μL and stored in a -80 °C refrigerator for later use.

[0039] Example 3: Detection of the interference efficiency of CsKr-h1 and the expression of CsVg gene by real-time fluorescence quantitative PCR

[0040] Female ladybugs with consistent developmental progress (within 48 h after eclosion) were selected, and 2000 ng of dsCsKr-h1 was injected into the intersegmental membrane of the abdomen of the ladybugs. Female insects injected with an equal amount of dsGFP were used as the control group. The injected ladybugs (dsGFP, n = 19; dsCsKr-h1, n = 27) were reared under non-diapause conditions for 2 days, and the RNA of the whole ladybug was extracted. After reverse transcription, cDNA was obtained, and fluorescence quantitative PCR was performed using cDNA as a template to detect the interference efficiency of CsKr-h1.

[0041] The non-diapause conditions include: temperature of 24 ± 1 °C, photoperiod of 16L:8D, and relative humidity of 70% ± 10%.

[0042] The reaction system for fluorescence quantitative PCR detection includes: 10 μL of 5G qPCR Premix (Toroid Technology Limited), 0.8 μL of forward primer (10 μM), 0.8 μL of reverse primer (10 μM), 1 μL of cDNA template, and 7.4 μL of nuclease-free water.

[0043] The reaction conditions for fluorescence quantitative PCR detection include: 95 °C, 30 s, 1 cycle; 95 °C, 5 s, 55 - 60 °C, 30 s, 40 cycles.

[0044] The real-time fluorescence quantitative PCR experiment was performed on a Lightcycler 96 (Roche, CH) instrument, and the fluorescence signal was detected using Toroivd's 5G qPCR Premix. The RT-qPCR data was analyzed using the 2 -ΔΔCt method, ΔΔCt = (Ct 目标基因 − Ct 内参基因 ) 实验组 − (Ct 目标基因 − Ct 内参基因 ), with Actin as the internal reference gene, and the gene expression was normalized and plotted using GraphPad Prism 8.0 software. 对照组 Each reaction was set with 3 technical replicates. The experimental results showed that after interfering with the CsKr-h1 gene, its transcriptional expression level decreased significantly (

[0045] A) and the significant decrease in CsKr-h1 expression significantly inhibited the expression of the vitellogenin CsVg gene ( Figure 1 B). It indicates that RNA interference of the CsKr-h1 gene is effective. Figure 1 B). It indicates that RNA interference of the CsKr-h1 gene is effective.

[0046] Example 4: Effect of interfering with the CsKr-h1 gene on the ovarian development of female insects

[0047] Female insects were injected with dsCsKr-h1 and then reared under non-diapause conditions for 7 days. The control group was injected with dsGFP and reared under non-diapause conditions for 7 days. The non-diapause conditions included: temperature of 24 ± 1 °C, photoperiod of 16L:8D, and relative humidity of 70% ± 10%. The rest referred to Example 3.

[0048] Ovarian tissues were dissected in PBS (P1020, Solarbio), photographed using a super-depth-of-field microscope, and their length and width were measured. The results showed that compared with the control group, treatment with dsCsKr-h1 significantly inhibited the ovarian development of female insects ( Figure 2 A, Figure 2 B), and both the length and width of the ovaries were significantly reduced ( Figure 2 C, Figure 2 D).

[0049] Based on the above results, it can be shown that after the expression of the transcription factor CsKr-h1 gene provided by the present invention is inhibited by dsRNA, it can induce diapause in Coccinella septempunctata. The dsRNA of the CsKr-h1 gene can be used as a related preparation and product for inducing diapause in Coccinella septempunctata, promoting the development of the natural enemy insect industry and its application in green biological control, and having broad application prospects.

[0050] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. The transcription factor CsKr-h1 gene of Coccinella septempunctata, characterized in that, Having any one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO.1; (2) A coding nucleotide sequence of a protein with the same function obtained by substitution, deletion or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.

1.

2. A protein encoding the Coccinella septempunctata transcription factor CsKr-h1 gene recited in claim 1.

3. The protein according to claim 2, characterized in that, Having the amino acid sequence shown in SEQ ID NO.2, or having an amino acid sequence with at least 95% homology with the amino acid sequence shown in SEQ ID NO.

2.

4. A transcription factor CsKr-h1 gene inhibitor, characterized in that, Comprising RNA, wherein the RNA has the function of any one or more of (1) to (3); (1) For inhibiting the expression of the gene recited in claim 1; (2) For reducing the level of the protein recited in claim 2 or 3; (3) For degrading the protein recited in claim 2 or 3.

5. The transcription factor CsKr-h1 gene inhibitor according to claim 4, characterized in that, The transcription factor CsKr-h1 gene inhibitor comprises one or more of dsRNA, miRNA, siRNA, ribozyme, shRNA that inhibit the transcription factor CsKr-h1 gene.

6. The transcription factor CsKr-h1 gene inhibitor according to claim 5, wherein The dsRNA is a double-stranded RNA composed of the nucleotide sequence of the forward primer T7-dsCsKr-h1-F and the nucleotide sequence of the reverse primer T7-dsCsKr-h1-R; the nucleotide sequence of T7-dsCsKr-h1-F is shown in SEQ ID NO.4; the nucleotide sequence of T7-dsCsKr-h1-R is shown in SEQ ID NO.

5.

7. A method for preparing an inhibitor of the transcription factor CsKr-h1 gene according to any one of claims 4-6, characterized in that, Comprising the following steps: using the ORF sequence of the transcription factor CsKr-h1 gene as a template, and performing in vitro transcription synthesis of dsRNA after amplification with the primers T7-dsCsKr-h1-F and T7-dsCsKr-h1-R.

8. Use of the transcription factor CsKr-h1 gene inhibitor according to any one of claims 4-6 in inducing diapause of organisms.

9. Use of the transcription factor CsKr-h1 gene inhibitor according to claim 7 in inducing diapause, characterized in that Introducing the transcription factor CsKr-h1 gene inhibitor into an organism.

10. A method for inducing diapause in an organism, characterized in that, Comprising the following steps: introducing the transcription factor CsKr-h1 gene inhibitor according to any one of claims 4-6 into an organism.

Images