Fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection primer probe set, kit and detection method

Abstract

The invention relates to a gene detection technology, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of gray mold of Chinese chives, which comprises a primer HMB-F, a primer HMB-R and a probe P, wherein the sequence of the primer HMB-F is 5 'AAACTCGACCGCACAGATATT3', the sequence of the primer HMB-F is 5 'AAACTCGACCGCACATT3'; the sequence of the primer HMB-R is 5 'ACCTTGTTAGCTGGCATGAG 3', and the sequence of the probe P is 5 'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ 3'. The invention further provides a fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection and detection method, and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection kit and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection method have the advantages that existence and quantity of pathogens can be detected in the early stage of leek gray mold pathogens, and early intervention and early warning of gray mold are facilitated.

Description

Technical Field

[0001] The present invention relates to gene detection technology, and in particular to a primer-probe set, a kit and a detection method for detecting pathogenic microorganisms of Chinese chive gray mold based on fluorescence quantitative PCR. Background Art

[0002] Chinese chive (Allium tuberosum Rottl. ex Spreng.) belongs to the Liliaceae perennial herb, with a special strong smell; its rhizome lies horizontally, the bulb is narrowly conical and clustered; the scale-like outer skin is yellowish-brown and reticulate fibrous; the leaves are basal, linear and flat; the umbel inflorescence is terminal. Chinese chive is a vegetable with relatively high yield. The annual yield of Chinese chive in China is about 20 million tons, with huge output value.

[0003] However, Chinese chive is easily infected by fungi, leading to Chinese chive gray mold. Chinese chive gray mold, also known as white spot leaf blight, commonly known as white spot disease, is a disease caused by the infection of Botrytis squamosa Walker. Chinese chive gray mold mainly harms the leaves and is the main disease in the cultivation of Chinese chive in solar greenhouses. Once the disease occurs, it often causes the leaves of Chinese chive to wither, rot wetly and mildew, and when severe, the yield reduction can reach more than 30%.

[0004] At present, the detection of Chinese chive gray mold on the market mainly relies on visual observation. Although experienced growers can easily observe the occurrence of gray mold by visual observation, there is no good way for the qualitative analysis at the molecular level of the pathogen and the early intervention and early warning of gray mold in the plant protection process. It is often necessary to wait until a large number of Botrytis squamosa gather and cause the outbreak of gray mold before it can be observed. This will not only lead to a significant reduction in the yield of Chinese chive, but also affect the quality of Chinese chive. When the gray mold is severe, only relatively drastic plant protection measures such as pesticides can be adopted, resulting in excessive pesticide residues in Chinese chive and greatly reducing the quality. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer-probe set, a kit and a detection method for detecting pathogenic microorganisms of Chinese chive gray mold based on fluorescence quantitative PCR (qPCR), which can detect the presence and quantity of the pathogen at the early stage of Chinese chive gray mold (before the outbreak of gray mold), facilitating the early intervention and early warning of gray mold.

[0006] The present invention adopts the following technical solutions to solve the above technical problems:

[0007] A primer-probe set for detecting pathogenic microorganisms of Chinese chive gray mold based on fluorescence quantitative PCR (qPCR) includes primer HMB-F, primer HMB-R and probe P;

[0008] Among them, the sequence of primer HMB-F is: 5’AAACTCGACCGCAGACATATT 3’; the sequence of primer HMB-R is: 5’ACCTTGTTAGCTGGCATGAG 3’; the sequence of probe P is: 5’FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ3’.

[0009] As one of the preferred embodiments of the present invention, the primer HMB-F and the primer HMB-R are used to amplify the specific gene sequence of Botrytis squamosa Walker, the main pathogen of gray mold of Chinese chives; the specific gene sequence of Botrytis squamosa Walker is shown in SEQ ID NO.1.

[0010] A kit for detecting pathogenic microorganisms of gray mold of Chinese chives based on fluorescence quantitative PCR includes the above primer-probe group.

[0011] As one of the preferred embodiments of the present invention, it further includes a fluorescence quantitative reaction solution.

[0012] As one of the preferred embodiments of the present invention, the fluorescence quantitative reaction solution includes DNA polymerase, dNTPs, Mg 2+ , buffer solution, ROX.

[0013] As one of the preferred embodiments of the present invention, it further includes a plasmid standard.

[0014] As one of the preferred embodiments of the present invention, the plasmid standard is constructed by inserting Feature 11 containing the target gene into the PUC57 plasmid as a vector through genetic engineering methods; the nucleotide sequence of Feature 11 containing the target gene is shown in SEQ ID NO.2.

[0015] A method for detecting pathogenic microorganisms of gray mold of Chinese chives based on fluorescence quantitative PCR, using the above primer-probe group or kit, includes the following steps:

[0016] (1) Take the leaves of the Chinese chive plants to be identified, grind them and then extract DNA.

[0017] (2) Using the extracted DNA as a template, perform fluorescence quantitative PCR with the primer HMB-F, the primer HMB-R and the fluorescence probe.

[0018] (3) Observe and analyze the Ct value of Botrytis cinerea detected during the fluorescence quantitative PCR process; when the Ct value < 37.20, it indicates that the Chinese chives are infected with gray mold.

[0019] As one of the preferred embodiments of the present invention, in the step (2), the reaction system for fluorescence quantitative PCR is as follows: 1 μL of HotStart Taq DNA polymerase (final concentration 0.8 U / reaction), 1 μL of dNTPs (final concentration 300 μM each), 0.5 μL of MgCl2 / MgSO4 (final concentration 3 mM), 2.5 μL of buffer with pH 8.0, 0.5 μL of ROX, 1 μL of primer HMB-F (final concentration 400 nM), 1 μL of primer HMB-R (final concentration 400 nM), 0.5 μL of probe P (final concentration 200 nM), 1 μL of template, and 16 μL of H2O.

[0020] As one of the preferred embodiments of the present invention, in the step (2), the reaction program for fluorescence quantitative PCR is as follows: incubate at 50 °C for 2 min; pre-denature at 95 °C for 5 min; denature at 95 °C for 15 s, anneal / extend at 60 °C for 30 s, for 40 cycles.

[0021] As one of the preferred embodiments of the present invention, in the step (3), the specific correspondence between the Ct value detected for Botrytis cinerea and Botrytis cinerea infection is as follows:

[0022] When 34.55 ≤ Ct value < 37.20, it indicates that the Chinese chives have a "slight" Botrytis cinerea infection;

[0023] When 29.39 ≤ Ct value < 34.55, it indicates that the Chinese chives have a "moderate" Botrytis cinerea infection;

[0024] When the Ct value < 29.39, it indicates that the Chinese chives have a "severe" Botrytis cinerea infection.

[0025] The present invention is based on the probe-based qPCR, and the principle is as follows: while the upstream and downstream primers (primer HMB-F, primer HMB-R) guide the amplification of the target DNA, the fluorescence-labeled probe (probe P) binds to the middle region of the target sequence through strict complementarity. The two ends of the probe are respectively labeled with a fluorescence reporter group (FAM) and a quenching group (BHQ); in the PCR extension stage, the 5'→3' exonuclease activity of DNA polymerase hydrolyzes the probe, separating the reporter group from the quenching group and releasing a fluorescence signal. By real-time monitoring the change in fluorescence intensity of each round of amplification and combining with the Ct value (cycle threshold), accurate quantification of the target nucleic acid is achieved. Among them, the higher the content (copy number) of the target sequence in the test sample, the smaller the Ct value corresponding to reaching the threshold; conversely, the lower the copy number of the target sequence in the test sample, the larger the Ct value corresponding to reaching the threshold.

[0026] The advantages of the present invention compared with the prior art are as follows:

[0027] (1) Based on the probe-based qPCR, the primer-probe set designed by the present invention is used to amplify the sample to be tested, enabling the detection of low-copy molecules, thus greatly advancing the detection of Botrytis cinerea in Chinese chives (detecting the presence and quantity of the pathogen at the early stage of the pathogen of Chinese chive gray mold), facilitating the early intervention and warning of gray mold;

[0028] (2) This method can simply and directly identify and quantify the pathogenic microorganisms of Botrytis cinerea in Chinese chives, and has the advantages of high sensitivity and strong specificity. The detection results (Ct values) can correspond to the infection degree of Chinese chive gray mold, which has important guiding significance for the prevention and control of Chinese chive gray mold. Description of the Drawings

[0029] Figure 1 It is a schematic structural diagram of the plasmid standard in Example 2;

[0030] Figure 2 It is a physical picture of the leaves and roots of the "severely" infected plants in Experimental Example 1;

[0031] Figure 3 It is a physical picture of the leaves and roots of the "moderately" infected plants in Experimental Example 1;

[0032] Figure 4 It is a physical picture of the leaves and roots of the "slightly" infected plants in Experimental Example 1;

[0033] Figure 5 It is a comparison chart of the amplification curves of the leaf group of the "severely" infected plants, the root group of the "severely" infected plants, the leaf group of the "moderately" infected plants, the root group of the "moderately" infected plants, the leaf group of the "slightly" infected plants, the root group of the "slightly" infected plants, the negative control group, and the positive control group in Experimental Example 1;

[0034] Figure 6 It is a comparison chart of the amplification curves of the nutrient solution group at the water outlet, the nutrient solution group at the water return port, the negative control group, and the positive control group in Experimental Example 1 (in the figure, CSK, HSK, NTC, and PTC respectively represent the nutrient solution group at the water outlet, the nutrient solution group at the water return port, the negative control group, and the positive control group);

[0035] Figure 7 It is the Ct value results corresponding to each group in Experimental Example 1. Detailed Embodiments

[0036] The following is a detailed description of the embodiments of the present invention. These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments. At the same time, the carriers, reagents, and instruments used in the following embodiments and experimental examples, unless otherwise specified, are all conventional carriers, reagents, and instruments in the art; the experimental methods used, unless otherwise specified, are all conventional methods in the art and will not be elaborated further.

[0037] Example 1

[0038] A primer-probe set for detecting pathogenic microorganisms of Botrytis squamosa in Chinese chives based on fluorescence quantitative PCR in this example includes primer HMB-F, primer HMB-R, and probe P.

[0039] Among them, the sequence of primer HMB-F is: 5’AAACTCGACCGCAGACATATT 3’; the sequence of primer HMB-R is: 5’ACCTTGTTAGCTGGCATGAG 3’; the sequence of probe P is: 5’FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ3’.

[0040] The primer HMB-F and primer HMB-R are used to amplify the specific gene sequence (SEQ ID NO.1) of Botrytis squamosa Walker, the main pathogen of Botrytis squamosa in Chinese chives.

[0041] Example 2

[0042] A kit for detecting pathogenic microorganisms of Botrytis squamosa in Chinese chives based on fluorescence quantitative PCR in this example includes: primer HMB-F, primer HMB-R, probe P, Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, PCR buffer (pH 8.0), ROX (dye), and plasmid standard.

[0043] Among them, primer HMB-F, primer HMB-R, and probe P are as shown in Example 1. Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, buffer, and ROX are commercially available products. The plasmid standard is a self-made product, and its structure is as Figure 1 shown. It is constructed by using the PUC57 plasmid as a vector and inserting Feature 11 containing the target gene (the sequence is as shown in SEQ ID NO.2) into it through genetic engineering methods.

[0044] The specific construction method of the plasmid standard is as follows:

[0045] Twenty-eight primers were designed according to the plasmid target nucleic acid sequence (see Table 1). Through the mutual pairing of primers in the first-step PCR process, a PCR product containing the plasmid target nucleic acid sequence was obtained, and using this as a template, the full-length target nucleic acid sequence (SEQ ID NO.2) was amplified by the second-step PCR. After 1% agarose gel electrophoresis, the PCR product was recovered by cutting the gel, and then the PCR product was recombinantly ligated with the PUC57 plasmid (a commercially available vector) treated with ECORI-HINDIII using a recombinase to construct a recombinant plasmid. After screening for the recombinant plasmid by colony selection, the sequence of the inserted fragment was verified by first-generation sequencing, and the plasmid standard product that passed the sequence verification was the target required. This construction process can be entrusted to a biological company.

[0046] Table 1. Primers used for the construction of plasmid standard products

[0047]

[0048]

[0049]

[0050] Among them, the reaction system for the first-step PCR was as follows:

[0051] 0.5 μL each of Primers 1-28 (Table 1) (50 pmol / μL), 0.5 μL of polymerase (pv2), 10 μL of 5X PV2 buffer, 1 μL of 10 mM dNTP, and ddH2O was added to 50 μL.

[0052] The reaction conditions were: 95°C for 3 min; 95°C for 25 s, 62°C for 20 s, 72°C for 40 s, for 25 cycles; 72°C for 1 min; hold at 4°C.

[0053] The reaction system for the second-step PCR was: 0.3 μL of template (PCR first-round product) (100 ng / μL), 0.5 μL of Primer NJ0204996-1_1 (50 pmol / μL), 0.5 μL of Primer NJ0204996-1_28 (50 pmol / μL), 0.5 μL of polymerase pv2, 10 μL of 5X PV2 buffer, 1 μL of 10 mM dNTP, and ddH2O was added to 50 μL.

[0054] The reaction conditions were: 95°C for 3 min; 95°C for 25 s, 62°C for 20 s, 72°C for 40 s, for 25 cycles; 72°C for 1 min; hold at 4°C.

[0055] Example 3

[0056] A method for detecting pathogenic microorganisms of Botrytis squamosa on Chinese chives based on fluorescence quantitative PCR in this embodiment uses the kit for detecting pathogenic microorganisms of Botrytis squamosa in Example 2, and includes the following steps:

[0057] (1) Take the leaves of the Chinese chive plants to be identified. After grinding with liquid nitrogen, extract their DNA using a DNA extraction kit (Yeasen Bacterial / Fungal DNA Kit, magnetic bead method for bacterial / fungal DNA extraction).

[0058] (2) Construct the reaction system shown in Table 2, and perform fluorescence quantitative PCR amplification reaction using the extracted DNA as a template. The qPCR reaction program is shown in Table 3.

[0059] Table 2. qPCR reaction system

[0060]

[0061]

[0062] Table 3. qPCR reaction program

[0063]

[0064] (3) Observe and analyze the Ct value of Botrytis cinerea detected during the fluorescence quantitative PCR process:

[0065] When 34.55 ≤ Ct value < 37.20, it indicates that the Chinese chives have a "mild" Botrytis squamosa infection;

[0066] When 29.39 ≤ Ct value < 34.55, it indicates that the Chinese chives have a "moderate" Botrytis squamosa infection;

[0067] When the Ct value < 29.39, it indicates that the Chinese chives have a "severe" Botrytis squamosa infection.

[0068] Example 4

[0069] A method for detecting pathogenic microorganisms of Botrytis squamosa on Chinese chives based on fluorescence quantitative PCR in this embodiment is basically the same as that in Example 3, and the main difference is that: "MgCl2" in the qPCR reaction system is replaced by "MgSO4".

[0070] Experimental Example 1

[0071] This experimental example is used to explore the transmission route and infection cycle of Botrytis cinerea in the hydroponic Chinese chive greenhouse, and at the same time verify the feasibility of the method of the present invention.

[0072] I. Experimental method

[0073] First, select samples from the leek greenhouse. According to the severity of the Botrytis cinerea lesions on the leek leaf surface, the samples are divided into three categories: "mild" infection, "moderate" infection, and "severe" infection. The classification criteria are as follows: Generally, a leek has 5 leaves. When sporadic gray mold spots begin to appear on the leaves, it is a "mild" infection; when the spots gather on 2 - 3 leaves or the leaf tips dry on 1 - 2 leaves, it is a "moderate" infection; when the spots gather in large numbers on 4 - 5 leaves, the leaf tips dry on more than 3 leaves, or there is wet rot on the leaves, it is a "severe" infection. For each category, take the whole plant sample (including leaves and roots) and group them according to Table 4.

[0074] Table 4. Sample grouping

[0075]

[0076] Subsequently, grind the leaves and roots of each group, and use a DNA extraction kit (Yeasen Biotech Bacterial / Fungal DNA Kit magnetic bead method bacterial / fungal DNA extraction kit) to extract the nucleic acids of the symbiotic microorganisms in them respectively. At the same time, take samples of each nutrient solution and extract its nucleic acids (the DNA extraction kit is the same as above).

[0077] Finally, using the extracted DNA as a template, perform a fluorescence quantitative PCR amplification reaction with the kit of the present invention (using a fluorescence quantitative PCR instrument) to detect the content of Botrytis cinerea in the leaves, roots, and nutrient solutions respectively (the reaction system and reaction program are specifically referred to Example 3).

[0078] II. Test results

[0079] Figure 5 It is a comparison chart of the amplification curves for the leaf group of "severe" infection plants, the root group of "severe" infection plants, the leaf group of "moderate" infection plants, the root group of "moderate" infection plants, the leaf group of "mild" infection plants, the root group of "mild" infection plants, the negative control group, and the positive control group;

[0080] Figure 6 It is a comparison chart of the amplification curves for the outlet nutrient solution group, the return port nutrient solution group, the negative control group, and the positive control group (in the figure, CSK, HSK, NTC, and PTC respectively represent the outlet nutrient solution group, the return port nutrient solution group, the negative control group, and the positive control group);

[0081] Figure 7 It is the Ct value result corresponding to each group.

[0082] III. Result statistical analysis

[0083] Perform statistical analysis on the results, as shown in Table 5.

[0084] Table 5. Result analysis and statistics

[0085]

[0086]

[0087] It can be seen from the above results that:

[0088] (1) When the Ct value of Botrytis cinerea detected in the leek leaves is less than 37.20, the leek is infected with Botrytis cinerea, and obvious infection characteristics of Botrytis cinerea appear on the leaves. For the same leek, when it is heavily infected with Botrytis cinerea (the Ct value of Botrytis cinerea detected in the leaves is 29.39), the content of Botrytis cinerea in its roots does not increase significantly (the Ct value of Botrytis cinerea detected in the roots is 39.76); at the same time, the content of Botrytis cinerea in the circulating hydroponic nutrient solution is not detected. These results indicate that the circulating nutrient solution in hydroponic leeks is not the main route of Botrytis cinerea transmission, the roots are not the main parasitic parts of Botrytis cinerea, the leaves are the main parasitic parts of Botrytis cinerea, and the transmission route of Botrytis cinerea among leeks is mainly the airborne transmission of bacterial spores, which causes the infection of leek leaves; therefore, when detecting Botrytis cinerea disease in leeks, leek leaves should be taken as the detection samples;

[0089] (2) When the Ct value of Botrytis cinerea detected in the leek leaves is less than 37.20, the leek is infected with Botrytis cinerea, which requires the attention of plant protection personnel; when the Ct value of Botrytis cinerea detected in the leek leaves is less than 34.55, the infection degree of Botrytis cinerea in the leek deepens, and plant protection personnel need to take intervention measures, otherwise it will cause the outbreak of Botrytis cinerea disease; when the Ct value of Botrytis cinerea detected in the leek leaves is less than 29.39, the infection of Botrytis cinerea in the leek has broken out, which will affect the growth of leeks, and plant protection personnel need to immediately take measures for treatment to avoid greater losses.

[0090] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A primer-probe set for detecting pathogenic microorganisms of Botrytis squamosa on Chinese chives based on fluorescence quantitative PCR, characterized in that, It includes primer HMB-F, primer HMB-R and probe P; Among them, the sequence of primer HMB-F is: 5’AAACTCGACCGCAGACATATT 3’; the sequence of primer HMB-R is: 5’ACCTTGTTAGCTGGCATGAG 3’; the sequence of probe P is: 5’FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ3’.

2. The primer-probe set for detecting pathogenic microorganisms of Botrytis squamosa of leeks based on fluorescence quantitative PCR according to claim 1, wherein, The primer HMB-F and primer HMB-R are used to amplify the specific gene sequence of the pathogen of Chinese chive gray mold - Botrytis squamosa; the specific gene sequence of Botrytis squamosa is shown as SEQ ID NO.

1.

3. A kit for detecting pathogenic microorganisms of Botrytis squamosa of Chinese chives based on fluorescence quantitative PCR, characterized in that, It includes the primer-probe set described in claim 1 or 2.

4. The kit for detecting pathogenic microorganisms of Botrytis squamosa of leeks based on fluorescence quantitative PCR according to claim 3, characterized in that, It further includes a fluorescence quantitative reaction solution.

5. The kit for detecting pathogenic microorganisms of Botrytis squamosa on leeks based on fluorescence quantitative PCR according to claim 4, wherein The fluorescence quantitative reaction solution includes DNA polymerase, dNTPs, Mg 2+ , buffer solution, and ROX.

6. The kit for detecting pathogenic microorganisms of Botrytis squamosa of leek based on fluorescence quantitative PCR according to claim 3, wherein It further includes a plasmid standard.

7. The detection kit for pathogenic microorganisms of Botrytis squamosa of leek based on fluorescence quantitative PCR according to claim 6, wherein, The plasmid standard is constructed by inserting Feature 11 containing the target gene into the PUC57 plasmid as a vector through genetic engineering methods; the nucleotide sequence of Feature 11 containing the target gene is shown as SEQ ID NO.

2.

8. A method for detecting pathogenic microorganisms of Botrytis squamosa of Chinese chives based on fluorescence quantitative PCR, characterized in that, Using the primer-probe set described in any one of claims 1 to 2, or the kit described in any one of claims 3 to 7, includes the following steps: (1) Take the leaves of the Chinese chive plants to be identified, grind them and then extract DNA; (2) Using the extracted DNA as a template, perform fluorescence quantitative PCR with primer HMB-F, primer HMB-R and the fluorescence probe; (3) Observe and analyze the Ct value of Botrytis detection during the fluorescence quantitative PCR process; when the Ct value < 37.20, it indicates that the Chinese chives are infected with gray mold.

9. The method for detecting pathogenic microorganisms of Botrytis squamosa of leek based on fluorescence quantitative PCR according to claim 8, wherein, In the step (2), the reaction system for fluorescence quantitative PCR is: 1 μL of Hot Start Taq DNA polymerase, 1 μL of dNTPs, 0.5 μL of MgCl2 / MgSO4, 2.5 μL of buffer solution with pH 8.0, 0.5 μL of ROX, 1 μL of primer HMB-F, 1 μL of primer HMB-R, 0.5 μL of probe P, 1 μL of template, 16 μL of H2O; The reaction program is: incubate at 50 °C for 2 min; pre-denature at 95 °C for 5 min; denature at 95 °C for 15 s, anneal / extend at 60 °C for 30 s, for 40 cycles.

10. The method for detecting pathogenic microorganisms of Botrytis squamosa of Chinese chives based on fluorescence quantitative PCR according to claim 8, wherein, In the step (3), the specific correspondence between the Ct value of Botrytis detection and the gray mold infection is: When 34.55 ≤ Ct value < 37.20, it indicates that the Chinese chives have a "slight" gray mold infection; When 29.39 ≤ Ct value < 34.55, it indicates that the Chinese chives have a "moderate" gray mold infection; When the Ct value < 29.39, it indicates that the Chinese chives have a "severe" gray mold infection.

Images