Osmanthus fragrans transcription factors OfbHLH10 and OfWRKY78 for regulating synthesis of flower fragrance component beta-ionone as well as encoding genes and application of osmanthus fragrans transcription factors OfbHLH10 and OfWRKY78

Abstract

The invention discloses osmanthus transcription factors OfbHLH10 and OfWRKY78 for regulating synthesis of a flower fragrance component beta-ionone as well as a coding gene and application of the osmanthus transcription factors OfbHLH10 and OfWRKY78, and belongs to the field of plant molecular biology. The amino acid sequence of the osmanthus fragrans transcription factor OfbHLH10 provided by the invention is as shown in SEQ ID NO. 2, and the amino acid sequence of the transcription factor OfWRKY78 interacting with the osmanthus fragrans transcription factor OfbHLH10 is as shown in SEQ ID NO. 4. According to the invention, carriers constructed by CDs of OfWRKY78 and a promoter of OfCCD4 are jointly injected into Ben's tobacco leaves, a dual-luciferase experiment is carried out, and a result shows that OfbHLH10 has a promoting effect on expression of a synthetase gene OfCCD4 of beta-ionone, OfWRKY78 has an inhibiting effect on expression of OfCCD4, and OfbHLH10 and OfWRKY78 interact with each other and has an antagonistic effect on expression of OfCCD4. The gene provided by the invention can effectively regulate and control the content of beta-ionone in osmanthus fragrans fragrance, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and particularly relates to transcription factors OfbHLH10 and OfWRKY78 that regulate the synthesis of β-ionone, an osmanthus fragrance component, their encoding genes, and applications thereof. Background Art

[0002] bHLH (basic helix-loop-helix) transcription factors are one of the largest transcription factor families in plants. Their domains are highly conserved and usually consist of two functionally different regions, containing approximately 60 amino acids. The N-terminal basic region includes approximately 10 - 17 basic amino acids, and the C-terminal helix 1-loop-helix 2 (HLH) region contains about 40 amino acids. bHLH plays an important role in plant growth and development, secondary metabolism, abiotic stress responses, etc.

[0003] WRKY is a class of trans-acting factors unique to plants. The characteristic of WRKY proteins is that they contain one or two highly conserved WRKYGQK sequences and a C2H2 or C2HC type zinc finger domain. According to the number of WRKY domains and the type of zinc finger structure, the members of the WRKY family are divided into three categories (I, II, and III). Members of group I contain two WRKY domains, while members of groups II and III have only one WRKY domain. A large number of studies have shown that WRKY transcription factors play a key role in regulating the synthesis of plant metabolites.

[0004] Osmanthus fragrans is one of the top ten traditional famous flowers in China and belongs to the genus Osmanthus of the Oleaceae family. Because of its unique fragrance and fresh and elegant tree shape, it is loved by the broad masses of the people and is often given the meaning of loftiness, peace, and beauty. Previous comprehensive studies on the compound identification and classification of osmanthus flower fragrance have found that β-ionone is an important substance that strongly affects the osmanthus flower fragrance, and the CCD4 protein can catalyze the oxidative cleavage of β-carotene to produce the volatile substance β-ionone. However, there are relatively few studies on the regulatory network analysis of the synthesis and release of the key osmanthus flower fragrance component β-ionone. Therefore, it is of great significance to explore the regulatory network that regulates the key osmanthus flower fragrance component β-ionone. Summary of the Invention

[0005] In view of the above problems existing in the prior art, the technical problems to be solved by the present invention are to provide a transcription factor OfbHLH10 related to the synthesis of the key aroma substance β-ionone in osmanthus and its encoding gene. Another technical problem to be solved by the present invention is to provide a transcription factor OfWRKY78 that interacts with the aforementioned transcription factor OfbHLH10 and its encoding gene. The last technical problem to be solved by the present invention is to provide the application of the encoding genes of the transcription factors OfbHLH10 and OfWRKY78 in regulating the synthesis of β-ionone.

[0006] In view of the above problems existing in the prior art, the technical solutions adopted by the present invention are as follows:

[0007] An osmanthus transcription factor OfbHLH10, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] The gene encoding the osmanthus transcription factor OfbHLH10, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] An expression cassette, recombinant vector, recombinant bacterium or recombinant cell containing the gene encoding the osmanthus transcription factor OfbHLH10.

[0010] An osmanthus transcription factor OfWRKY78, the amino acid sequence of which is shown in SEQ ID NO.4.

[0011] The gene encoding the osmanthus transcription factor OfWRKY78, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0012] An expression cassette, recombinant vector, recombinant bacterium or recombinant cell containing the gene encoding the osmanthus transcription factor OfWRKY78.

[0013] The application of a biological material related to the osmanthus transcription factor OfbHLH10. In some embodiments, the application is any one of the following 1) or 2): 1) regulating the synthesis of the floral fragrance component β-ionone, so that the content of the β-ionone component in the floral fragrance of the plant is increased or decreased; 2) osmanthus breeding; the biological material is at least one of the gene encoding the osmanthus transcription factor OfbHLH10, an expression cassette containing the gene encoding the osmanthus transcription factor OfbHLH10, a recombinant vector, a recombinant bacterium, and a recombinant cell.

[0014] Application of biological materials related to the osmanthus transcription factor OfWRKY78. In some embodiments, the application is any one of the following 1) or 2): 1) regulating the synthesis of the floral scent component β-ionone to increase or decrease the content of β-ionone in the floral scent of plants; 2) osmanthus breeding; the biological materials are at least one of the gene encoding the osmanthus transcription factor OfWRKY78, an expression cassette containing the gene encoding the osmanthus transcription factor OfWRKY78, a recombinant vector, a recombinant bacterium, and a recombinant cell.

[0015] A method for regulating the synthesis of the floral scent component β-ionone, comprising

[0016] 1) constructing an overexpression vector for the coding gene of the osmanthus transcription factor OfbHLH10 or a silencing vector for the coding gene of the osmanthus transcription factor OfWRKY78, transforming it into a plant plant or plant tissue, and cultivating and screening to obtain a transgenic plant plant or flower tissue with increased β-ionone component in the floral scent;

[0017] Or, 2) constructing a silencing vector for the coding gene of the osmanthus transcription factor OfbHLH10 or an overexpression vector for the coding gene of the osmanthus transcription factor OfWRKY78, transforming it into a plant plant or flower tissue, and cultivating and screening to obtain a transgenic plant plant or flower tissue with decreased β-ionone component in the floral scent.

[0018] In some embodiments, the transformation is specifically by Agrobacterium transformation.

[0019] Advantageous effects: Compared with the prior art, the advantageous effects of the present invention are:

[0020] 1) The application of OfbHLH10 disclosed in the present invention in the synthesis of the key aroma substance β-ionone in osmanthus, and the nucleotide sequence of OfbHLH10 is shown in SEQ ID NO.1. The present invention infects the OfbHLH10 gene into osmanthus petals; and performs GC-MS determination. The results show that OfbHLH10 promotes the synthesis of β-ionone.

[0021] 2) Application of the module OfbHLH10-OfWRKY78-OfCCD4 disclosed by the present invention in regulating the synthesis of β-ionone. The present invention co-injected the vector constructed with the CDs of OfbHLH10 and OfWRKY78 and the promoter of OfCCD4 into the leaves of Nicotiana benthamiana for a dual-luciferase experiment (measuring luciferin and renilla luciferin). The results showed that OfbHLH10 promoted the expression of OfCCD4, OfWRKY78 inhibited the expression of OfCCD4, and when OfbHLH10 interacted with OfWRKY78, the expression of OfCCD4 was not significantly different from that of the control. The results indicated that the OfbHLH10 and OfWRKY78 proteins had an antagonistic effect on the expression of OfCCD4, thereby affecting the synthesis of β-ionone in Osmanthus fragrans.

[0022] In summary, the transcription factors OfbHLH10 and OfWRKY78 provided by the present invention can effectively regulate the increase or decrease of the content of β-ionone in the floral fragrance of Osmanthus fragrans, so that new transgenic Osmanthus fragrans varieties with different floral fragrance types and styles can be obtained, having good application prospects. Description of the Drawings

[0023] Figure 1 It is the amplification diagram of the OfbHLH10 gene;

[0024] Figure 2 It is the verification diagram of the ligation and transformation bacteria;

[0025] Figure 3 It is the double digestion verification diagram;

[0026] Figure 4 It is the verification diagram of the transformed GV3101 (psoup) bacteria;

[0027] Figure 5 It is the verification result diagram of the transient transformation of Osmanthus fragrans petals by OfbHLH10. Among them, A is the detection result diagram of the OfbHLH10 expression by fluorescence quantitative experiment; B is the detection result diagram of the content of the aroma substance β-ionone released by the petals of the overexpressed OfbHLH10 Osmanthus fragrans;

[0028] Figure 6 It is the verification diagram of the transformed AH109 bacteria;

[0029] Figure 7 It is the interaction diagram of the OfbHLH10 and OfWRKY78 proteins. Among them, A is the verification diagram of the yeast library screening bacteria; B is the result diagram of the yeast two-hybrid point-to-point experiment; C is the detection result diagram of the CO-IP experiment; D is the detection result diagram of the bimolecular fluorescence complementation experiment (BiFc);

[0030] Figure 8Diagram of the interaction between OfbHLH10 and OfWRKY78 proteins on OfCCD4; among them, A is the fluorescence detection diagram of transformed tobacco leaves; B is the comparison diagram of LUC / REN detection results in tobacco leaves transformed with Agrobacterium carrying different vectors.

[0031] Figure 9 Verification diagram of transient transformation of Osmanthus fragrans petals with OfWRKY78; among them, A is the result diagram of detecting the expression level of OfWRKY78 by fluorescence quantitative experiment; B is the result diagram of detecting the content of the aroma substance β-ionone in transiently transformed Osmanthus fragrans. Specific implementation mode

[0032] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art. For molecular biology experimental methods not specifically described, they can be referred to the methods listed in "Molecular Cloning Experiment Guide" (Third Edition) by J. Sambrook or the conventional methods in the art, or carried out according to the kit and product instructions.

[0033] The materials used in this application are the flowers of Osmanthus fragrans during the full bloom period, and the Nicotiana benthamiana seedlings used are provided by the research group of Wang Lianggui from Nanjing Forestry University.

[0034] Example 1: Acquisition and functional verification of the OfbHLH10 gene

[0035] 1. Total RNA extraction and cDNA acquisition

[0036] Use the EASYspin Plus Plant RNA kit to extract the total RNA of Osmanthus fragrans flowers. Using the extracted total RNA as a template, use the TransScript® IV One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit to reverse transcribe the extracted RNA into cDNA. Finally, the obtained cDNA is diluted 10 times with water and stored in a -20°C refrigerator.

[0037] 2. Primer design

[0038] Based on the published osmanthus genome database by the previous research group, 1 gene sequence was screened and named OfbHLH10. The BioXM software was used to analyze the nucleotide full-length sequence of the precursor sequence OfbHLH10 gene for restriction enzyme sites, and SmaⅠ and KpnⅠ enzymes were selected as the two restriction enzymes. The CE design software was used to design primers. Fill in the relevant information as required, specifically including the sequences near the restriction enzyme sites on the vector, the full length of the target gene, and fill in the 2 restriction enzyme sites (5' end and 3' end) in order, and the amplification primers can be obtained. The designed sequences were sent to Tsingke Biological Company for synthesis. The primer sequences are as follows:

[0039] pSuper1300-OfbHLH10-F:

[0040] 5’- aagcttctgcaggggcccgggATGGATCCACCATTGACAAATGA-3’,

[0041] pSuper1300-OfbHLH10-R:

[0042] 5’- gcccttgctcaccatggtaccTGTTGGACGTTCAAAGACATTTCC-3’;

[0043] 3. Double digestion of the vector

[0044] The pSuper1300 vector was taken out from the -80℃ ultra-low temperature refrigerator in advance for activation and shaking culture. The pSuper1300 vector plasmid was extracted according to the kit, and then a double digestion experiment was carried out. The system is as follows:

[0045] The 50μL double digestion reaction system is: SmaⅠ 1.5 μL, KpnⅠ 1.5 μL, Buffer 5 μL, vector plasmid XμL, ddH2O Add to 50μL.

[0046] Among them, X (µL) = 3000ng / vector plasmid concentration (ng / µL). The centrifuge tube was gently shaken to mix it evenly, centrifuged instantaneously for 6s, and placed in a water bath at 37℃ for 1h. The double-digested vector obtained was subjected to agarose gel electrophoresis, and then the gel was recovered using the kit.

[0047] 4. Amplification of the target gene

[0048] Using the cDNA diluted 10 times as a template, PCR amplification of the target gene was carried out.

[0049] The PCR reaction system is as follows: Forward Primer 1 μL, Forward Primer 1 μL, cDNA 1 μL, PrimeSTAR 10 μL, ddH2O 7 μL. Three 20-μL systems are prepared for each gene.

[0050] The PCR reaction conditions are as follows: denaturation at 98 °C for 10 s; annealing at 58 °C for 15 s, extension at 72 °C for 1 min, for 35 cycles; final extension at 72 °C for 10 min; termination of the reaction at 16 °C.

[0051] The obtained amplification products are subjected to agarose gel electrophoresis, and then cut-gel recovery is performed using a kit ( Figure 1 ).

[0052] 5. Ligation and transformation Ligation: The amplification product of the OfbHLH10 gene is recombinantly ligated with the linearized vector fragment.

[0053] The ligation reaction system is as follows: 200 ng of the recovered product of the target fragment, 100 ng of the recovered product of the plasmid double-digested, 2 μL of ligase, 4 μL of Buffer, ddH2O added to 20 μL.

[0054] The centrifuge tube is gently shaken to mix it evenly, centrifuged instantaneously for 6 s, placed in a water bath at 37 °C for 30 min, and then on ice for 2 min.

[0055] Transformation: In a laminar flow hood, 5 μL of the ligation product is taken with a pipette and added to 50 μL of Trelief TM 5α competent cells, gently flicked to mix, ice-bathed for 5 min, water-bathed at 42 °C for 60 s, then ice-bathed for 2 min, 250 μL of liquid LB (without Kana) is added, and incubated in a shaker at 37 °C and 200 rpm for 30 min.

[0056] Plating: 200 μL of the incubated bacterial solution is taken, evenly spread on an LB solid medium (containing 50 mg / L of Kana) with a sterilized glass rod and air-dried, sealed with a sealing film, and inverted and cultured in a constant temperature incubator at 37 °C for 12 - 14 h.

[0057] 6. Detection and sequencing of positive single colonies

[0058] After colonies grow on the medium, single colony detection is carried out in a laminar flow hood. Multiple plump single colonies are picked for each gene, sequentially backed up on an LB solid medium containing Kana resistance, and the corresponding single colonies are picked with a sterile toothpick and transferred to the following system for bacterial detection:

[0059] The PCR reaction system is as follows: pSuper1300-F 1 μL, Gene-R 1 μL, 2 × Taq Master 10 μL, ddH2O 8 μL.

[0060] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, for 35 cycles; total extension at 72°C for 10 min; termination of the reaction at 16°C. The obtained amplification products were subjected to agarose gel electrophoresis, and positive colonies with the correct band length were selected for sequencing ( Figure 2 ). The nucleotide sequence of the OfbHLH10 gene was as shown in SEQ ID NO.1, with a full length of 831 bp, and the amino acid sequence of its expressed protein was as shown in SEQ ID NO.2, consisting of 276 amino acids.

[0061] 7. Double digestion verification

[0062] The plasmid with the correct sequence obtained by sequencing was verified by double digestion.

[0063] The double digestion system was as follows: 1 μL of SmaⅠ, 1 μL of KpnⅠ, 2 μL of Buffer, X μL of vector plasmid, and ddH2O added to 20 μL.

[0064] Among them, X (µL) = 1000 ng / concentration of vector plasmid (ng / µL). The centrifuge tube was gently shaken to mix it evenly, centrifuged instantaneously for 6 s, and placed in a water bath at 37°C for 1 h. The obtained vector after double digestion was subjected to agarose gel electrophoresis to detect the double digestion situation ( Figure 3 ).

[0065] 8. Transformation of Agrobacterium tumefaciens GV3101

[0066] The GV3101 competent cells stored in an ultra-low temperature freezer at -80°C were taken out and melted on ice. 1 μL of plasmid was added to every 33 µL of competent cells. After pipetting and mixing evenly, it was ice-bathed for 5 min, flash-frozen in liquid ammonia for 5 min, water-bathed at 37°C for 5 min, and ice-bathed for 5 min; 500 µL of LB liquid medium without resistance was added, and it was cultured on a shaker at 28°C and 200 rpm for 1 h; after the culture was completed, the bacterial solution was centrifuged at 6000 rpm for 1 min, and part of the supernatant was discarded, leaving 100 µL to be evenly spread on the LB solid medium (containing 50 mg / L Kana), sealed with a sealing film, and inverted and cultured in an incubator at 28°C for 40 - 48 h.

[0067] Bacterial inspection and backup: If the target bands in the bacterial inspection are correct and the brightness is consistent ( Figure 4 ), then the corresponding colonies on the backup plate were picked into the LB liquid medium (containing 50 mg / L Kana) for shaking culture, and then the bacterial solution and 50% glycerol were used for bacterial preservation according to a volume ratio of 6:4, flash-frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80°C.

[0068] 9. Infection of osmanthus petals and determination of aroma substances by GC-MS

[0069] The OfbHLH10 gene was constructed on the pSuper1300 vector, namely vector 35S::OfbHLH10; the pSuper1300 empty vector and the constructed vector 35S::OfbHLH10 were transformed into competent cells of Agrobacterium tumefaciens GV3101; the recombinant Agrobacterium was transiently transformed and infected into the osmanthus petals; the transiently transformed plants grew normally for 48 h, and the transiently infected osmanthus petals were collected for GC-MS determination.

[0070] The specific steps are as follows:

[0071] (1)Shaking the bacteria: The P19 helper expression vector and the Agrobacterium liquid containing the pSuper1300 empty vector and the vector 35S::OfbHLH10 were taken out from -80 °C and melted at room temperature until in a state of ice-water mixture, and then inserted into ice to melt. According to 300 μL of the bacterial liquid added to 30 mL of LB liquid medium (containing 50 mg / L Kana), it was cultured with dark oscillation at 28 °C and 200 rpm until the OD 600 of the bacterial liquid was between 0.6 - 0.8.

[0072] (2)Preparing the mixed bacterial liquid: Weigh 0.0098 g of acetosyringone (AS) powder, dissolve it with the help of dimethyl sulfoxide (operating in a fume hood), and then add an appropriate amount of sterile water to make the volume up to 50 mL to obtain the mother liquor. Take 30 mL of the mother liquor and add 170 mL of sterile water to obtain 150 μmol / L AS; weigh 0.407 g of MgCl2 and 0.427 g of MES and add them to the prepared 150 μmol / L AS solution; centrifuge the bacterial liquid (at 4 °C, 5000 rpm, for 10 min), discard the supernatant, collect the bacterial cells, resuspend them with the buffer prepared on the same day, and finally mix them according to the optimal volume ratio (P19 helper vector: target gene = 5:7). After fully shaking and mixing, activate for 3 h and use it as the infection solution for the next step.

[0073] (3)Vacuum infiltration and infection of osmanthus: Select the flowers during the full bloom period of osmanthus, wash them with pure water, dry them, wrap them with sterile gauze, immerse them in the conical flask containing the infection solution, and then place the conical flask with the opening upward into the glass jar connected to the vacuum pump. Turn on the vacuum pump to keep the air pressure in the glass jar at -0.08 Mpa, maintain it for 10 min, then slowly open the air release hole to gradually restore the normal air pressure value (0 Mpa) in the glass jar. Subsequently, seal the air release hole tightly and perform vacuum infiltration 2 more times. After the infiltration is completed, take out the osmanthus flowers wrapped with gauze, dry the attached bacterial liquid, and then place the flowers into 5% agar medium as soon as possible and incubate them in the dark at room temperature (24 °C) for 48 h.

[0074] (4)Determination of Aroma Substances in Instantaneously Transformed Osmanthus Flower Petals: After 48 h of dark culture, pick up the Osmanthus flowers with normal state, without wilting, wrinkling or browning, using forceps, and put them into a centrifuge tube for quick freezing in liquid nitrogen. Take 0.8 g of the ground powder and place it in a sealed 20 mL extraction bottle, add 3 mL of saturated sodium chloride, and the internal standard solution (ethyl decanoate at 1 / 6000: 1 μL of ethyl decanoate standard sample added to 6 mL of methanol); in a water bath at 45 °C, after sealing, insert the extraction head of 65 μm DB / 5MS into the middle of the extraction bottle, and after 30 min of extraction, insert the extraction head into the chromatographic column TRACETR-5 MS C30m×0.25mm×0.25μm), the carrier gas is high-purity helium (He), the helium flow rate is 1 mL / min, splitless injection, the injection port temperature is 250 °C, and the desorption time is 3 min; the temperature program is: first, the temperature is 60 °C and held for 2 min, the first temperature increase program is from 60 °C to 100 °C at a rate of 5 °C / min, the second temperature increase program is from 100 °C to 250 °C at a rate of 10 °C / min, and then held for 5 min; the mass spectrometry conditions are the ion source temperature of 250 °C, the ionization mode of EI, and the electron energy of 70 eV.

[0075] (5)Analysis of Aroma Substances in Instantaneously Transformed Osmanthus Flower Petals: After removing the silicon oxide impurities in the data, calculate the relative content of various substances, import the relative content of the substances into SIMCA5.0 to calculate the substances with VIP>1, and conduct statistical analysis on the substances with different p<0.05, indicating that OfbHLH10 has an important regulatory effect on β-ionone.

[0076] The results are as Figure 5 shown, Figure 5 in A, it is proved by fluorescence quantitative experiment that OfbHLH10 has been overexpressed 10 times in Osmanthus flower petals. As Figure 5 shown in B, after the overexpression of OfbHLH10, the content of the aroma substance β-ionone in Osmanthus increased nearly 8 times.

[0077] Example 2: Obtaining the OfWRKY78 Protein Gene of Osmanthus fragrans cv. 'rixianggui'

[0078] The protein OfWRKY78 that interacts with the OfbHLH10 protein is obtained by yeast two-hybrid screening library. The main experimental contents include: constructing the bait vector pGBKT7-OfbHLH10 of the Osmanthus fragrans cv. 'rixianggui' OfbHLH10 gene; transforming the yeast strain AH109 to obtain the recombinant yeast, and the results of bacterial inspection are as Figure 6 shown; screening the yeast library with the pGBKT7-OfbHLH10 recombinant yeast; verifying the screened protein OfWRKY78 by yeast two-hybrid point-to-point, BiFc and CO-IP and other experiments. The specific contents are as follows:

[0079] 1. Yeast library screening

[0080] (1)Pick a single colony from the SD-T plate and inoculate it into 10 mL of liquid SD-T medium. Incubate at 30 °C with shaking at 200 rpm for 16 - 18 h until the culture becomes turbid.

[0081] (2)Take 2 - 3 mL from the 10 mL of bacterial solution and transfer it to 50 mL of YPDA medium to make the initial OD 600 = 0.2. Incubate at 30 °C with shaking at 200 rpm for 4 - 6 h until the OD 600 = 0.6.

[0082] (3)Centrifuge the bacteria at 3000 rpm for 5 min at room temperature, and discard the supernatant.

[0083] (4)Resuspend the cell pellet with 10 mL of sterile water, centrifuge at 3000 rpm for 5 min at room temperature, and discard the supernatant.

[0084] (5)Resuspend the cell pellet with 10 mL of 0.1 M LiAc, mix well, centrifuge to collect the bacteria, and centrifuge at 3000 rpm for 5 min at room temperature. Discard the supernatant.

[0085] (6)Resuspend the cell pellet with 500 μL of 0.1 M LiAc, mix well, and aliquot into 10 1.5 mL centrifuge tubes, 50 μL per tube.

[0086] (7)Add the following reagents to each 1.5 mL centrifuge tube in sequence. Mix well with a pipette tip or shake vigorously for 1 min until completely mixed.

[0087] 300 μL of a mixture of 50% PEG3350 and 1 M LiAc, 10 μL of Carrier DNA, 1 μg of library plasmid DNA. Carrier DNA needs to be boiled at 95 - 100 °C for 5 min before each use, immediately placed on ice for 3 min, and repeated 3 times to denature it before use.

[0088] (8)After adding, seal the tubes with parafilm and incubate in a 30 °C water bath for 45 min, gently mixing by inverting the tubes periodically.

[0089] (9)Heat shock in a 42 °C water bath for 20 min, gently mixing by inverting the tubes periodically.

[0090] (10)After shaking well, centrifuge at 4000 rpm for 5 min, discard the supernatant, and resuspend the pellet with 1 mL / tube of YPDA. Incubate with shaking at 30 °C for 90 min.

[0091] (11)Centrifuge to collect bacteria, centrifuge at 4000 rpm for 5 min, discard the supernatant, resuspend with 400 μL of 0.9% NaCl solution, mix gently as much as possible, and plate on SD - TLH.

[0092] (12)Incubate in an inverted position at 30 °C for 3 - 7 days and observe colony growth.

[0093] (13)After bacteria grow, pick the grown single colony clones, add them to 50 μL of ddH2O, pipette and mix well.

[0094] 1) Bacterial inspection: Seal the sterile water with the spotted bacteria and place it in an - 80 °C refrigerator for lysis. Take 5 μL as a template the next day for further bacterial inspection. The results are as Figure 7 shown in A.

[0095] Primers: T7: CTATTCGATGATGAAGATACCCC;

[0096] ADR: GTGAACTTGCGGGGTTTTTCAG.

[0097] 2) Plate transfer: Pipette 4 μL each and spot onto three kinds of media: SD / -THL, SD / -THLA, and SD / -THLA + x - α - gal.

[0098] (14)Send for sequencing: Select a single band with a length of more than 750 bp, and send 15 μL of the PCR stock solution of the bacteria that grow on the SD / -THLA plate for sequencing.

[0099] (14)Result comparison: Blast the fragment sequence obtained by sequencing with the osmanthus genome data.

[0100] The nucleotide sequence of the OfWRKY78 gene is as shown in SEQ ID NO.3, with a full length of 1614 bp, and the amino acid sequence of its expressed protein is as shown in SEQ ID NO.4, consisting of 537 amino acids.

[0101] 2. Yeast two - hybrid pairwise

[0102] Co - transform pGADT7 - OfWRKY78 and pGBKT7 - OfbHLH10 into AH109 competent cells. Use the co - transformation of pGADT7 and pGBKT7 - OfbHLH10 as a control group, the co - transformation of pGADT7 - T and pGBKT7 - 53 as a positive control, and pGADT7 - T and pGBKT7 - lam as a negative control. Spot them onto SD - TL, SD - THL, SD - THLA, and SD - THLA + x - α - gal plates respectively. As Figure 7B. It was found that only the positive control and the experimental group could grow on the SD-THL, SD-THLA, and SD-THLA + x-α-gal plates, and turn blue on the SD-THLA + x-α-gal plate.

[0103] 3. CO-IP

[0104] (1)Tobacco injection: Mix the bacterial suspensions of OfbHLH10-FLAG:OfWRKY78-HA:P19 = 1:1:1 and inject. Use the mixture of OfbHLH10-FLAG:GFP-HA:P19 = 1:1:1 for injection as the control group.

[0105] (2)Plant protein extraction: Take about 0.5 g of the infected leaves, grind them in liquid nitrogen, add 500 µL of PlantCell lysis buffer (with protease inhibitor added), and extract proteins at 4 °C on a rotary mixer for 1 h. After centrifugation, take 50 µL of the supernatant as Input, add 5× protein loading buffer, and denature at 100 °C for 10 min. Transfer the remaining supernatant to a new centrifuge tube and place it on ice for protein adsorption.

[0106] (3)FLAG magnetic bead pretreatment: Pipette 20 µL of magnetic beads, wash the magnetic beads 3 times with the washing buffer, and activate them.

[0107] (4)Protein adsorption: Mix the plant protein extract and the magnetic beads, and adsorb proteins at 4 °C on a rotary mixer for 2 h.

[0108] (5)Magnetic bead washing: Use a magnetic stand to adsorb the magnetic beads, and a part of the adsorbed protein extract can be retained for use. Wash the magnetic beads with the washing buffer. Add the washing buffer to the centrifuge tube, invert the centrifuge tube to resuspend the magnetic beads, place it on the magnetic stand, and discard the supernatant after the magnetic beads precipitate. Repeat this operation 3 times.

[0109] (6)Elution of the target protein: Denature and elute the target protein, add 1× protein loading buffer, denature at 80 °C for 20 min, and subject the sample to subsequent SDS-PAGE detection.

[0110] As Figure 7 C. In the Input, the fusion proteins OfbHLH10-FLAG and OfWRKY78-HA as well as GFP-HA were detected, indicating that the three proteins were all successfully expressed in tobacco. In the IP sample, the HA antibody detected the band of the OfWRKY78-HA fusion protein, indicating that OfbHLH10 interacted with OfWRKY78 in plant cells.

[0111] 4. Bimolecular Fluorescence Complementation Assay (BiFc)

[0112] Co-inject YNE-OfWRKY78 and YCE-OfbHLH10 into Nicotiana benthamiana, with the co-injection of YNE and YCE-OfbHLH10, YNE-OfWRKY78 and YCE, YNE and YCE as the control groups. As Figure 7 D, After 48 h of injection, take the tobacco leaves in the injection area and observe the GFP signal with a laser confocal microscope. It is found that only in the experimental group can the GFP signal be observed in the nucleus.

[0113] Example 3: Dual-Luciferase Assay to Investigate the Effects of OfbHLH10 and OfWRKY78 on the β-Ionone Synthase Gene OfCCD4

[0114] 1. Infect Nicotiana benthamiana

[0115] (1) Tobacco preparation: Prepare Nicotiana benthamiana with a robust growth and a seedling age of about 6 weeks, and control water in advance;

[0116] (2) Bacterial shaking:

[0117] Respectively construct the CDs of the OfbHLH10 and OfWRKY78 genes into the pGreenII 62-SK vector, and construct the promoter of the OfCCD4 gene into the pGreenII 0800-LUC vector; then transform the pGreenII 62-SK vector and the constructed vectors into GV3101 (psoup) Agrobacterium competent cells to obtain recombinant Agrobacterium pGreenII 62-SK, SK-OfbHLH10, SK-OfWRKY78, and 0800-OfCCD4;

[0118] Respectively culture the Agrobacterium of pGreenII 62-SK, SK-OfbHLH10, SK-OfWRKY78, and 0800-OfCCD4 in 50 mL of liquid LB medium containing 100 mg / L of Kana in the dark at 28 °C and 200 rpm overnight;

[0119] (3) Prepare the infection buffer: Prepare an infection buffer with a final concentration of 150 μmol·L -1 of acetosyringone (AS), 10 mmol·L -1 of MgCl2, and 10 mmol·L -1 of morpholineethanesulfonic acid (MES) (prepared and used immediately);

[0120] (4) Centrifugation and resuspension: When the OD of the bacterial solution 600When OD = 0.8, centrifuge (at 4°C, 6000 rpm, for 10 min), discard the supernatant, collect the bacterial cells, resuspend them with the freshly prepared infection buffer, and separately mix ① pGreenII 62-SK, ② SK-OfbHLH10, ③ SK-OfWRKY78, 0800-OfCCD4, according to the volume ratios of ①:②: = 4.5:4.5:1 (SK-bHLH10), ①:③: = 4.5:4.5:1 (SK-WRKY78), ②:③: = 4.5:4.5:1 (SK-bHLH10-WRKY78) and ①: = 9:1 (SK). Mix the bacterial suspensions, shake well, activate in the dark for 3 h, and then inject.

[0121] (5) Infection: Use a 1 mL syringe without a needle to draw the prepared mixed bacterial suspension and inject it from the back of the Nicotiana benthamiana leaf.

[0122] (6) Cultivation: After injection, water thoroughly, place in a growth chamber, incubate in the dark for 12 h, and then cultivate normally for 48 d.

[0123] 2. Measurement of luciferase and renilla luciferase

[0124] (1) Take 3 - 4 leaf discs with a diameter of 6 - 8 mm, place them in a 2 mL grinding tube (previously placed with 2 - 3 steel beads), freeze in liquid nitrogen, and grind using a crusher (45 Hz, for 60 s). After complete grinding, add 200 μL of lysis buffer to the grinding tube.

[0125] (2) Incubate on ice for about 5 min to fully lyse the leaves.

[0126] (3) Centrifuge at 12000 rpm for 2 min and take the supernatant for use.

[0127] (4) Take 50 μL of the supernatant from the previous step and add it to the culture plate. According to the experimental requirements, 3 - 5 replicates can be set.

[0128] (5) Prepare the firefly luciferase reaction solution and the renilla luciferase reaction solution, that is, dilute the firefly luciferase substrate (50x) and the renilla luciferase substrate (50x) to 1x working solutions with the corresponding buffers respectively. And incubate to room temperature.

[0129] (6) Add 100 μL of the firefly luciferase reaction solution, shake the plate to mix well, and detect the activity of firefly luciferase.

[0130] (7) Add 100 μL of the renilla luciferase reaction solution, shake the plate to mix well, and detect the activity of renilla luciferase.

[0131] (8) Analyze the data: Ratio = Activity of firefly luciferase / Activity of Renilla luciferase.

[0132] The experimental results of the effect of OfbHLH10 and OfWRKY78 proteins on OfCCD4 are shown in Figure 8 A and B below. When OfbHLH10 was injected alone, the LUC / REN ratio was significantly higher than that of the control group. When OfWRKY78 was injected alone, the ratio was significantly lower than that of the control group. When OfbHLH10 and OfWRKY78 were co-injected, the expression of OfCCD4 was not significantly different from that of the control. The results showed that OfbHLH10 and OfWRKY78 proteins had an antagonistic effect on the expression of OfCCD4, thus affecting the synthesis of β-ionone in osmanthus.

[0133] Example 4: Infect osmanthus petals with OfWRKY78 and perform GC-MS determination of aroma substances

[0134] Construct the OfWRKY78 gene on the pSuper1300 vector, namely vector 35S::OfWRKY78;

[0135] Transform the pSuper1300 empty vector and the constructed vector 35S::OfWRKY78 into competent cells of Agrobacterium tumefaciens GV3101 respectively;

[0136] Respectively infect the obtained recombinant Agrobacterium tumefaciens into osmanthus petals by transient transformation;

[0137] After transiently transforming osmanthus petals and growing normally for 48 h, collect the transiently infected osmanthus petals for GC-MS determination. The specific steps of GC-MS are as in Example 1.

[0138] The results are shown in Figure 9 A and B below. It was proved by fluorescence quantitative experiment that OfWRKY78 was overexpressed 5-fold in osmanthus petals. After the overexpression of OfWRKY78, the content of the aroma substance β-ionone in osmanthus decreased significantly.

Claims

1. A sweet osmanthus transcription factor OfbHLH10, whose amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding the sweet osmanthus transcription factor OfbHLH10 according to claim 1, whose nucleotide sequence is shown in SEQ ID NO.

1.

3. An expression cassette, recombinant vector, recombinant bacterium or recombinant cell containing the gene encoding the sweet osmanthus transcription factor OfbHLH10 according to claim 2.

4. A sweet osmanthus transcription factor OfWRKY78, whose amino acid sequence is shown in SEQ ID NO.

4.

5. A gene encoding the sweet osmanthus transcription factor OfWRKY78 according to claim 4, whose nucleotide sequence is shown in SEQ ID NO.

3.

6. An expression cassette, recombinant vector, recombinant bacterium or recombinant cell containing the gene encoding the sweet osmanthus transcription factor OfWRKY78 according to claim 5.

7. Use of a biological material related to the osmanthus transcription factor OfbHLH10 according to claim 1, characterized in that, The application is any one of the following 1) or 2): 1) regulating the synthesis of the floral fragrance component β-ionone, so that the content of β-ionone in the floral fragrance of plants is increased or decreased; 2) sweet osmanthus breeding; the biological material is at least one of the gene encoding the sweet osmanthus transcription factor OfbHLH10 according to claim 1, the expression cassette containing the gene encoding the sweet osmanthus transcription factor OfbHLH10 according to claim 1, the recombinant vector, the recombinant bacterium, and the recombinant cell.

8. Use of a biological material related to the osmanthus transcription factor OfWRKY78 according to claim 4, characterized in that The application is any one of the following 1) or 2): 1) regulating the synthesis of the floral fragrance component β-ionone, so that the content of β-ionone in the floral fragrance of plants is increased or decreased; 2) sweet osmanthus breeding; the biological material is at least one of the gene encoding the sweet osmanthus transcription factor OfWRKY78 according to claim 4, the expression cassette containing the gene encoding the sweet osmanthus transcription factor OfWRKY78 according to claim 4, the recombinant vector, the recombinant bacterium, and the recombinant cell.

9. A method for regulating the synthesis of the floral fragrance component β-ionone, characterized in that, Including: 1) Construct an overexpression vector of the encoding gene of the sweet osmanthus transcription factor OfbHLH10 or a silencing vector of the encoding gene of the sweet osmanthus transcription factor OfWRKY78, transform it into a plant plant or plant tissue, and cultivate and screen to obtain a transgenic plant plant or flower tissue with increased β-ionone component in the floral fragrance; Or, 2) Construct a silencing vector of the encoding gene of the sweet osmanthus transcription factor OfbHLH10 or an overexpression vector of the encoding gene of the sweet osmanthus transcription factor OfWRKY78, transform it into a plant plant or flower tissue, and cultivate and screen to obtain a transgenic plant plant or flower tissue with decreased β-ionone component in the floral fragrance.

10. The method according to claim 9, wherein The transformation specifically refers to transformation by Agrobacterium.

Images