Bifidobacterium longum NKU1-4 and application thereof in inhibition of methicillin-resistant staphylococcus aureus drug resistance
Bifidobacterium longus NKU1-4 and its cultured cell-free supernatant solved the drug resistance problem of the bacteria by inhibiting the growth and drug-resistant gene expression of methicillin-resistant Staphylococcus aureus, achieving effective inhibition and treatment of it.
Patent Information
- Application Number
- CN202410091201.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-23
- Publication Date
- 2025-07-25
AI Technical Summary
Methicillin-resistant Staphylococcus aureus is resistant to a variety of antibiotics, which makes it difficult to treat infections and have a high mortality rate. It is difficult for the prior art to effectively inhibit its growth and drug-resistant gene expression.
Bifidobacterium longus NKU1-4 and its cultured cell-free supernatant were used to inhibit the growth of methicillin-resistant Staphylococcus aureus, the expression of the drug-resistant gene mec_A and the formation of biofilm, to achieve effective inhibition of the bacteria.
Bifidobacterium longus NKU1-4 can significantly inhibit the growth of methicillin-resistant Staphylococcus aureus, reduce its drug-resistant gene expression, destroy biofilm structure, and provide an effective anti-resistant solution.
Smart Images
Figure CN120366095A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and in particular relates to Bifidobacterium longum NKU1-4 and application thereof in inhibiting the drug resistance of methicillin-resistant Staphylococcus aureus. Background Art
[0002] Methicillin-resistant Staphylococcus aureus (MRSA) is a common clinical pathogen that produces a variety of toxins, enzymes, and antigenic proteins. It possesses a high pathogenicity, causing skin and soft tissue infections, bloodstream infections, and systemic infections. MRSA, first isolated clinically in 1961, is resistant to all β-lactam antibiotics and to most antimicrobial agents, including macrolides, aminoglycosides, and fluoroquinolones. This makes infections caused by this bacterium difficult to treat and leads to a high mortality rate. Since the 1980s, hospital-acquired MRSA infections have steadily increased, making it a major cause of nosocomial infections. mecDNA is a unique DNA sequence of approximately 30-45 kb located on the bacterial chromosome. The mecA gene expresses a specific penicillin-binding protein, PBP2a, which has very low binding activity to β-2-lactam antibiotics, thereby conferring drug resistance. It is contained in SCCmec, a mobile gene family that can act as a vector for the horizontal transmission of mec genes between Staphylococci, enabling the spread of MRSA. SCCmec can also integrate many resistance genes besides mec genes, leading to multidrug resistance in MRSA. Summary of the Invention
[0003] In order to solve the above technical problems, the present invention provides a Bifidobacterium longum NKU1-4 and its application in inhibiting the drug resistance of methicillin-resistant Staphylococcus aureus.
[0004] The technical solution adopted by the present invention is: a Bifidobacterium longum, whose 16s DNA sequence has an identity with SEQ ID No. 1 greater than or equal to 90%, greater than or equal to 95%, greater than or equal to 98%, greater than or equal to 99%, or 100%.
[0005] Preferably, it is named NKU1-4, and the deposit number is GDMCC No.64046.
[0006] Preferably, the anaerobic bacteria are Gram-positive bacteria and have a long thread-like or rod-like shape.
[0007] A culture comprising a culture obtained by culturing Bifidobacterium longum.
[0008] Preferably, the culture is a fermentation broth of the strain or a cell-free supernatant of the fermentation broth;
[0009] Preferably, Bifidobacterium longum NKU1-4 is inoculated into MRS medium containing 0.5 g / L L-cysteine hydrochloride, cultured strictly anaerobically at 37° C. for 16-20 h, and then the supernatant is collected by centrifugation and filtered through a microporous membrane to obtain a cell-free supernatant.
[0010] A microbial agent includes a strain, or a strain metabolite, or a culture.
[0011] Use of Bifidobacterium longum, or culture thereof, or microbial agent in inhibiting drug resistance of methicillin-resistant Staphylococcus aureus.
[0012] Preferably, the strain, culture or microbial preparation is capable of inhibiting one or more of the growth of methicillin-resistant Staphylococcus aureus, the expression of the drug-resistant gene mec_A, the expression of genes related to anti-biofilm activity and the inhibition of biofilm formation.
[0013] Preferably, the biofilm activity-related gene is Psma and / or IcaR.
[0014] The advantages and positive effects of the present invention are: providing a new bacterial strain, Bifidobacterium longum NKU1-4, which can effectively inhibit methicillin-resistant Staphylococcus aureus. The bacterial strain or its culture can inhibit the growth of methicillin-resistant Staphylococcus aureus, and can also inhibit the expression of its drug-resistant genes and inhibit the film formation of methicillin-resistant Staphylococcus aureus. It can be effectively used to combat the drug resistance of methicillin-resistant Staphylococcus aureus and has good medicinal value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 Bifidobacterium longum NKU1-4 morphology;
[0016] Figure 2 Construction of phylogenetic tree of strain NKU1-4;
[0017] Figure 3 Figure 2 shows the antibacterial effect of Bifidobacterium longum NKU1-4 cell-free supernatant on MRSA;
[0018] Figure 4 Minimum inhibitory concentration of the cell-free supernatant of Bifidobacterium longum NKU1-4 for inhibiting MRSA growth;
[0019] Figure 5 Growth curves of MRSA under the influence of different concentrations of Bifidobacterium longum NKU1-4 cell-free supernatant;
[0020] Figure 6 The cell-free supernatant of Bifidobacterium longum NKU1-4 inhibits the expression of MRSA resistance genes and virulence genes;
[0021] Figure 7Inhibition of MRSA biofilm formation by cell-free supernatant of Bifidobacterium longum NKU1-4;
[0022] Biological material: NKU1-4, deposit number GDMCC No.64046, deposit date: November 21, 2023; deposit unit: Institute of Microbiology, Guangdong Academy of Sciences; deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou; deposit status is alive. DETAILED DESCRIPTION
[0023] The embodiments of the present invention are described below with reference to the accompanying drawings.
[0024] The present invention relates to a Bifidobacterium longum strain, designated NKU1-4, with a classification name of Bifidobacterium longum subsp. longum, a deposit number of GDMCC No. 64046, and a deposit date of November 21, 2023. The deposited unit is the Institute of Microbiology, Guangdong Academy of Sciences; the deposit address is 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou; and the deposit status is alive. Bifidobacterium longum NKU1-4 is isolated from the feces of breastfed infants and is a recognized edible fungus species.
[0025] The characteristics of the bacterial colony and bacteria are as follows: on MRS solid medium containing 0.5g / L L-cysteine hydrochloride, strictly anaerobic culture for 16-20h, the colonies are tiny white, moist, and have neat edges; Gram staining of the bacteria is positive under an optical microscope, and the strain is long, linear, or rod-shaped after primary division or subculture. Figure 1 shown.
[0026] The genome of the strain was extracted and sequenced, and its 16s DNA sequence is shown as SEQ ID No.1.
[0027] SEQ ID No.1
[0028]
[0029] Bifidobacterium longum NKU1-4 can inhibit methicillin-resistant Staphylococcus aureus. The strain itself or the cell-free supernatant after culture can inhibit the growth of methicillin-resistant Staphylococcus aureus. Analysis shows that it can also inhibit the expression of the resistance gene mec_A, thereby achieving the inhibition of methicillin-resistant Staphylococcus aureus resistance. After culture, Bifidobacterium longum NKU1-4 expresses and secretes organic acids, which are released into the culture supernatant and can inhibit methicillin-resistant Staphylococcus aureus. At the same time, Bifidobacterium longum NKU1-4 can inhibit the biofilm formation of methicillin-resistant Staphylococcus aureus and reduce the expression of genes related to biofilm activity. Therefore, Bifidobacterium longum NKU1-4 can be used to prepare preparations that inhibit methicillin-resistant Staphylococcus aureus, or to prepare preparations that resist methicillin-resistant Staphylococcus aureus resistance.
[0030] The present invention is described below with reference to the accompanying drawings. Experimental methods without specific operating steps are carried out in accordance with the corresponding product specifications. Unless otherwise specified, the instruments, reagents, and consumables used in the examples can be purchased from commercial companies.
[0031] Example 1: Activation of strains and 16S rRNA identification of Bifidobacterium longum NKU1-4
[0032] 1.1 Activation of strains and preparation of cell-free supernatant
[0033] Methicillin-resistant Staphylococcus aureus (MRSA) ATCC43300 was provided by Beina Biotechnology and inoculated into Luria-Bertani medium at 37°C and 200 rpm for 12-24 hours to activate it. Bifidobacterium longum NKU1-4 was isolated and stored in the laboratory of Nankai University School of Medicine from infant feces.
[0034] Bifidobacterium longum NKU1-4 was inoculated into MRS medium containing 0.5 g / L L-cysteine hydrochloride and cultured under strict anaerobism at 37°C for 16-20 hours. The supernatant was collected by centrifugation at 8000 r for 5 minutes and filtered through a 0.2 μm microporous filter to obtain a cell-free supernatant.
[0035] 1.2 Identification of strains
[0036] The bacterial culture medium that has been cultured to the mid-logarithmic phase was centrifuged at 8000 rpm for 5 min and washed several times with PBS to collect sufficient bacteria. Genomic DNA was extracted using a bacterial DNA extraction kit and the quality of the extracted DNA was tested for genome sequencing and bioinformatics analysis.
[0037] The raw sequences at both ends obtained by Sanger sequencing were quality controlled to remove low-quality bases. After obtaining the clean sequence, they were spliced to obtain the assembled sequence. The top 10 species with the highest similarity were obtained by blasting with the NT database, and the species with the highest similarity were selected as the bacterial identification result. The phylogenetic tree was constructed using MEGA software using the Neighbor-Joining method. Based on the analysis results, NKU1-4 was confirmed to be Bifidobacterium longum, with a similarity of 99% with Bifidobacterium longum subsp. longum, further confirmed as Bifidobacterium longum subsp. longum. The phylogenetic tree of strain NKU1-4 was constructed as shown below. Figure 2 shown.
[0038] Example 2: Antibacterial activity determination
[0039] 2.1 Oxford Cup Test
[0040] First, the methicillin-resistant Staphylococcus aureus culture liquid was cultured to an OD600 of 0.1-0.2 using LB broth medium, and 200 μL of the culture liquid was aspirated and spread on an agar plate. Then, Oxford cups were placed on the agar plate in sequence and the cell-free supernatant of Bifidobacterium longum NKU1-4 grown to the logarithmic phase was added to each Oxford cup well (the preparation method is shown in Example 1). Oxford cups were set at three locations, respectively, as experimental group 1, experimental group 2, and experimental group 3. MRSC liquid culture medium was used as a control group M. After culturing in a constant temperature incubator at 37°C for 5-8 hours, the diameter of the inhibition zone of each group was measured.
[0041] The antibacterial effect of the cell-free supernatant of Bifidobacterium longum NKU1-4 against Staphylococcus aureus is as follows Figure 3 As shown, compared with the control group, the experimental group containing the cell-free supernatant of Bifidobacterium longum NKU1-4 showed obvious inhibition zone, and the average diameter of the inhibition zone of three groups was 18.20 mm. Therefore, the cell-free supernatant of Bifidobacterium longum NKU1-4 has good antibacterial activity against methicillin-resistant Staphylococcus aureus.
[0042] 2.2 Minimum inhibitory concentration test
[0043] The minimum inhibitory concentration (MIC) of the cell-free supernatant of Bifidobacterium longum NKU1-4 against methicillin-resistant Staphylococcus aureus was determined using the broth microdilution method. First, 100 μL of LB broth was added to all wells of a 96-well plate. Then, 100 μL of the cell-free supernatant of Bifidobacterium longum NKU1-4 was added to wells A1-H1. After pipetting and mixing, 100 μL of the supernatant was diluted two-fold from wells A1-A8, and the process was repeated for wells B1-H1. 100 μL of undiluted cell-free supernatant of Bifidobacterium longum NKU1-4 was added to wells A9-H9 as a negative control. Next, a culture of methicillin-resistant Staphylococcus aureus grown to logarithmic phase was cultured in LB broth to an OD600 of 0.1-0.2. 100 μL of this culture was then added to wells A1-A8, and the process was repeated for wells B1-H1. Finally, 100 μL of bacterial solution was added to wells A10-H10 in sequence as a positive control.
[0044] The experimental results are as follows Figure 4 As shown, when the inhibitory concentration is 31.25 μL / mL, there is almost no inhibitory effect on the growth of MRSA. Therefore, the minimum inhibitory concentration of Bifidobacterium longum subspecies NKU1-4 against MRSA is 62.5 μL / mL.
[0045] 2.3 Growth curve and sterilization curve determination
[0046] Growth curve assay: First, culture MRSA overnight in fresh LB medium to an OD600 of approximately 0.2. Subsequently, add the cell-free supernatant of Bifidobacterium longum NKU1-4 to the bacterial suspension to final concentrations of 0, 1 / 8×MIC, 1 / 4×MIC, 1 / 2×MIC, 1×MIC, 2×MIC, and 4×MIC. 200 μl of each aliquot was added to a 96-well plate, and the OD600 was measured every hour.
[0047] Growth curve results Figure 5 As shown, at the supernatant concentration of MIC, the growth of MRSA was significantly inhibited within the first 6 hours. At a concentration of 2 MIC, the OD600 of the bacterial solution remained nearly stable at 0.1-0.2 over the 12-hour culture period, indicating that the cell-free supernatant of Bifidobacterium longum NKU1-4 significantly inhibited the growth of MRSA. Therefore, the growth of methicillin-resistant Staphylococcus aureus can be significantly inhibited within 12 hours in the presence of the cell-free supernatant of Bifidobacterium longum NKU1-4.
[0048] Example 3: Inhibition of the expression of methicillin-resistant Staphylococcus aureus resistance genes and biofilm formation-related genes by the cell-free supernatant of Bifidobacterium longum NKU1-4
[0049] qPCR technology was used to detect the inhibitory effect of the cell-free supernatant of Bifidobacterium longum NKU1-4 on the expression of methicillin-resistant Staphylococcus aureus resistance genes. First, the OD600 of the methicillin-resistant Staphylococcus aureus culture grown to the logarithmic phase was adjusted to 0.1-0.2 using LB broth. Then, the CFEs of the cell-free extract of Bifidobacterium longum NKU1-4 was adjusted to the MIC and incubated with methicillin-resistant Staphylococcus aureus in a 37°C constant temperature incubator for 18-24 hours. The cell without CFEs served as a control. Then, an RNA extraction kit was used to extract total RNA from the co-culture and control groups and reverse transcribed. Finally, reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used to determine the relative expression of Staphylococcus aureus resistance genes and virulence genes. The primers used for qPCR are shown in Table 1.
[0050] The experimental results are as follows Figure 6 As shown, compared with the control group without the addition of Bifidobacterium longum NKU1-4 cell-free supernatant, the expression of MRSA biofilm formation-related genes Psma and IcaR in the experimental group decreased by 62.4% and 60.7%, respectively, and the expression of the drug-resistant gene mec_A decreased by 58.7%. Therefore, the cell-free supernatant of Bifidobacterium longum NKU1-4 has a significant inhibitory effect on the expression of the methicillin-resistant gene mec_A and biofilm-related genes in Staphylococcus aureus.
[0051] Table 1
[0052] Primer name Primer sequences 16S rRNA_F CCATAAAGTTGTTCTCAGTT 16S rRNA_R CATGTCGATCTACGATTACT mecA_F TGGAACTTGTTGAGCAGAGGT mecA_R TGGAACTTGTTGAGCAGAGGT psmα_F GGAAGGCTGCCGTCATACCA psmα_R GGATTACATCCTGCACCCGAAC Ica_F TCGCACTCTTTATTGATAGTCGCTACGAG Ica_R TGCGACAAGAACTACTGCTGCGTTAAT
[0053] Example 4: Effect of Bifidobacterium longum NKU1-4 cell-free supernatant on methicillin-resistant Staphylococcus aureus biofilm formation
[0054] The inhibition and disruption of MRSA biofilms by Bifidobacterium longum NKU1-4 CFS were observed using scanning electron microscopy. First, 1 cm diameter coverslips were sterilized and placed in 24-well plates. A bacterial suspension of Bifidobacterium longum NKU1-4 (OD600 = 0.1) was added to the wells to final concentrations of 0, 1 / 4× the MIC, and 1 / 8× the MIC. Then, 2 mL of sample was added to the wells and incubated at 37°C for 48 h, with culture medium replenished during the incubation period. After incubation, the upper layer of planktonic bacteria was gently removed from the wells. The coverslips were removed with tweezers and placed in a centrifuge tube. The coverslips were then washed three times with PBS. Subsequently, 2 mL of 2.5% glutaraldehyde was added and fixed overnight at 4°C. The next day, the coverslips were washed with PBS buffer and dehydrated with 10%, 30%, 70%, 80%, 90%, 95%, and 100% ethanol-water solutions, sequentially. The dehydrated coverslips were dehydrated on an automated critical point dryer, gold-sprayed, and observed under a scanning electron microscope.
[0055] The experimental results are as follows Figure 7As shown, in the control group, MRSA extracellular material tightly enveloped the bacteria, with only small gaps on the surface. When the concentration of Bifidobacterium longum NKU1-4 CFS was 2× the MIC, the gaps on the biofilm surface increased, the connection between the bacteria and the extracellular material became loose, and the biofilm structure was disrupted. However, after treatment with CFS at 4× the MIC, the biofilm structure developed grooves, the bacteria were loosely distributed, and the loss of extracellular material and the degree of biofilm structural damage were further deepened. When the NKU1-4 supernatant concentrations were 1 / 4× the MIC, 1 / 2× the MIC, 2× the MIC, and 4× the MIC, the inhibition rates on MRSA biofilm formation were 24.5%, 39.9%, 87.9%, and 90.6%, respectively. These results indicate that high-concentration CFS treatment can disrupt the structure of mature biofilms.
[0056] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and should not be considered to limit the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.
Claims
1. A Bifidobacterium longum, characterized in that: Its 16s DNA sequence has an identity of greater than or equal to 90%, greater than or equal to 95%, greater than or equal to 98%, greater than or equal to 99%, or 100% with SEQ ID No.
1.
2. The Bifidobacterium longum according to claim 1, wherein: Named NKU1-4, the deposit number is: GDMCC No. 64046.
3. The Bifidobacterium longum according to claim 2, characterized in that: Anaerobic bacteria, Gram-positive bacteria, with a long linear or rod-shaped morphology.
4. A culture, characterized in that: It includes the culture obtained by culturing any one of the Bifidobacterium longum described in claims 1-3.
5. The culture according to claim 4, characterized in that: The culture is the fermentation broth or cell-free supernatant of the fermentation broth of the strain described in any one of claims 1-3.
6. The culture according to claim 5, characterized in that: Bifidobacterium longum NKU1-4 was inoculated into MRS medium containing 0.5 g / L of L-cysteine hydrochloride and strictly anaerobically cultured at 37 °C for 16-20 h. Then, the supernatant was collected by centrifugation and passed through a microporous filter membrane to obtain a cell-free supernatant.
7. A microbial inoculant, characterized in that: It includes any one of the strains described in claims 1-3, or strain metabolites, or the culture described in claim 4 or 5.
8. Use of the Bifidobacterium longum described in any one of claims 1-3, or the culture described in any one of claims 4-6, or the microbial agent described in claim 7 in inhibiting the drug resistance of methicillin-resistant Staphylococcus aureus.
9. The application according to claim 8, characterized in that: The strain, culture or microbial preparation can inhibit one or more of the growth of methicillin-resistant Staphylococcus aureus, the expression of the drug resistance gene mec_A, the expression of the biofilm activity-related genes Psma and IcaR, and the inhibition of biofilm formation.
10. The application according to claim 9, characterized in that: The biofilm activity-related genes are Psma and / or IcaR.