Gene for inducing apomixis in plants, method for inducing using the same, and use thereof
By introducing specific genes from plants such as Arabidopsis thaliana and maize into rice and combining them with the MiMe system, a rice apomixis system was constructed, solving the problems of low seed setting rate and cloning efficiency in existing technologies. This enabled the efficient production of cloned diploid seeds and promoted the progress of rice breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-06-20
- Publication Date
- 2026-05-29
AI Technical Summary
Existing rice apomixis systems have deficiencies in terms of seed setting rate and cloning efficiency, which hinder their application in production. In particular, the cloning efficiency of MiMe and the combinations of BBM1, BBM4 and ToPAR is low and the seed setting rate is unstable.
Genes such as Arabidopsis thaliana AtCPRO1, maize ZmCPRO3, ZmCPRO4, soybean GlCPRO2, and rapeseed BnaCPRO8 were introduced. By combining the promoter of the oocyte-specific gene AtEC1.2 with the MiMe system, a rice apomixis system was constructed. Agrobacterium-mediated transformation technology was used to express these genes ectopically in rice, inducing apomixis and obtaining clonal diploid seeds.
This method improves the seed setting rate and cloning efficiency of rice apomixis, enabling efficient production of clonal diploid seeds without affecting plant growth and development, thus providing a new solution for rice breeding.
Smart Images

Figure CN120330218B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and plant breeding, specifically involving the use of gene binding that can induce haploid production. MiMe system A method for constructing an apomixis system to induce the production of clonal diploid offspring. Background Technology
[0002] Rice is one of the most important food crops in my country and the world, and breeding superior varieties is crucial for ensuring stable and increased rice yields. The rice breeding process typically takes 5-10 years, but haploid and diploid breeding techniques can achieve strain purification within 1-2 generations, significantly shortening the breeding cycle. Traditionally, rice reproduction relies on sexual reproduction, where male and female gametes combine to form seeds. However, this process is greatly influenced by environmental factors, and genetic variation is difficult to control precisely. Apomixis, as a reproductive method that produces offspring without relying on gamete fusion, holds immense potential for plant genetic improvement and rapid propagation.
[0003] Currently, an artificial apomixis system has been created in rice. This system is... MiMe ( Mitosis instead of meiosis It is composed of mitotic replacement meiotic elements and parthenogenetic genes.
[0004] Among them, chromosome elimination genes MTL and MiMe Apomixis systems were constructed, but the resulting materials generally exhibited low seed set and cloning efficiency, posing challenges for practical production applications. (Parthenogenesis genes) BBM1, BBM4 and ToPAR respectively with MiMe An apomixis reproductive system was constructed by combining these components. MiMe and BBM1 The combined cloning efficiency exceeded 95%, but the seed set rate was only 44%, with significant differences (20%–65%) between different genetic backgrounds. In contrast, MiMe and BBM4 and ToPAR The hybrids achieved the same seed set rate as the wild type, but their cloning efficiency was lower. MiMe and BBM1 The combined rates were only 2.4% and 54%. In summary, the currently constructed apomixis systems have certain deficiencies in seed setting rate and cloning efficiency, hindering the commercial application of apomixis in hybrid rice. Summary of the Invention
[0005] This invention provides genes that induce apomixis in plants, namely: Arabidopsis thaliana AtCPRO1, maize ZmCPRO3, ZmCPRO4, soybean GlCPRO2, and rapeseed BnaCPRO8, whose nucleotide sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively.
[0006] This invention provides a rice apomixis system composed of genes that induce plant apomixis, which is composed of the promoter of the Arabidopsis oocyte-specific expression gene AtEC1.2, the MiMe system, and any one of Arabidopsis AtCPRO1, maize ZmCPRO3, ZmCPRO4, soybean GlCPRO2, and rapeseed BnaCPRO8, respectively. The nucleotide sequence of the AtEC1.2 promoter is shown in SEQ ID NO. 6.
[0007] This invention also provides a method for producing clonal seeds in a rice apomixis system using the aforementioned gene for inducing plant apomixis, comprising the following steps: inducing any one of the above-mentioned genes AtCPRO1, ZmCPRO3, ZmCPRO4, GlCPRO2, and BnaCPRO8 using the promoter of the Arabidopsis oocyte-specific gene AtEC1.2 and combining it with the MiMe system for ectopic expression in rice oocytes, inducing parthenogenesis in rice to obtain diploid rice seeds; specifically including the following steps:
[0008] (1) Vector construction: First, primers were designed, and the promoter of gene AtEC1.2 and gene AtCPRO1 were cloned from Arabidopsis thaliana, genes Zm CPRO3 and Zm CPRO4 were cloned from maize, gene GlCPRO2 was cloned from soybean, and gene Bna CPRO8 was cloned from rapeseed. Then, the backbone vector pgg was digested with enzymes. Finally, the backbone vector pgg was digested with enzymes using a multi-fragment homologous recombination kit. Finally, the promoter of AtEC1.2 was combined with any one of genes AtCPRO1, Zm CPRO3, Zm CPRO4, GlCPRO2 or Bna CPRO8 using a multi-fragment homologous recombination kit to construct a complete composite vector to obtain the recombinant product.
[0009] (2) The recombinant product obtained above was cloned;
[0010] (3) Genetic transformation: embryogenic callus prepared from rice seeds was transformed with Agrobacterium containing the recombinant product, and transgenic plants were obtained by culture;
[0011] (4) Diploid identification of the seeds of the transgenic plant.
[0012] Furthermore, a method is provided for producing cloned seeds in a rice apomixis system using the aforementioned gene for inducing plant apomixis, characterized in that the primers designed in the vector construction step are:
[0013] AtEC1.2-R: tatTCTTTCTTTTGGGG (SEQ ID NO.7);
[0014] AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8);
[0015] AtCPRO1-F:caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC (SEQ ID NO.9);
[0016] AtCPRO1-R:AATGTTTGAACGATCTCAAGCTACAAATCATGTACCAATTGTG (SEQ ID NO.10);
[0017] ZmCPRO3-F:caaaaagaaagaataATGGCTACCTACTACTCGAGCC (SEQ ID NO.11;
[0018] ZmCPRO3-R:AATGTTTGAACGATCTCACGCCACAAAATCATGGAG (SEQ ID NO.12);
[0019] ZmCPRO4-F:caaaaagaaagaataATGGCCACATTCTTCTCCACTTC (SEQ ID NO.13);
[0020] ZmCPRO4-R:AATGTTTGAACGATCTCACGCCACAAAATCGTGC (SEQ ID NO.14);
[0021] GlCPRO2-F: caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG (SEQ ID NO.15);
[0022] GlCPRO2-R: AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG (SEQ ID NO.16); Bna CPRO8-F: caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG (SEQ ID NO.17);
[0023] Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG (SEQ ID NO.18);
[0024] NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19);
[0025] NOS-F:GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0026] Furthermore, a method is provided for producing cloned seeds in a rice apomixis system using the gene that induces plant apomixis, preferably by transferring the recombinant product into competent DH5α cells for cloning during the cloning process.
[0027] Furthermore, a method is provided for producing cloned seeds in a rice apomixis system using the aforementioned gene for inducing plant apomixis, preferably using a genetic transformation method mediated by Agrobacterium EHA105 strain during genetic transformation.
[0028] Furthermore, a method is provided for producing cloned seeds in a rice apomixis system using the gene that induces plant apomixis, preferably using the indica-japonica hybrid rice variety Chunyou 84.
[0029] Furthermore, a method for producing cloned seeds in a rice apomixis system using the aforementioned gene for inducing plant apomixis is provided, with the preferred diploid identification method being: using flow cytometry to identify diploids.
[0030] Finally, the application of the gene for inducing plant apomixis, the rice apomixis system, and the method for producing cloned seeds in the rice apomixis system is provided in the preparation of superior rice varieties.
[0031] The method of this invention uses natural substances derived from Arabidopsis thaliana. AtCPRO1, Corn Zm CPRO3, Zm CPRO4in soybeans GlCPRO2, rapeseed Bna CPRO8 The enzyme was introduced separately into rice, and its ectopic expression in oocytes was induced. Then, it was combined with... MiMe system This method, without affecting plant growth and development, can induce the production of clonal diploid offspring, providing a new solution for rice breeding and possessing significant application prospects and economic value. Attached Figure Description
[0032] Figure 1 It is a carrier spectrum diagram;
[0033] Figure 2 This is a positive test result image of a genetically modified plant;
[0034] Figure 3 This is a graph showing the mutation types of transgenic plants.
[0035] Figure 4 This is a phenotypic diagram of the T0 generation transgenic plant;
[0036] Figure 5 This is a flow cytometry diagram for screening diploid cells;
[0037] Figure 6 This is a graph of whole genome sequencing data from diploid plants;
[0038] Figure 7 It is a phenotypic diagram of a cloned plant. Detailed Implementation
[0039] Example 1: Arabidopsis thaliana AtCPRO1 and MiMe Methods for producing cloned seeds using rice apomixis systems composed of different system combinations
[0040] This method was applied to the indica-japonica hybrid rice Chunyou 84, resulting in transgenic lines with high and stable seed setting rates. In the ploidy identification of the progeny plants, cloned diploid plants with fixed genotypes were successfully identified. The process mainly consists of vector construction, genetic transformation, genotype identification, and result detection.
[0041] Carrier construction:
[0042] 1.1 AtEC1.2 Promoters and Arabidopsis AtCPRO1 Obtaining gene coding sequences
[0043] (1) The required genome was amplified from the Arabidopsis thaliana genome. AtEC1.2 promoters and genes AtCPRO1 ,exist PC1300- ACTIN-CAS9 Amplification of terminators on vectors NOS The primers are as follows:
[0044] AtEC1.2-R: tatTCTTTCTTTTGGGG (SEQ ID NO.7);
[0045] AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8);
[0046] AtCPRO1-F:caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC (SEQ ID NO.9);
[0047] AtCPRO1-R:AATGTTTGAACGATCTCAAGCTACAAATCATGTACCAATTGTG (SEQ ID NO.10);
[0048] NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19);
[0049] NOS-F:GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0050] The products were purified using a recovery kit to obtain amplification products 1, 2, and 3, respectively.
[0051] 1.2 Construction of Expression Box A
[0052] The main steps are as follows (the specific operation can also refer to the method described in the paper Wang C, Shen L, Fu Y, Yan C, Wang K. A Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice. J Genet Genomics. 2015 Dec 20;42(12):703-6. doi:10.1016 / j.jgg.2015.09.011, with slight modifications):
[0053] (1) sgMiMe Construction of intermediate carrier
[0054] PAIR1, REC8, OSD1 The four target sequences of the three genes (underlined) PAM (Sequence), specifically:
[0055] PAIR1 target sites: AAGCAACCCAGTGCACCGC TGG(SEQ ID NO. 21);
[0056] REC8 target site: CGGAGAGCCTTAGTGCCAT GGG (SEQ ID NO. 22);
[0057] Target sites of OSD1-g1: TTGACCGCCACGGCTCCCGG CGG (SEQ ID NO. 23);
[0058] Target sites of OSD1-g3: CTGCCGCCGACGAGCAACA AGG (SEQ ID NO. 24).
[0059] Designed separately PAIR1, REC8, OSD1 Two complementary DNA sequences are used. Adding GGCA before the forward target sequence creates the forward primer for the target site, and adding AAAC before the reverse complementary target sequence creates the reverse primer for the target site.
[0060] The SK-gRNA intermediate vector has two AarI restriction sites. After digestion with AarI, a vector with sticky ends is formed. The forward and reverse primers of the target are mixed and denatured and annealed to form a fragment with sticky ends. The vector and fragment are ligated using T4 ligase to form an intermediate vector for a single target gene of sgMiMe, which is labeled as SK-gPAIR1, SK-gREC8, SK-gOSD1-g1, and SK-gOSD1-g3, respectively.
[0061] (2) sgMiMe Carrier construction
[0062] Utilizing the isosinetic nature of BglII and BamHI, NheI and XbaI, and SalI and XhoI, gRNA polymerization was performed: SK-gRNA OSD1-g1 was digested with KpnI and XhoI to serve as a vector; SK-gRNA PAIR1 was digested with SalI and BamHI to provide the PAIR1 sgRNA fragment, and SK-gRNA REC8 was digested with BglII and KpnI to provide the REC8 sgRNA fragment, enabling rapid one-step polymerization of the three gRNAs; finally, the polymerized gRNA OSD1-gRNA REC8-gRNA PAIR1 vector was digested with KpnI and BglII, and the fragments were recovered and ligated into the binary vector pC1300-Cas9 (between the KpnI and BamHI sites) expressing Cas9 protein; subsequently, the ligated vector was digested with KpnI and XbaI, and SK-gRNA OSD1... -g3 was digested with KpnI and NheI enzymes, and the two parts were ligated with T4 ligase to obtain a multi-gene knockout expression cassette A that can simultaneously knock out four target sites of three genes: REC8, OSD1 and PAIR1.
[0063] 1.3 Construction of Expression Box B
[0064] Will AtEC1.2 promoter, Arabidopsis AtCPRO1 The gene coding sequence and the NOS terminator were integrated into expression cassette A to obtain expression cassette B. The vector map is shown below. Figure 1 :
[0065] (1) PmeⅠ restriction enzyme digestion vector expression cassette A
[0066] COMPONENT 50 µl REACTION
[0067] pC1300-Act-Cas9 1 µg
[0068] 10X rCutSmart Buffer 5 µl (1X)
[0069] PmeⅠ 20 units
[0070] Nuclease-free Water to 50 µl
[0071] The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain expression cassette A digestion.
[0072] (2) Using a multi-fragment homologous recombination kit (Novizan C113):
[0073] COMPONENT 20 µl REACTION
[0074] pC1300-Act-Cas9 (PmeⅠ cut) 100ng
[0075] Amplification product 1 20 ng
[0076] Amplification product 2 10 ng
[0077] Amplification product 3 20 ng
[0078] 5 xCE MultiS Buffer 4 µl
[0079] Exnase MultiS 2 µl
[0080] Nuclease-free Water to 20 µl
[0081] React at 37°C for 30 min; then cool to 4°C or immediately place on ice to cool.
[0082] (3) Transformation of recombinant products:
[0083] Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend in 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer pC1300-F: acactttatgcttccggctc (SEQ ID NO. 31).
[0084] 2. Genetic transformation
[0085] The cloning vector sequencing was correct, and the next step was to conduct Agrobacterium-mediated transformation experiments. The indica-japonica hybrid rice variety Chunyou 84 (CY84) was transformed using the Agrobacterium EHA105 strain-mediated genetic transformation method to obtain transgenic material. The seeds were dehulled, disinfected with 75% ethanol for 1 min, the ethanol was discarded, and 2% sodium hypochlorite solution was added for disinfection for 20 min, during which time the seeds were placed on a shaker. The sodium hypochlorite solution was discarded in a clean bench, and the seeds were rinsed 4-5 times with sterile water. The seeds were then placed on sterilized filter paper to absorb excess moisture. Subsequently, the seeds were inoculated onto N6 mature embryo callus induction medium and cultured in the dark at 28℃ for approximately one month. Well-formed embryogenic callus was selected and subcultured 2-3 times. Embryogenic callus from the second subculture, 3-5 days after the second subculture, was selected for transformation.
[0086] Embryogenic callus was immersed in activated Agrobacterium tumefaciens EHA105 bacterial suspension (containing acetylsyl syringone) with the target plasmid for 30 min. The callus tissue was washed several times with sterile water, dried in a laminar flow hood, and co-cultured at 19°C for 2-3 days. It was then transferred to selection medium supplemented with antibiotics containing selection markers for selection. Each selection process lasted 2 weeks, and 2-3 rounds of selection were performed to obtain newly grown callus tissue. The newly grown callus tissue was then transferred to pre-differentiation medium and cultured for 7 days, followed by differentiation medium. It was cultured at 25°C under a 16 h / d light intensity for approximately 10 days until green spots appeared, at which point regenerated plantlets were obtained. The roots of the differentiated transgenic seedlings were cut off and placed in rooting medium for 2-3 weeks. Then, the sealing film was removed, water was added, and the seedlings were hardened off for 1 week before transplanting.
[0087] 3. Detection of mutations and ectopic expression in transgenic T0 generation plants
[0088] filter OsPAIR1 , OsREC8 and OsOSD1 The method for producing T0 generation transgenic plants with homozygous mutations in all three genes is as follows:
[0089] (1) According to OsPAIR1, OsREC8 and OsOSD1 Hi-TOM detection primers were designed based on the gene sequence. The primer sequences are as follows:
[0090] PAIR1-Hi-F:ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc (SEQ ID NO.25);
[0091] PAIR1-Hi-R:gagttggatgctgagtggggagatgtagtgcgtgggtcttg (SEQ ID NO.26);
[0092] REC8-Hi-F:ggagtgagtacggtgtgcttgggttagtgaggagat (SEQ ID NO.27);
[0093] REC8-Hi-R: gagttggatgctgagtggtgcgatcggaactatggagac (SEQ ID NO.28);
[0094] OSD1-Hi-F: ggagtgagtacggtgtgctatcaggaggacgacgtcgccg (SEQ ID NO.29);
[0095] OSD1-Hi-R:gagttggatgctgagtggctcctcctcttgggtgtagc (SEQ ID NO.30).
[0096] The above three primer pairs were used to perform PCR amplification on T0 generation transgenic plants. The mutation types of the three genes in all plants were detected using the Hi-TOM system, and transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout) were screened.
[0097] (2) Genomic DNA was extracted from these plants using the CTAB method. The transgenic lines were identified as transgenic using the AtC1-PCR-F and AtC1-PCR-R primer combinations. The primer information used is as follows:
[0098] At C1-PCR-F:gtgactatttaccgtcaatcctttc (SEQ ID NO.32);
[0099] AtC1-PCR-R: CTCGGCGCCATATTTTGATG (SEQ ID NO.33).
[0100] 4. Plant ploidy and genotype identification:
[0101] Flow cytometry and genome sequencing were used to analyze the progeny of T0 transgenic plants with homozygous mutations in all five genes, screening for plants with fixed heterosis. Flow cytometry was used to identify the ploidy of the progeny of T0 transgenic plants with homozygous mutations in all five genes. The specific experimental procedures were as follows:
[0102] Fresh rice leaves, 4-5 cm long and grown for 10 days, were cut and placed in a glass dish. 1 ml of plant lysis buffer LB01 was added, and the tissue was quickly and vertically minced with a blade. The lysis buffer was aspirated from the dish and filtered through a 50 µm nylon mesh into centrifuge tubes. The tube caps were labeled with the sample name. Centrifuged at 1,200 rpm for 5 min at 4°C in a benchtop refrigerated centrifuge. The centrifuge tubes were gently removed, and the supernatant was slowly aspirated. 450 µl of LB01, 25 µl of pre-chilled PI, and 25 µl of RNase A were added. The tubes were stained at 4°C in the dark for 10 min. Detection was performed using BD Accuri C6 assay. If the tissue is diploid, the peak value should be consistent with the wild-type peak. The specific reagent formulation is as follows:
[0103] Lysis buffer LB01: Tris 363.4 mg, Na2EDTA 148.9 mg, Sperminetetrahydrochloride 34.8 mg, KCl 1.193 g, NaCl 233.8 mg, Triton X-100 200 µl, bring to a final volume of 200 mL, adjust pH to 7.5 with 1M HCl, and add 220 µl of β-mercaptoethanol in a fume hood. Sterilize and dispense via vacuum filtration using a 0.22 µm filter in a clean bench, and store at -20°C.
[0104] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of powder and dissolve it in 50 mL of ddH2O; sterilize and dispense the solution by filtration through a 0.22 μm filter in a clean bench and store at -20℃.
[0105] RNase stock solution (1 mg / ml): Weigh 25 mg RNase (IIA Sigma) and dissolve it in 25 ml ddH2O; sterilize and dispense by filtration using a 0.22 µm filter in a clean bench; heat at 90℃ for 15 min to inactivate DNase; store at -20℃.
[0106] Genotyping of diploid plants was performed using genome sequencing technology, specifically as follows:
[0107] For the plants identified as diploid, DNA was extracted and a library constructed. Paired-end sequencing was performed using the Illumina Hiseq 2500 sequencing platform, with an average sequencing depth of 10-15 times for each sample. The raw data was first filtered using NGSQCtoolkit v2.3.3, and then aligned to a reference genome to obtain SNP data. Finally, the SNP data was compared with the wild-type Chunyou 84 genome to determine the genotype of the diploid plant. If the diploid plant exhibits fixed heterosis, its genome should theoretically have the same heterozygous genotype as Chunyou 84.
[0108] 5. Test Results:
[0109] A total of 48 strains were obtained through genetic transformation. Hi-TOM detection technology was used to analyze 3 genes. OsPAIR1 OsREC8 and OsOSD1 The mutation types were detected, and transgenic positivity was identified. Results showed that five lines (PGR-5, PGR-6, PGR-18, PGR-33, and PGR-36) were identified as simultaneously possessing the AtEC1.2:AtCPRO1 expression element (…). Figure 2 )as well as PAIR1, REC8, OSD1 Homozygous mutations in three genes ( Figure 3 The growth and development of these five strains are consistent with the wild type. Figure 4 The seed setting rate fluctuated between 62.41% and 73.76%, while the seed setting rate of the wild-type Chunyou 84 was 71.24±6.51%. After the seeds matured, the seeds of this line were harvested. The T1 progeny seeds from the five lines were germinated, and flow cytometry analysis was performed on the progeny ploidy at the seedling stage. One diploid plant was selected from each of the two lines (PGR-33 and PGR-36). Figure 5 Next, the genotypes of these two strains were further verified using whole-genome sequencing data. The results showed that both strains were diploid genotypes, and both were consistent with the genotype of Chunyou 84, indicating a heterozygous state. Figure 6 Both of these plants were apomixis clones, with cloning efficiencies of 1.85% and 2.50%, respectively (Table 1). Furthermore, the growth and development of these two clones were consistent with the wild type. Figure 7 ).
[0110] Example 2: Corn ZmCPRO3, ZmCPRO4 and MiMe Methods for producing cloned seeds using rice apomixis systems composed of different system combinations
[0111] This method was applied to the indica-japonica hybrid rice Chunyou 84, resulting in transgenic lines with high and stable seed setting rates. In the ploidy identification of the progeny plants, cloned diploid plants with fixed genotypes were successfully identified. The process mainly consists of vector construction, genetic transformation, genotype identification, and result detection.
[0112] Carrier construction:
[0113] 1.1 AtEC1.2 Promoters and corn ZmCPRO3, ZmCPRO4 Obtaining gene coding sequences
[0114] (1) The required genome was amplified from the Arabidopsis thaliana genome. AtEC1.2 The required promoter and maize genome amplification ZmCPRO3, ZmCPRO4 The terminator was amplified on the vector using PC1300-ACTIN-CAS9. NOS .
[0115] The primers are as follows:
[0116] AtEC1.2-R: tatTCTTTCTTTTGGGG (SEQ ID NO.7);
[0117] AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8);
[0118] ZmCPRO3-F:caaaaagaaagaataATGGCTACCTACTACTCGAGCC (SEQ ID NO.11);
[0119] ZmCPRO3-R:AATGTTTGAACGATCTCACGCCACAAAATCATGGAG (SEQ ID NO.12);
[0120] ZmCPRO4-F:caaaaagaaagaataATGGCCACATTCTTCTCCACTTC (SEQ ID NO.13);
[0121] ZmCPRO4-R:AATGTTTGAACGATCTCACGCCACAAAATCGTGC (SEQ ID NO.14);
[0122] NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19);
[0123] NOS-F:GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0124] The products were purified using a recovery kit to obtain amplification products 1, 2, 3, and 4, respectively.
[0125] 1.2 Construction of Expression Box A
[0126] Expression box A was obtained in the same way as in Example 1.
[0127] 1.3 Construction of Expression Box B
[0128] Will AtEC1.2 promoter, corn ZmCPRO3, ZmCPRO4 The gene coding sequence and the NOS terminator were integrated into expression cassette A to obtain expression cassette B. The vector map is shown below. Figure 1 The specific method is the same as in Example 1.
[0129] 2. Genetic transformation
[0130] The specific method is the same as in Example 1.
[0131] 3. Detection of mutations and ectopic expression in transgenic T0 generation plants
[0132] (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for selecting T0 generation transgenic plants with homozygous mutations in all three genes is the same as in Example 1, screening for transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0133] (2) Genomic DNA was extracted from these plants using the CTAB method. Transgenic lines were identified using primer combinations of ZmC3-PCR-F and ZmC3-PCR-R, and ZmC4-PCR-F and ZmC4-PCR-R. The primer information used is as follows:
[0134] ZmC3-PCR-F:cccattcctcccactaatcc (SEQ ID NO.34);
[0135] ZmC3-PCR-R: GCCCGCCAGAAGCCGGGCTG (SEQ ID NO.35);
[0136] ZmC4-PCR-F:cccattcctcccactaatcc (SEQ ID NO.36);
[0137] ZmC4-PCR-R:CTTCCGACACGATGGTG (SEQ ID NO.37).
[0138] 4. Plant ploidy and genotype identification:
[0139] The specific method is the same as in Implementation Example 1.
[0140] 5. Test Results:
[0141] 5.1 ZmCPRO3
[0142] A total of 28 strains were obtained through genetic transformation. Hi-TOM detection technology was used to analyze 3 genes. OsPAIR1 OsREC8 and OsOSD1 The mutation types were detected, and transgenic positivity was identified. Results showed that 14 lines (PHJ-1, PHJ-2, PHJ-3, PHJ-5, PHJ-7, PHJ-8, PHJ-10, PHJ-14, PHJ-15, PHJ-17, PHJ-19, PHJ-21, PHJ-23, PHJ-24) were identified as simultaneously possessing the AtEC1.2:ZmCPRO3 expression element and... PAIR1, REC8, OSD1Homozygous mutations in three genes were identified. The growth and development of these 14 lines were consistent with the wild type, with a seed setting rate of 73.63±1.32%, compared to 71.24±6.51% for the wild-type Chunyou 84. Seeds from these lines were harvested upon maturity, and the T1 progeny seeds from the 14 lines were germinated. Flow cytometry analysis of the progeny ploidy was performed at the seedling stage, and one diploid plant was selected from one line (PHJ-24). Further validation of this genotype was achieved through whole-genome sequencing data. The results showed that this material was diploid, with a genotype identical to that of Chunyou 84, indicating a heterozygous state. This material was an apomixis clone with a cloning efficiency of 1.67% (Table 1). Furthermore, the growth and development of this clone were consistent with the wild type.
[0143] 5.2 ZmCPRO4
[0144] A total of 27 strains were obtained through genetic transformation. Hi-TOM detection technology was used to analyze 3 genes. OsPAIR1 OsREC8 and OsOSD1 The mutation types were detected, and transgenic positivity was identified. Results showed that eight lines (PHK-1, PHK-5, PHK-11, PHK-14, PHK J-16, PHK-17, PHK-22, and PHK-24) were identified as simultaneously possessing the AtEC1.2:ZmCPRO4 expression element and... PAIR1, REC8, OSD1 Homozygous mutations in three genes were identified. The growth and development of these eight lines were consistent with the wild type, with a seed setting rate of 76.10±9.90%, compared to 71.24±6.51% for the wild-type Chunyou 84. Seeds from these lines were harvested upon maturity, and the T1 progeny seeds from the eight lines were germinated. Flow cytometry analysis of the progeny ploidy was performed at the seedling stage, and three diploid plants were screened from one line (PHK-5). Further validation of the genotypes of these three plants using whole-genome sequencing data showed that they were diploid and identical to the Chunyou 84 genotype, indicating a heterozygous state. These three materials were apomixis clones with a cloning efficiency of 25% (Table 1). Furthermore, the growth and development of these three clones were consistent with the wild type.
[0145] Example 3: Soybeans GlCPRO2 and MiMe Methods for producing cloned seeds using rice apomixis systems composed of different system combinations
[0146] This method was applied to the indica-japonica hybrid rice Chunyou 84, resulting in transgenic lines with high and stable seed setting rates. In the ploidy identification of the progeny plants, cloned diploid plants with fixed genotypes were successfully identified. The process mainly consists of vector construction, genetic transformation, genotype identification, and result detection.
[0147] Carrier construction:
[0148] 1.1 AtEC1.2 Promoters and soybeans GlCPRO2 Obtaining gene coding sequences
[0149] (1) The required genome was amplified from the Arabidopsis thaliana genome. AtEC1.2 The required promoter and soybean genome amplification GlCPRO2 The terminator was amplified on the vector using PC1300-ACTIN-CAS9. NOS The primers are as follows:
[0150] AtEC1.2-R: tatTCTTTCTTTTGGGG (SEQ ID NO.7);
[0151] AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8);
[0152] GlCPRO2-F:caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG (SEQ ID NO.15);
[0153] GlCPRO2-R:AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG (SEQ ID NO.16);
[0154] NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19);
[0155] NOS-F:GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0156] The products were purified using a recovery kit to obtain amplification products 1, 2, and 3, respectively.
[0157] 1.2 Construction of Expression Box A
[0158] Expression box A was obtained in the same way as in Example 1.
[0159] 1.3 Construction of Expression Box B
[0160] Will AtEC1.2 promoter, soybean GlCPRO2 The gene coding sequence and the NOS terminator were integrated into expression cassette A to obtain expression cassette B. The vector map is shown below. Figure 1 The method is the same as in Example 1.
[0161] 2. Genetic transformation
[0162] The method is the same as in Example 1.
[0163] 3. Detection of mutations and ectopic expression in transgenic T0 generation plants
[0164] (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for selecting T0 generation transgenic plants with homozygous mutations in all three genes is the same as in Example 1, screening for transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0165] (2) Genomic DNA was extracted from these plants using the CTAB method. The transgenic lines were identified as transgenic using primer combinations of GlC2-PCR-F and GlC2-PCR-R. The primer information used is as follows:
[0166] GlC2-PCR-F: caccactaagcttcgaatcc (SEQ ID NO.38);
[0167] GlC2-PCR-R: GCCCCTACTGATGGTGATGG (SEQ ID NO. 39).
[0168] 4. Plant ploidy and genotype identification:
[0169] The specific method is the same as in Implementation Example 1.
[0170] 5. Test Results:
[0171] A total of 32 strains were obtained through genetic transformation. Hi-TOM detection technology was used to analyze three genes. OsPAIR1 OsREC8 and OsOSD1 The mutation types were detected, and transgene positivity was identified. Results showed that nine lines (PGL-2, PGL-4, PGL-8, PGL-10, PGL-11, PGL-13, PGL-14, PGL-20, and PGL-26) were identified as simultaneously possessing the AtEC1.2:GlCPRO2 expression element and... PAIR1, REC8, OSD1Homozygous mutations in three genes were identified. The growth and development of these nine lines were consistent with the wild type, with a seed setting rate of 70.1±7.83%, compared to 71.24±6.51% for the wild-type Chunyou 84. Seeds from these lines were harvested upon maturity, and the T1 progeny seeds from the nine lines were germinated. Flow cytometry analysis of the progeny ploidy was performed at the seedling stage, and one diploid plant was selected from one line (PGL-2). Further validation of this genotype was achieved through whole-genome sequencing data. The results showed that this material was diploid, with a genotype identical to Chunyou 84, indicating a heterozygous state. This material was an apomixis clone with a cloning efficiency of 1.51% (Table 1). Furthermore, the growth and development of this clone were consistent with the wild type.
[0172] Example 4: Rapeseed Bna CPRO8 and MiMe Methods for producing cloned seeds using rice apomixis systems composed of different system combinations
[0173] This method was applied to the indica-japonica hybrid rice Chunyou 84, resulting in transgenic lines with high and stable seed setting rates. In the ploidy identification of the progeny plants, cloned diploid plants with fixed genotypes were successfully identified. The process mainly consists of vector construction, genetic transformation, genotype identification, and result detection.
[0174] Carrier construction:
[0175] 1.1 AtEC1.2 promoters and rapeseed Bna CPRO8 Obtaining gene coding sequences
[0176] (1) The required genome was amplified from the Arabidopsis thaliana genome. AtEC1.2 The required promoter and rapeseed genome amplification BnaCPRO8 The terminator was amplified on the vector using PC1300-ACTIN-CAS9. NOS .
[0177] The primers are as follows:
[0178] AtEC1.2-R: tatTCTTTCTTTTGGGG (SEQ ID NO.7);
[0179] AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8);
[0180] Bna CPRO8-F:caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG (SEQ ID NO.17);
[0181] Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG (SEQ ID NO.18);
[0182] NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19);
[0183] NOS-F:GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0184] The products were purified using a recovery kit to obtain amplification products 1, 2, and 3, respectively.
[0185] 1.2 Construction of Expression Box A
[0186] Expression box A was obtained in the same way as in Example 1.
[0187] 1.3 Construction of Expression Box B
[0188] Will AtEC1.2 promoter, rapeseed Bna CPRO8 The gene coding sequence and the NOS terminator were integrated into expression cassette A to obtain expression cassette B. The vector map is shown below. Figure 1 The method is the same as in Example 1.
[0189] 2. Genetic transformation
[0190] The method is the same as in Example 1.
[0191] 3. Detection of mutations and ectopic expression in transgenic T0 generation plants
[0192] (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for selecting T0 generation transgenic plants with homozygous mutations in all three genes is the same as in Example 1, screening for transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0193] (2) Genomic DNA was extracted from these plants using the CTAB method. The transgenic lines were identified as transgenic using primer combinations BnaC8-PCR-F and BnaC8-PCR-R. The primer information used is as follows:
[0194] BnaC8-PCR-F:caccactaagcttcgaatcc (SEQ ID NO.40);
[0195] BnaC8-PCR-R:GTTAGGGATATCGAGACCGC (SEQ ID NO. 41).
[0196] 4. Plant ploidy and genotype identification:
[0197] The specific method is the same as in Implementation Example 1.
[0198] 5. Test Results:
[0199] A total of 35 strains were obtained through genetic transformation. Hi-TOM detection technology was used to analyze three genes. OsPAIR1 OsREC8 and OsOSD1 The mutation types were detected, and transgenic positivity was identified. Results showed that a total of 10 lines (PGY-2, PGY-4, PGY-6, PGY-9, PGY-12, PGY-15, PGY-22, PGY-25, PGY-28, and PGY-30) were identified as simultaneously possessing the AtEC1.2:BnaCPRO8 expression element and... PAIR1, REC8, OSD1 Homozygous mutations in three genes were identified. The growth and development of these 10 lines were consistent with the wild type, with a seed setting rate fluctuating between 54.07% and 88.67%, while the seed setting rate of the wild-type Chunyou 84 was 71.24 ± 6.51%. Seeds from these lines were harvested upon maturity, and the T1 progeny seeds from the 10 lines were germinated. Flow cytometry analysis of the progeny ploidy was performed at the seedling stage, and one diploid plant was selected from each of the two lines (PGY-28 and PGY-30). Further validation of the genotypes of these two plants was achieved through whole-genome sequencing. The results showed that both plants were diploid and identical to the Chunyou 84 genotype, indicating a heterozygous state. Both plants were apomixis clones with cloning efficiencies of 1.79% and 1.92%, respectively (Table 1). Furthermore, the growth and development of these two clones were consistent with the wild type.
[0200] Table 1 Genes that induce haploids CPRO Statistics on the cloning seed efficiency of apomixis lines
[0201] .
Claims
1. A method for producing cloned seeds in a rice apomixis system using a gene that induces plant apomixis, characterized in that, Includes the following steps: 1) Carrier construction (1) First, design primers. The primers are specifically as follows: AtEC1.2-R: tatTCTTTCTTTTGGGG; AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc; AtCPRO1-F:caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC; AtCPRO1-R:AATGTTTGAACGATCTCAAGCTACAAATCATGTACCAATTGTG; ZmCPRO3-F: caaaaagaaagaataATGGCTACCTACTACTCGAGCC; ZmCPRO3-R:AATGTTTGAACGATCTCACGCCACAAAATCATGGAG; ZmCPRO4-F: caaaaagaaagaataATGGCCACATTCTTCTCCACTTC; ZmCPRO4-R:AATGTTTGAACGATCTCACGCCACAAAATCGTGC; GlCPRO2-F:caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG; GlCPRO2-R:AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG; Bna CPRO8-F:caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG; Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG; NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC; NOS-F:GATCGTTCAAACATTTGGCAATAAAG; (2) Using the primers described above, the promoter of gene AtEC1.2 and gene AtCPRO1 were cloned from Arabidopsis thaliana, genes ZmCPRO3 and ZmCPRO4 were cloned from maize, gene GlCPRO2 was cloned from soybean, and gene BnaCPRO8 was cloned from rapeseed. The terminator NOS was then amplified on the pc1300-actin-cas9 vector. The nucleotide sequences of the Arabidopsis thaliana AtCPRO1, maize ZmCPRO3 and ZmCPRO4, rapeseed BnaCPRO8, and soybean GlCPRO2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. The nucleotide sequence of the promoter of AtEC1.2 is shown in SEQ ID NO.
6. (3) Construction of expression box A Through the construction of the sgMiMe intermediate vector and the sgMiMe vector, a multi-gene knockout expression cassette A that can simultaneously knock out four target sites of the three genes REC8, OSD1 and PAIR1 was finally obtained; the four target site sequences of the three genes PAIR1, REC8 and OSD1 are shown in SEQ ID NO.21-24. (4) Construction of expression box B The AtEC1.2 promoter, along with the coding sequences of any one of the genes AtCPRO1, Zm CPRO3, Zm CPRO4, GlCPRO2, and Bna CPRO8, and the NOS terminator, are integrated into expression cassette A to obtain the complete expression cassette B complex vector, which is the recombinant product. 2) The recombinant product obtained above is cloned; 3) Genetic transformation: embryogenic callus tissue prepared from rice seeds was transformed with Agrobacterium containing the recombinant product, and transgenic plants were obtained by culturing. 4) Diploidy identification of the seeds of the transgenic plants.
2. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 1, characterized in that, When cloning its recombinant product, the recombinant product is transferred into competent DH5α cells for cloning.
3. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 2, characterized in that, During its genetic transformation, the Agrobacterium EHA105 strain was used as the mediated genetic transformation method.
4. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 3, characterized in that, The rice variety it was transformed into is the indica-japonica hybrid rice variety Chunyou 84.
5. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 4, characterized in that, The method for identifying diploidity is as follows: flow cytometry is used to identify diploidity.
Citation Information
Patent Citations
CN114957422A