Soybean 1-aminocyclopropane-1-carboxylate synthase mutant based on single amino acid deletion

Abstract

The invention is applicable to the technical field of plant genetic engineering, and provides a soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant based on single amino acid deletion, and the soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant is named as # imgabs 0 # and # imgabs 1 #; the amino acid sequence of the # imgabs2 is as shown in SEQ ID NO. 1; the amino acid sequence of the # imgabs3 # is as shown in SEQ ID NO. 2. A functional site modification technology of the soybean 1-aminocyclopropane-1-carboxylic acid synthase is utilized to obtain the 1-aminocyclopropane-1-carboxylic acid synthase active mutant in which the activity of the 1-aminocyclopropane-1-carboxylic acid synthase is completely lost and the activity of C-S lyase is partially retained, and a novel target and a gene resource are provided for creation of soybean stress-resistant varieties. The soybean 1-aminocyclopropane-1-carboxylic acid synthase and the 1-aminocyclopropane-1-carboxylic acid synthase in other plants have high conservative property at the corresponding D site, and are important regulation and control sites of the double-enzyme activity of the 1-aminocyclopropane-1-carboxylic acid synthase, so that the same effect can be generated by performing similar deletion in homologous proteins of soybeans and other plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the modification of the dual enzyme activities of two soybean 1-aminocyclopropane-1-carboxylate synthases based on specific single amino acid deletions at key sites, and the creation of active mutants of 1-aminocyclopropane-1-carboxylate synthase. Background Art

[0002] As a gaseous hormone, ethylene plays an important regulatory role in multiple processes of plant growth and development, including seed germination, cell elongation, root development, flowering, and fruit ripening. In addition, ethylene is also indispensable in the response processes of plants to various biotic and abiotic stresses, including pathogen invasion, flooding, high temperature, high salt, and drought. In seed plants, the rate-limiting step of ethylene biosynthesis is catalyzed by 1-aminocyclopropane-1-carboxylate synthase. 1-aminocyclopropane-1-carboxylate synthase is encoded by a multi-gene family, and the amino acid sequences of its members all contain a conserved AAT-like (Aspartate aminotransferases-like) domain and belong to the α superfamily of Pyridoxal-5’-Phosphate (PLP)-dependent proteases. In addition to 1-aminocyclopropane-1-carboxylate synthase, other subfamilies of this family also include aminotransferases and C-S lyases, etc.

[0003] For a long time, it has been unanimously believed that 1-aminocyclopropane-1-carboxylic acid synthase is a single enzyme that can only catalyze the formation of 1-aminocyclopropane-1-carboxylic acid from SAM and is involved in the biosynthesis of ethylene in plants, mainly acting on developmental processes such as fruit ripening and organ senescence. However, recent studies have found that in higher plants, 1-aminocyclopropane-1-carboxylic acid synthase not only has the 1-aminocyclopropane-1-carboxylic acid synthase activity as traditionally recognized, but also has C-S lyase activity, which can catalyze the formation of ammonium ions, pyruvate, and thiocysteine using cystine as a substrate, and further generate hydrogen sulfide. Pyruvate and hydrogen sulfide play important roles in plant growth and development and resistance to various abiotic stresses. The discovery of the dual enzyme activities of 1-aminocyclopropane-1-carboxylic acid synthase in higher plants makes it a key intersection point for promoting two different but closely related life processes of plant development, fruit ripening, and resistance to abiotic stresses. The balance and regulation of its dual enzyme activities are important targets for crop improvement using biotechnological means. In-depth analysis of the key domains and key sites of the dual enzyme activities of 1-aminocyclopropane-1-carboxylic acid synthase in higher plants will not only open up a new perspective for elucidating the biological functions of 1-aminocyclopropane-1-carboxylic acid synthase, but also provide important gene resources for the creation of high-yield and stress-resistant new varieties, with important theoretical value and practical significance.

[0004] Soybean (Glycine max) is an important crop in China that can be used as both food and oil, as well as feed, and has an important strategic position in the development of the national economy. The plant hormone ethylene also plays important roles in soybean growth and development and responses to abiotic stresses. However, up to now, there have been no reports on the identification of key sites and key domains, the mechanism of action, and the regulation and utilization of the dual enzyme activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase in soybean 1-aminocyclopropane-1-carboxylic acid synthase. Summary of the Invention

[0005] The purpose of the embodiments of the present invention is to provide soybean 1-aminocyclopropane-1-carboxylic acid synthase mutants based on single amino acid deletions, aiming to solve the problems proposed in the above background technology.

[0006] The embodiments of the present invention are implemented as follows. For the soybean 1-aminocyclopropane-1-carboxylic acid synthase mutants based on single amino acid deletions, using molecular biological means, specific single amino acids at the key sites of the dual enzyme activities of soybean 1-aminocyclopropane-1-carboxylic acid synthase are deleted, thereby creating corresponding 1-aminocyclopropane-1-carboxylic acid synthase mutants with altered dual enzyme activities. The 1-aminocyclopropane-1-carboxylic acid synthase mutants are respectively and ;

[0007] The The unreported functional 1-aminocyclopropane-1-carboxylic acid synthase homologous gene located at positions 42453584 - 42455777 on chromosome Gm05 of the soybean genome is temporarily named GmAH1 ( G lycine m ax1- a minocyclopropane-1-carboxylate synthase h omologous protein 1). Deleting the bases G, A, and T at positions 42454464, 42454465, and 42454466 on its genome, or the corresponding bases G, A, and T at positions 704, 705, and 706 in its cDNA sequence, or deleting the bases G, A, and U at positions 704, 705, and 706 corresponding to its mRNA sequence, can cause the soybean GmAH1 protein to lack one amino acid, i.e., aspartic acid (Asp, D), between the original amino acids at positions 144 - 146. The mutated GmAH1 protein, i.e., , retains 15% of the original C-S lyase activity and loses all 1-aminocyclopropane-1-carboxylic acid synthase activity. The amino acid sequence is shown in SEQ ID NO.1.

[0008] The unreported functional 1-aminocyclopropane-1-carboxylic acid synthase homologous gene located at positions 2422317 - 2424407 on chromosome Gm08 of the soybean genome is temporarily named GmAH2 ( G lycine m ax 1- a minocyclopropane-1-carboxylate synthase h omologous protein 2). Deleting the three bases A, G, and A at positions 2423097, 2423098, and 2423099 on its genome, or the corresponding three bases at positions 682, 683, and 684 in its cDNA and mRNA sequences, can cause the soybean GmAH2 protein to lack one amino acid, i.e., aspartic acid (Asp, D), between the original amino acids at positions 144 - 146. The mutated GmAH2 protein, i.e., , retains 11% of the original C-S lyase activity and loses all 1-aminocyclopropane-1-carboxylic acid synthase activity. The amino acid sequence is shown in SEQ ID NO.2.

[0009] The soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant based on single amino acid deletion provided in the embodiment of the present invention has created two soybean 1-aminocyclopropane-1-carboxylic acid synthase mutants, and the functional site modification technology of 1-aminocyclopropane-1-carboxylic acid synthase, a key enzyme in soybean ethylene synthesis, is used to site-specifically delete specific aspartic acid residues to obtain soybean 1-aminocyclopropane-1-carboxylic acid synthase mutants in which 1-aminocyclopropane-1-carboxylic acid synthase activity is completely lost but CS lyase activity is partially retained, thereby providing new targets and new gene resources for the creation of soybean stress-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 For GmAH1 and SDS-PAGE electrophoresis diagram;

[0011] Figure 2 For GmAH1 and Detection of 1-aminocyclopropane-1-carboxylate synthase and CS lyase activities;

[0012] Figure 3 For GmAH2 and SDS-PAGE electrophoresis diagram;

[0013] Figure 4 For GmAH2 and Detection of 1-aminocyclopropane-1-carboxylate synthase and CS lyase activities;

[0014] Figure 5 It is an amino acid sequence comparison diagram of the two soybean 1-aminocyclopropane-1-carboxylate synthase sequences in the present invention and the 1-aminocyclopropane-1-carboxylate synthase sequences in other plants (such as Arabidopsis, tomato and rice). DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0016] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0017] A soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant based on a single amino acid deletion is provided in one embodiment of the present invention, wherein the 1-aminocyclopropane-1-carboxylic acid synthase mutant is and ;

[0018] Said The 1-aminocyclopropane-1-carboxylic acid synthase homologous gene located at positions 42453584 - 42455777 of chromosome Gm05 in the soybean genome, whose function has not been reported, is temporarily named GmAH1 ( G lycine m ax1- a minocyclopropane-1-carboxylate synthase h omologous protein 1). Deleting the bases G, A, and T at positions 42454464, 42454465, and 42454466 on its genome, or corresponding to bases G, A, and T at positions 704, 705, and 706 in its cDNA sequence, or deleting bases G, A, and U at positions 704, 705, and 706 corresponding to its mRNA sequence, can cause the soybean GmAH1 protein to lack an amino acid between the original amino acids at positions 144 - 146, that is, aspartic acid (Asp, D). The mutated GmAH1 protein, that is , retains 15% of the original C-S lyase activity and loses all 1-aminocyclopropane-1-carboxylic acid synthase activity. The amino acid sequence is shown in SEQ ID NO.1.

[0019] The 1-aminocyclopropane-1-carboxylic acid synthase homologous gene located at positions 2422317 - 2424407 of chromosome Gm08 in the soybean, whose function has not been reported, is temporarily named GmAH2 ( G lycine m ax 1- a minocyclopropane-1-carboxylate synthase h omologous protein 2). Deleting the three bases A, G, and A at positions 2423097, 2423098, and 2423099 on its genome, or corresponding to positions 682, 683, and 684 in its cDNA and mRNA sequences, can cause the soybean GmAH2 protein to lack an amino acid between the original amino acids at positions 144 - 146, that is, aspartic acid (Asp, D). The mutated GmAH2 protein, that is , retains 11% of the original C-S lyase activity and loses all 1-aminocyclopropane-1-carboxylic acid synthase activity. The amino acid sequence is shown in SEQ ID NO.2.

[0020] As a preferred embodiment of the present invention, the preparation method of the is as follows:

[0021] Step 1: Design primers;

[0022] (1)Design primers at the very front and very end of the gene, seamless cloning primers can be used;

[0023] 05F:

[0024] CAGCAAATGGGTCGCGGATCCATGGGTATCAAGATTGAGCAAGAGCAACC

[0025] 05R:

[0026] TGGTGGTGCTCGAGTGCGGCCGCTTACTCTTTCTTCATTCGTTCCATGAA;

[0027] (2)Design primers at the positions lacking bases, take about 15 bp from the upstream and downstream respectively, about 30 bp in total;

[0028] 05D-F: CAGGAGCTCTACTTGTTCC

[0029] 05D-R: TAGAGCTCCTGGGTTAGCAA;

[0030] Step 2: PCR amplification experiment;

[0031] (1)Amplification of A and B fragments;

[0032] Primers for A fragment amplification:

[0033] 05F:

[0034] CAGCAAATGGGTCGCGGATCCATGGGTATCAAGATTGAGCAAGAGCAACC

[0035] 05D-R: TAGAGCTCCTGGGTTAGCAA

[0036] 459 bp

[0037] Primers for B fragment amplification:

[0038] 05D-F: CAGGAGCTCTACTTGTTCC

[0039] 05R:

[0040] TGGTGGTGCTCGAGTGCGGCCGCTTACTCTTTCTTCATTCGTTCCATGAA

[0041] 916 bp

[0042] In a 50 μl reaction system, using the plasmid containing the wild-type GmAH1 gene as a template, 1 μl of each 10 μM primer, and HiFi Hot Start as the DNA polymerase; the amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 1 min; 72°C for 10 min; a total of 25 cycles.

[0043] (2)The AB fragment fusion was 1364 bp;

[0044] The amplification reaction system was: in a 50 μl reaction system, according to the concentrations and lengths of the A and B fragments respectively, following the principle of a total volume of 15 μl, calculate the volumes of the A and B fragments to be added respectively, and use HiFi Hot Start as the DNA polymerase; the amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 2 min; 72°C for 10 min; a total of 11 cycles. Then, using the purified products obtained in this step as templates respectively, with HiFi Hot Start as the DNA polymerase and GmAH1 upstream and downstream 05F and 05R as primers, the target product GmAH1 mutant was obtained by fusion PCR, that is .

[0045] Step 3: In vitro protein expression and purification;

[0046] After purifying the above PCR products, the products were ligated to the pMD_18-T vector according to the pMD_18-T Vector Cloning Kit. After being verified correct by sequencing, the pMD_18-T vector and the expression vector pET28a were double digested with BamH I and Not I, and then the target fragment was ligated to pET28a to obtain the expression vector of the nucleotide sequence. Take 20 ng of the vector verified by sequencing and transform it into BL21 competent cells, coat it on an LB plate containing ampicillin, and culture it overnight at 37°C. Pick a single clone the next day. Culture and collect the transformed cells, and extract and purify according to the His-Trap FF column (GE Healthcare, product number 17-5255-01) instruction manual ( Figure 1 ).

[0047] In the examples of the present invention, the methods for measuring the activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase are as follows:

[0048] The purified mutant protein was subjected to a dual enzyme activity assay for measuring the activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase according to the following method. Among them:

[0049] The method for measuring the activity of 1-aminocyclopropane-1-carboxylate synthase is as follows: incubate the purified 1-aminocyclopropane-1-carboxylate synthase mutant protein or the corresponding positive and negative controls (GmAH1, the same process protein extract of the strain transformed with the empty vector pET28a), 1-aminocyclopropane-1-carboxylate synthase reaction buffer (50 mM EPPS, pH 8.5, 10 μM PLP, 2 mM DTT), and S-adenosylmethionine (SAM) together, terminate the reaction with 100 mM HgCl2, and then add freshly prepared ACC assay solution [saturated NaOH:sodium hypochlorite = 2:1 (v:v)] to convert the generated 1-aminocyclopropane-1-carboxylate into ethylene, and analyze and calculate the ethylene production using a gas chromatograph (Agilent 7890A).

[0050] The basic reaction system for measuring C-S lyase activity is: incubate the purified 1-aminocyclopropane-1-carboxylate synthase mutant protein or the corresponding positive and negative controls, a substrate such as L-cystine, 0.1 M potassium phosphate buffer pH 7.8, 10 mM PLP, and 2 mM DTT together, and extract the protein with chloroform after the reaction. For the determination of the reaction product pyruvate, spectrophotometry is used to detect the amount of pyruvate-2,4-dinitrophenylhydrazone formed by the reaction of pyruvate with 2,4-dinitrophenylhydrazine.

[0051] The results of the determination of the activities of 1-aminocyclopropane-1-carboxylate synthase and C-S lyase are as Figure 2 shown, where Figure 2 The picture in A is the pyruvate color reaction of GmAH1, and the bar graph quantifies the C-S lyase activity of GmAH1 and its 1-aminocyclopropane-1-carboxylate synthase activity according to the OD 520 value of the post-reaction mixture. This experiment uses the pET28a empty vector as the negative control. The error bars represent the standard error values of three biological replicates. Figure 2 The picture in B is the pyruvate color reaction, and the bar graph quantifies the C-S lyase activity of 520 and its 1-aminocyclopropane-1-carboxylate synthase activity according to the OD value of the post-reaction mixture. This experiment uses the pET28a empty vector as the negative control. The error bars represent the standard error values of three biological replicates. The detection results show that compared with GmAH1, completely loses its 1-aminocyclopropane-1-carboxylate synthase activity, and its C-S lyase activity retains 15% of the original.

[0052] As a preferred embodiment of the present invention, the The preparation method is as follows:

[0053] Step 1: Design primers;

[0054] (1) Design primers at the very front and very end of the gene, and seamless cloning primers can be used.

[0055] 08F:

[0056] CAGCAAATGGGTCGCGGATCCATGGGTATCAAGATTGAGCAAGAGCAACC;

[0057] 08R:

[0058] TGGTGGTGCTCGAGTGCGGCCGCTTAGTCTTTCTTCATTCGTTCCATGAA;

[0059] (2) Design primers at the positions lacking bases. Take about 15 bp from the upper and lower parts respectively, for a total of about 30 bp;

[0060] 08D-F: ACCCAGGTGCTCTACTTGTTCC;

[0061] 08D-R: AGAGCACCTGGGTTTGCAAG;

[0062] Step 2: PCR amplification experiment;

[0063] (1) Amplification of A and B fragments:

[0064] Primers for A fragment amplification:

[0065] 08F:

[0066] CAGCAAATGGGTCGCGGATCCATGGGTATCAAGATTGAGCAAGAGCAACC

[0067] 08D-R: AGAGCACCTGGGTTTGCAAG

[0068] 458 bp

[0069] Primers for B fragment amplification:

[0070] 08D-F: ACCCAGGTGCTCTACTTGTTCC

[0071] 08R:

[0072] TGGTGGTGCTCGAGTGCGGCCGCTTAGTCTTTCTTCATTCGTTCCATGAA

[0073] 919 bp

[0074] In a 50 μl reaction system, using the plasmid containing the wild-type GmAH2 gene as a template, 1 μl of each 10 μM primer, and HiFi Hot Start as the DNA polymerase; the amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 1 min; 72°C for 10 min; a total of 25 cycles.

[0075] (2)AB fragment fusion:

[0076] The amplification reaction system was: in a 50 μl reaction system, according to the concentrations and lengths of the A and B fragments respectively, following the principle of a total volume of 15 μl, calculate the volumes of the A and B fragments to be added respectively, and use HiFi Hot Start as the DNA polymerase; the amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 2 min; 72°C for 10 min; a total of 11 cycles. Then, using the purified products obtained in this step as templates respectively, with HiFi Hot Start as the DNA polymerase and GmAH2 upstream and downstream 08F and 08R as primers, the target product GmAH2 mutant was obtained through fusion PCR, that is .

[0077] Step 3: In vitro protein expression and purification;

[0078] After purifying the above PCR products, the products were ligated to the pMD_18-T vector according to the pMD_18-T Vector Cloning Kit. After correct verification by sequencing, the pMD_18-T vector and the expression vector pET28a were double-digested with BamH I and Not I, and then the target fragment was ligated to pET28a, the expression vector of the above nucleotide sequence. Take 20 ng of the vector with correct sequencing verification and transform it into BL21 competent cells, spread it on an LB plate containing ampicillin, and culture it overnight at 37°C. Pick monoclonal colonies the next day. Culture and collect the transformed cells, and extract and purify according to the His-Trap FF column (GE Healthcare, product number 17-5255-01) instruction manual ( Figure 3 ).

[0079] In the examples of the present invention, the methods for measuring the activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase are as follows:

[0080] The purified mutant protein was subjected to a dual enzyme activity assay for measuring the activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase according to the following method. Among them:

[0081] The method for determining the activity of 1-aminocyclopropane-1-carboxylic acid synthase is as follows: The purified 1-aminocyclopropane-1-carboxylic acid synthase mutant protein or the corresponding positive and negative controls (GmAH2, the same process protein extract of the strain transformed with the empty vector pET28a), 1-aminocyclopropane-1-carboxylic acid synthase reaction buffer (50 mM EPPS, pH 8.5, 10 μM PLP, 2 mM DTT), and S-adenosylmethionine (SAM) are incubated together, and the reaction is terminated with 100 mM HgCl2. Then, freshly prepared ACC assay solution [saturated NaOH:sodium hypochlorite = 2:1 (v:v)] is added to convert the generated 1-aminocyclopropane-1-carboxylic acid into ethylene, and the amount of ethylene generated is analyzed and calculated using a gas chromatograph (Agilent 7890A).

[0082] The basic reaction system for the determination of C-S lyase activity is as follows: The purified 1-aminocyclopropane-1-carboxylic acid synthase mutant protein or the corresponding positive control and negative control, a substrate such as L-cystine, 0.1 M potassium phosphate buffer pH 7.8, 10 mM PLP, and 2 mM DTT are incubated together. After the reaction is completed, chloroform is added to extract the protein. For the determination of the reaction product pyruvate, spectrophotometry is used to detect the amount of pyruvate-2,4-dinitrophenylhydrazone formed by the reaction of pyruvate with 2,4-dinitrophenylhydrazine.

[0083] The results of the determination of the activities of 1-aminocyclopropane-1-carboxylic acid synthase and C-S lyase are as Figure 4 shown, where Figure 4 The picture in A is the pyruvate color reaction of GmAH2. The bar graph quantifies the C-S lyase activity of GmAH2 and its 1-aminocyclopropane-1-carboxylic acid synthase activity based on the OD 520 value of the reaction mixture after the reaction. In this experiment, the empty pET28a vector was used as the negative control. The error bars represent the standard error values of three biological replicates. Figure 4 The picture in B is the pyruvate color reaction of 520 and the bar graph quantifies the C-S lyase activity of and its 1-aminocyclopropane-1-carboxylic acid synthase activity based on the OD value of the reaction mixture after the reaction. In this experiment, the empty pET28a vector was used as the negative control. The error bars represent the standard error values of three biological replicates. The detection results show that compared with the wild-type GmAH2,

[0084] In addition, as Figure 5 shown, the amino acid sequences of the two soybean 1-aminocyclopropane-1-carboxylic acid synthase sequences in the present invention were aligned with the 1-aminocyclopropane-1-carboxylic acid synthase sequences in other plants (such as Arabidopsis thaliana, tomato, and rice). The results showed that the D locus involved in the present invention has high conservation and is an important regulatory locus for the dual enzyme activity of 1-aminocyclopropane-1-carboxylic acid synthase. Given that conserved amino acid sites are often located in the key domains or active centers of proteins and are indispensable for maintaining the normal functions of proteins, it is indicated that similar deletions at this locus in homologous proteins of soybeans and other plants can also produce the same effects, and this locus can be used as a novel target for soybean molecular breeding.

[0085] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant based on single amino acid deletion, characterized in that, The 1-aminocyclopropane-1-carboxylic acid synthase mutant is prepared by site-directed deletion of specific aspartic acid residues of soybean 1-aminocyclopropane-1-carboxylic acid synthase, and the 1-aminocyclopropane-1-carboxylic acid synthase mutant is and ; The said has the amino acid sequence shown in SEQ ID NO.1; The said has an amino acid sequence as shown in SEQ ID NO.

2.

2. The mutant of soybean 1-aminocyclopropane-1-carboxylic acid synthase based on single amino acid deletion according to claim 1, wherein The 1-aminocyclopropane-1-carboxylic acid synthase mutant may also be obtained by modifying the corresponding conserved D site in various plant homologous proteins.

Images