SNP (Single Nucleotide Polymorphism) molecular marker closely related to sheep weight character, primer group, kit and application

Abstract

The invention belongs to the field of biotechnology and livestock breeding, and relates to an SNP (Single Nucleotide Polymorphism) molecular marker closely related to sheep weight traits, a primer group, a kit and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.4, and Ggt exists at the 46th bp position of the sequence as shown in SEQ ID NO.4; c mutation. According to the method, the sheep population with excellent genetic resources can be rapidly established by rapidly and accurately detecting the SNP marker related to the weight character of the sheep genetic resource population of the'Auodur Lake ', so that the marker-assisted selection breeding process of the weight character of the sheep is accelerated.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and livestock breeding, and relates to an SNP molecular marker, a primer set, a kit and an application which are closely related to the body weight trait of sheep. Background Art

[0002] Animal breeding technologies mainly include conventional breeding technologies based on phenotypes and phenotypic values, and molecular breeding technologies based on DNA polymorphisms. As an important part of the molecular breeding technology system, marker-assisted selection (MAS) breeding technology selects traits according to molecular markers significantly related to genetic traits, analyzes the genetic composition of individuals at the DNA level, realizes direct selection of genotypes, improves the directivity of breeding goals, and has advantages in aspects such as early selection, non-damaging trait evaluation and selection, and improving the efficiency of backcross breeding. Searching for important functional genes, screening genetic variation sites of genes, and analyzing the correlation between genetic variation sites of genes and traits are the premise and key for the application of marker-assisted selection technology.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. Using SNP to analyze the individual genome can better explain the phenotypic differences of individuals and has important significance in animal molecular breeding. SNPs are distributed throughout the genome, most of which are located in known gene regions, and some are located in key regions that determine gene functions, such as promoter regions and exon regions.

[0004] In the production and breeding process of meat sheep, body weight reflects the meat production ability of sheep and is an important economic indicator for measuring the production performance of meat sheep. Using molecular markers for breeding can improve genetic stability, so the accuracy in the early breeding selection process can be well guaranteed. Therefore, screening major genes or molecular genetic markers related to sheep body weight has become a hot spot in modern molecular breeding. However, at present, the molecular markers related to the sheep body weight trait are relatively scarce and it is difficult to meet the sheep breeding requirements. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker closely related to the sheep body weight trait. Using this SNP molecular marker, early selection of body weight traits can be carried out, thereby accelerating the breeding speed of fine-wool sheep.

[0006] The present invention solves its technical problems by adopting the following technical solutions: In the first aspect of the present invention, there is provided an SNP molecular marker closely related to the body weight trait of sheep. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.4, and there is a G>C mutation at the 46th bp of the sequence shown in SEQ ID NO.4.

[0007] In the second aspect of the present invention, there is provided a primer set for amplifying the SNP molecular marker. The primer set is as follows: Upstream genotyping primer FAM: 5’-GAAGGTGACCAAGTTCATGCTTTTCCTTCTCCAGGGGATCTTCATG-3’; Upstream genotyping primer VIC: 5’-GAAGGTCGGAGTCAACGGATTTTTCCTTCTCCAGGGGATCTTCATC-3’; Downstream primer R: 5’- CCATACGGGCTTCCCAGGTGACTCAACAG -3’.

[0008] In the third aspect of the present invention, there is provided a kit, which includes the above-mentioned primer set.

[0009] As a preferred embodiment of the present invention, the kit further includes FLu-Arms 2×PCR Mix and template DNA.

[0010] In the fourth aspect of the present invention, there is provided the use of the above-mentioned SNP molecular marker or the above-mentioned primer set or the above-mentioned kit in identifying the body weight trait of sheep.

[0011] In the fifth aspect of the present invention, there is provided the use of the above-mentioned SNP molecular marker or the above-mentioned primer set or the above-mentioned kit in the assisted selection breeding of sheep.

[0012] In the sixth aspect of the present invention, there is provided a method for identifying the body weight trait of sheep, including the following steps: Extract the genomic DNA of the sheep to be tested; Using the genomic DNA as a template, amplify the gene fragment containing the mutation site by using the above-mentioned primer set. ERBB4 Gene fragment; Based on the analysis results of the fluorescence type and intensity of the amplification product, identify the genotype of the mutation site, and judge the body weight trait of the sheep according to the genotype.

[0013] As a preferred embodiment of the present invention, the genotype typing is GG, GC and CC genotypes, and the body weight of individuals with the genotype CC is greater than that of individuals with the genotype GG.

[0014] As a preferred embodiment of the present invention, each 10 μL reaction system consists of the following components: 5 μL of FLu-Arms 2×PCR Mix, 25 ng of template DNA, 0.5 μL of 50 μM primer mixture, and the rest is made up with ddH2O. The molar ratio of the upstream typing primer FAM, the upstream typing primer VIC to the downstream primer R is 1 - 2:1 - 2:3 - 6.

[0015] As a preferred embodiment of the present invention, the KASP reaction procedure is as follows: (1) Pre-denaturation: Denature at 95 °C for 10 min; (2) Touchdown PCR: Denature at 95 °C for 15 s, anneal at 61 - 55 °C for 60 s (-0.6 °C / cycle), for a total of 9 cycles; (3) Amplification: Denature at 95 °C for 15 s, anneal at 55 °C for 60 s, for a total of 31 cycles; (4) Plate reading: 25 s at 30 °C (read), 1 cycle.

[0016] As a preferred embodiment of the present invention, the breed of the sheep is Auduhu.

[0017] In the seventh aspect of the present invention, a method for rapidly detecting single nucleotide polymorphisms of sheep ERBB4 using KASP is provided, including the following steps: Using the genomic DNA of the individual sheep to be tested as a template, amplify the gene partial fragment containing the single nucleotide polymorphism through a primer mixture; identify the genotype of the individual at the missense mutation site according to the analysis results of the fluorescence type and intensity; the single nucleotide polymorphism of the sheep ERBB4 ERBB4 is derived from the variant site chr2: g.212198072G>C in the intron region of the sheep gene. ERBB4

[0018] As a preferred embodiment of the present invention, the primer mixture is a KASP primer composed of the upstream typing primer FAM, the upstream typing primer VIC and the downstream primer R: Upstream typing primer FAM: 5’-GAAGGTGACCAAGTTCATGCTTTTCCTTCTCCAGGGGATCTTCATG -3’; Upstream typing primer VIC: 5’-GAAGGTCGGAGTCAACGGATTTTTCCTTCTCCAGGGGATCTTCATC -3’; Downstream primer R: 5’- CCATACGGGCTTCCCAGGTGACTCAACAG -3’.

[0019] ​As a preferred embodiment of the present invention, the amplification reaction system includes the whole genome DNA of the sheep individual to be tested and a primer mixture.

[0020] As a preferred embodiment of the present invention, the amplification reaction program of KASP is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 61°C for 60 s, for a total of 9 cycles, with the annealing temperature decreasing by 0.6°C after each cycle; denaturation at 95°C for 15 s, annealing at 55°C for 60 s, for a total of 31 cycles.

[0021] As a preferred embodiment of the present invention, a qPCR instrument is used to complete the above amplification reaction procedure and then analyze the fluorescence type and intensity.

[0022] The identification of the genotype by PCR specifically includes the following steps: typing the three genotypes of GG, GC, and CC of the ERBB4 single nucleotide polymorphism site according to the intensity of different types of fluorescence matching the linker sequence carried by the KASP primers (specifically two upstream typing primers).

[0023] The beneficial effects of the present invention are embodied in: The present invention is based on sheep ERBB4 The results of the association analysis between the single nucleotide polymorphism site (chr2 position 212198072) and the sheep weight trait showed for the first time that different genotypes of this site were significantly correlated with the sheep weight trait, and there was a molecular marker for early selection to improve the sheep weight trait. The 46bp of the molecular marker sequence had a G>C mutation, and the weight of individuals with the CC genotype was greater than that of individuals with the GG genotype. The molecular markers of the present invention can be used to accurately establish a sheep population with excellent genetic resources, thereby accelerating the marker-assisted selection breeding process for the sheep weight trait.

[0024] The present invention uses the KASP method to treat sheep ERBB4 The single nucleotide polymorphism site (chr2 position 212198072) can be used for accurate genotyping and identification, which has the advantages of being simple, fast and low-cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 For Sheep ERBB4 KASP test result diagram of SNP site (chr2: g.212198072), where Allele1 / Allele1 represents GG genotype, Allele2 / Allele2 represents CC genotype, and Allele1 / Allele2 represents GC genotype.

[0026] Figure 2 For Sheep ERBB4Sequencing diagram of the amplification product of the SNP locus (chr2: g.212198072); among them: the upper sequencing peak diagram represents the genotype GG, the middle sequencing peak diagram represents the genotype GC, the lower sequencing peak diagram represents the genotype CC, and the boxed base position is the SNP locus. Detailed implementation mode

[0027] The present invention will be further described in detail below with reference to the drawings and embodiments. The embodiments are explanations of the present invention, rather than limitations on the protection scope of the present invention.

[0028] The "Aodu Lake" sheep breed involved in the present invention is recorded in "Shi Huibin, Wang Yuqin, Wu Zibo, etc. Determination of growth and development performance and blood physiological and biochemical indexes of Aodu Lake hybrid sheep [J]. Animal Husbandry and Veterinary Medicine, 2019, 51 (4): 1-6." (I) Sheep ERBB4 Identification of single nucleotide polymorphisms and analysis of their genetic variations Using the pooled samples of the genetic resource population of the ternary hybrid offspring of Australian white sheep - "Aodu Lake" sheep for Sanger sequencing, a ERBB4 single nucleotide variation site was found, specifically the G>C variation site located at chr2: g.212198072. Chr2: g.212198072 is located at ERBB4 the 106322bp position of the gene, derived from the Sheep Nov. 2015 (Oar_v4 / oviAri4) reference genome of the UCSC database. The sheep reference genome version: Ovis_aries_v4.0. On this reference genome, ERBB4 the gene belongs to chromosome No. 2, chr2: 212091751~213385983.

[0029] (II) Detection of ERBB4 single nucleotide polymorphism markers related to sheep body weight traits Using the KASP method to detect the ERBB4 single nucleotide polymorphism locus (chr2: g.212198072) in sheep, and performing an association analysis between different genotypes and sheep body weight traits, it was determined that the existence of this missense mutation site can be used as a candidate molecular marker for assisted selection in molecular breeding of sheep body weight traits. The detection results are as Figure 1 shown. The specific description is as follows:

[0030] 1. Experimental drugs and reagents 1.1 Biochemical reagents and biological reagents ① Taq DNA polymerase (purchased from Fermantas, i.e., MBI); ② Proteinase K (purchased from Huamei Biological Engineering Company); ③ Marker I (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0031] 1.2 Common reagents Common reagents were purchased from Huamei Biological Engineering Company and were imported and repackaged products: citric acid, sodium citrate, glucose, Tris, EDTA, NaCl, NaOH, KCl, Na2HPO4, KH2PO4, Tris-saturated phenol, chloroform, isoamyl alcohol, absolute ethanol, sodium acetate, sodium dodecyl sulfate (SDS), ethidium bromide (EB), bromophenol blue, dimethylbenzene cyanine FF, acetic acid, sucrose, boric acid, agarose, etc.

[0032] 1.3 Solutions and buffers All solutions and buffers were prepared with deionized ultrapure water. The autoclaving conditions were 15 bf / in (1.034×10 5 Pa), 25 min. The preparation methods all referred to "Molecular Cloning: A Laboratory Manual" edited by Sambrook et al.

[0033] 1) Solutions for extracting blood sample DNA ① PBS buffer: Weigh: NaCl (8 g), KCl (0.2 g), Na2HPO4 (1.44 g), KH2PO4 (0.24 g), add ultrapure water to make up to 1000 mL. Adjust the pH to 7.4 and autoclave.

[0034] ② DNA extraction solution (500 mL): 10 mmol / L Tris (pH 8.0) / MW 121.14 0.6057 g, 0.1 mol / L EDTA / MW 372.24 18.612 g, and 0.5% SDS / MW 288.38 2.5 g, make up to 500 mL. Adjust the pH to 8.0 and autoclave.

[0035] ③ Common solution for genomic DNA extraction 2) Solutions for agarose gel electrophoresis analysis ① 0.5×TBE buffer: Take 10×TBE 50 mL and make up to 1000 mL.

[0036] ② Loading buffer: 0.25% bromophenol blue and 0.25% dimethylbenzene cyanine FF, with the solvent being 40.0% (w / v) sucrose aqueous solution.

[0037] 2. Design KASP primers for missense mutation sites Retrieve sheep on UCSC ERBB4The sequence of the gene was obtained, and PCR primer pairs capable of amplifying the SNP locus (chr2: g.212198072) in the upstream region of the start codon of the single nucleotide polymorphism were designed using Primer 6.0. The specific primer sequences are as follows: Upstream genotyping primer FAM: 5’-GAAGGTGACCAAGTTCATGCTTTTCCTTCTCCAGGGGATCTTCATG-3’, SEQ ID NO.1; Upstream genotyping primer VIC: 5’-GAAGGTCGGAGTCAACGGATTTTTCCTTCTCCAGGGGATCTTCATC-3’, SEQ ID NO.2; Downstream primer R: 5’- CCATACGGGCTTCCCAGGTGACTCAACAG -3’, SEQ ID NO.3.

[0038] 3. Obtain sheep sample DNA and phenotypic values of body weight traits 3.1 Collection of body weight trait data and blood samples The animals used in the experiment were the genetic resource population of the three-way cross offspring of Australian white sheep - the "Aodu Lake" sheep genetic resource population (a cross population of Australian white sheep, Dorper sheep, and Hu sheep). 310 blood samples were collected from the genetic resource population of the three-way cross of Australian white sheep - the "Aodu Lake" sheep. Sampling was carried out between July 2024 and August 2024 (sampling location: Inner Mongolia Aqun Animal Husbandry Co., Ltd., Hulunbuir, Inner Mongolia). The morphological phenotypes of the samples were measured in the same group using a unified standard, including body weight; the jugular vein blood of sheep was collected using a disposable vacuum blood collection tube containing EDTA-2K anticoagulant. After collection, it was immediately mixed evenly and stored frozen in a -4°C refrigerator. After the samples were transported back to the laboratory, they were placed in a -20°C refrigerator for storage and standby.

[0039] 3.2 Extraction of genomic DNA from blood samples 1) Thaw the frozen blood samples in a room temperature water bath environment.

[0040] 2) Transfer the thawed blood samples to a 2 mL sterile centrifuge tube.

[0041] 3) Centrifuge at 12000 rpm for 10 min at 4°C.

[0042] 4) Remove the supernatant, retain the precipitate, add 1.5 mL of PBS buffer, vortex to suspend the precipitate, and gently shake on ice for 15 min.

[0043] 5) Centrifuge at 12000 rpm for 10 min at 4°C.

[0044] 6) Repeat steps 4 and 5 once.

[0045] 7) Mash the precipitate until it becomes flocculent.

[0046] 8) Add 500 μL of DNA extraction solution and 8 μL of proteinase K to the centrifuge tube.

[0047] 9) Incubate in a water bath at 65 °C for about 16 h until the cell precipitate is completely digested and the solution becomes clear.

[0048] 10) Add 1 mL of Tris-saturated phenol and gently shake on ice for 20 min.

[0049] 11) Centrifuge at 12000 rpm for 10 min at 4 °C.

[0050] 12) Transfer the upper aqueous phase to another 2.0 mL centrifuge tube using a pipette.

[0051] 13) Add 0.5 mL of saturated phenol and 0.5 mL of chloroform and gently shake on ice for 20 min.

[0052] 14) Centrifuge at 12000 rpm for 10 min at 4 °C.

[0053] 15) Transfer the upper aqueous phase to another 2.0 mL centrifuge tube using a pipette.

[0054] 16) Add 1 mL of chloroform and gently shake on ice for 20 min.

[0055] 17) Centrifuge at 12000 rpm for 10 min at 4 °C.

[0056] 18) Transfer the upper aqueous phase to another 1.5 mL centrifuge tube using a pipette.

[0057] 19) Add 1 mL of pre-cooled (-20 °C) absolute ethanol, gently shake several times until DNA precipitates, and let it stand at -20 °C for 3 min.

[0058] 20) Centrifuge at 12000 rpm for 10 min at 4 °C. Remove the ethanol

[0059] 21) Add 1 mL of 70% ethanol and gently shake on ice for 10 min.

[0060] 22) Centrifuge at 12000 rpm for 10 min at 4 °C. Remove the ethanol and repeat the rinsing once

[0061] 23) Invert at room temperature for 30 min and place in an oven at 60 °C for 30 s.

[0062] 24) Add 50 μL ultrapure water and store at 4°C until the DNA is completely dissolved and ready for detection.

[0063] 3.3 Spectrophotometric detection of DNA Use a UV photometer to measure the OD value of the DNA sample at 260 nm and 280 nm. Calculate the OD 260 / OD 280 The ratio of OD 260 / OD 280 If the ratio is less than 1.6, it means that the DNA sample contains more protein or phenol, and it should be purified; if the ratio is greater than 1.8, RNA purification should be considered.

[0064] DNA concentration (ng / μL) = 50 × OD 260 Value × dilution factor After the DNA test is qualified, a certain amount of DNA solution is taken out, diluted to 50 ng / μL template DNA, and stored at -20℃ for use, and the rest is stored at -80℃.

[0065] 4. Detection of SNP sites using the KASP method 4.1 KASP reaction system First, add 10 μL of paraffin oil to each 96-well plate, and then add the KASP reaction system (10 μL): FLu-Arms 2×PCR Mix 5 μL; 25 ng of genomic DNA (template DNA) of the sample to be tested; 0.5 μL of 50 μM primer mixture (molar ratio of upstream typing primer FAM: upstream typing primer VIC: downstream primer R = 1:1:3); the rest is filled with ddH2O. It should be noted that the molar ratio of upstream typing primer FAM: upstream typing primer VIC: downstream primer R can vary from 1 to 2:1 to 2:3 to 6, and those skilled in the art can make specific choices according to implementation requirements.

[0066] 4.2 KASP reaction procedure The reaction procedure is: (1) Pre-denaturation: 95 °C for 10 min; (2) Touchdown PCR: denaturation at 95 °C for 15 s, annealing at 61-55 °C for 60 s (-0.6 °C / cycle), for a total of 9 cycles; (3) Amplification: denaturation at 95 °C for 15 s, annealing at 55 °C for 60 s, for a total of 31 cycles; (4) Reading: 30°C 25 s (read), 1 cycle.

[0067] 5. Identification of sheep ERBB4 Single nucleotide polymorphism site KASP typing KASP genotyping was performed according to the intensities of different types of fluorescence. In the KASP genotyping results, the three genotypes GG, GC, and CC of the single nucleotide polymorphism site chr2: g.212198072 G>C of sheep ERBB4 were clearly and distinctly divided into three clusters. Among them, Allele1 / Allele1 represents the CC genotype, Allele2 / Allele2 represents the GG genotype, and Allele1 / Allele2 represents the GC genotype.

[0068] 6. Sheep ERBB4 Frequency statistical analysis of single nucleotide polymorphism sites Genotype frequency refers to the ratio of the number of individuals with a certain genotype of a trait in a population to the total number of individuals: P YY = N YY / N In the formula, P YY represents the YY genotype frequency of a certain locus; N YY represents the number of individuals with the YY genotype in the population; N is the total number of the tested population.

[0069] The calculation formula for allele frequency is: P Y = (2N YY + N Ya1 + N Ya2 + N Ya3 + N Ya4 + …… + N Yan ) / 2N In the formula, P Y represents the allele Y frequency, N YY represents the number of individuals with the YY genotype in the population, N Yai represents the number of individuals with the Yai genotype in the population (ai = a1, a2 …… an), and a1~an are n different multiple alleles of allele Y.

[0070] In the genetic resource population of the Australian White Sheep three-way crossbred offspring - "Aodu Lake" sheep, the gene frequency statistical results of the chr2: g.212198072G>C variation site are shown in Table 1.

[0071] Table 1. Genetic resource population of "Aodu Lake" sheep ERBB4 Gene frequency distribution of genetic variation sites As can be seen from Table 1, the frequencies of the three genotypes GG, GC, and CC are 0.171, 0.474, and 0.355, respectively. After Hardy-Weinberg disequilibrium analysis, the chr2: g.212198072 G>C variant site is in Hardy-Weinberg equilibrium in the Australian White sheep three-way crossbred offspring population ( P >0.05), and it is an SNP site.

[0072] The nucleotide sequence of the SNP molecular marker containing this variant site is GAAGGTGACCAAGTTCATGCTTTTCCTTCTCCAGGGGATCTTCAT S , SEQ ID NO.4, where S is the base G or C.

[0073] 7. Sheep ERBB4 Association analysis of gene effects at the locus Genotype data: GG, GC, and CC genotypes of the chr2: g.212198072 G>C variant site.

[0074] Body weight trait data: The individual body weights of the Australian White three-way crossbred offspring - the "Aodu Lake" sheep genetic resource population.

[0075] Association analysis model: Use SPSS (25.0) software to analyze the correlation between the SNP site and body weight traits. First, perform descriptive statistical analysis on the obtained data to determine whether there are outliers. Then, according to the characteristics of the data, use analysis of variance to analyze the effects of genotypes. During the data processing, considering the individual effects, gene interactions, and genotype effects, a fixed model is used for correlation analysis. In addition, make selections according to the actual conditions. Complete model: Y ijlm = μ+S i +HYS j +G l +e ijlm ; where, Y ijlm : Individual phenotypic record; μ: Overall mean; S i : Year effect; HYS j : Sheep population mean; G l : Fixed effect of genotype; e ijlm : Random error. Use one-way ANOVA in SPSS software for analysis. The analysis results are shown in Table 2.

[0076] Table 2. Correlation analysis between the SNP site (chr2: g.212198072) and the body weight of the "Aodu Lake" sheep genetic resource population Note: The same letter on the mean shoulder mark between different genotypes indicates no significant difference, and the letters a and b on the mean shoulder mark indicate significant difference.

[0077] As can be seen from Table 2, the genetic resource population of "Aoduhu" sheep ERBB4 Different genotypes of the single nucleotide polymorphism (chr2: g.212198072) have a significant effect on body weight ( P <0.05), and individuals with the CC genotype are significantly superior to those with the GG genotype in these body weight traits, with statistical differences. Therefore, the genetic resource population of "Aoduhu" sheep ERBB4 The CC genotype at the single nucleotide polymorphism (chr2: g.212198072) locus can be used as a candidate SNP marker for improving the body weight traits of sheep.

[0078] In summary, the present invention discovers the sheep ERBB4 SNP that can significantly affect the body weight traits of sheep, as well as a molecular marker for early selection to improve the body weight traits of sheep, which can be used to quickly establish a superior sheep population with genetic resources, thereby accelerating the marker-assisted selection breeding process for the body weight traits of the genetic resource population of "Aoduhu" sheep. It is beneficial to improve the production performance of sheep and enhance the benefits of related industries.

Claims

1. A SNP molecular marker closely related to the body weight trait of sheep, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.4, and there is a G>C mutation at the 46th bp of the sequence shown in SEQ ID NO.

4.

2. A primer set for amplifying the SNP molecular marker, characterized in that, The primer set is as follows: Upstream genotyping primer FAM: 5’-GAAGGTGACCAAGTTCATGCTTTTCCTTCTCCAGGGGATCTTCATG-3’; Upstream genotyping primer VIC: 5’-GAAGGTCGGAGTCAACGGATTTTTCCTTCTCCAGGGGATCTTCATC-3’; Downstream primer R: 5’- CCATACGGGCTTCCCAGGTGACTCAACAG -3’.

3. A kit, characterized in that, It includes the primer set described in claim 2.

4. The kit according to claim 3, wherein The kit further includes FLu-Arms 2×PCR Mix and template DNA.

5. Use of the SNP molecular marker described in claim 1, or the primer set described in claim 2, or the kit described in claim 3 in identifying the body weight trait of sheep.

6. Use of the SNP molecular marker described in claim 1, or the primer set described in claim 2, or the kit described in claim 3 in the assisted selection breeding of sheep.

7. A method for identifying sheep body weight traits, characterized in that, It includes the following steps: Extract the genomic DNA of the sheep to be tested; Using the whole genome DNA as a template, amplify the gene fragment containing the mutation site by using the primer set according to claim 2 ERBB4 ; Based on the analysis results of the fluorescence type and intensity of the amplification product, genotype the mutation site, and judge the body weight trait of the sheep according to the genotype.

8. The method for identifying sheep body weight traits according to claim 7, characterized in that, The genotype typing is GG, GC, and CC genotypes, and the body weight of individuals with the CC genotype is greater than that of individuals with the GG genotype.

9. The method for identifying the body weight trait of a sheep according to claim 7, characterized in that, Each 10 μL amplification reaction system consists of the following components: 5 μL of FLu-Arms 2×PCR Mix, 25 ng of template DNA, 0.5 μL of 50 μM primer mixture, and the rest is made up with ddH2O. The molar ratio of the upstream genotyping primer FAM, the upstream genotyping primer VIC to the downstream primer R is 1-2:1-2:3-6.

10. The method for identifying sheep body weight traits according to claim 7, characterized in that, The breed of the sheep is Aodu Lake.

Images