Bacillus amyloliquefaciens as well as construction method and application thereof

Abstract

The invention provides bacillus amyloliquefaciens as well as a construction method and application thereof. Wherein the bacillus amyloliquefaciens is the bacillus amyloliquefaciens of which the stress response transcription factor glcR gene is knocked out, and the bacillus amyloliquefaciens is a bacillus amyloliquefaciens of which the stress response transcription factor glcR gene is knocked out; the nucleotide sequence of the glcR gene is as shown in SEQ ID NO: 1. By knocking out a stress response transcription factor glcR gene in bacillus amyloliquefaciens, the level of glutaminase expression by using the bacillus amyloliquefaciens can be enhanced, the enzyme activity of the glutaminase obtained by expression is relatively high, and the activity of the enzyme can be further improved by using the modified strain; powerful technical support is provided for commercialized production of glutaminase, and great economic benefits and application prospects are achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fermentation, and more particularly, to a Bacillus amyloliquefaciens, a construction method thereof, and an application thereof. Background Art

[0002] Glutaminase can catalyze the hydrolysis of the γ-glutamyl group of glutamine to produce glutamic acid and ammonia. Glutaminase is ubiquitously present in living organisms, including microorganisms, plants, and the kidneys and livers of higher animals. The metabolic reactions it participates in play an important role in the nitrogen balance and amino acid metabolism in living organisms, and are an important way for the body to achieve anti-tumor effects, improve immunity, and antioxidant effects. Glutaminase has wide application values in the fields of food processing, fine chemicals, medical pharmaceuticals, etc.

[0003] The national food safety standard in China stipulates that currently, the only production strains of glutaminase are Bacillus amyloliquefaciens and Bacillus licheniformis. As food-grade safe strains, they have the characteristics of rapid growth and strong secretion ability, and are important host bacteria for glutaminase. The host bacteria will affect the expression of the enzyme protein, and it is of great significance to modify the host bacteria to improve glutaminase. However, currently, the activities of the strains producing glutaminase in China are generally low, and it is urgent to further improve the fermentation activity of glutaminase in China. Summary of the Invention

[0004] The main object of the present invention is to provide a Bacillus amyloliquefaciens, a construction method thereof, and an application thereof, so as to solve the problem of low enzyme activity of the glutaminase prepared in the prior art.

[0005] To achieve the above object, according to the first aspect of the present invention, there is provided a Bacillus amyloliquefaciens, wherein the Bacillus amyloliquefaciens is a Bacillus amyloliquefaciens in which the stress response transcription factor glcR gene is knocked out; the nucleotide sequence of the glcR gene is as shown in SEQ ID NO:1.

[0006] Furthermore, the copy number of the gene encoding glutaminase in the Bacillus amyloliquefaciens is ≥2.

[0007] Furthermore, the gene encoding glutaminase is derived from Bacillus amyloliquefaciens, and its nucleotide sequence is as shown in SEQ ID NO:2.

[0008] To achieve the above object, according to the second aspect of the present invention, there is provided a construction method of the above-mentioned Bacillus amyloliquefaciens, and the construction method includes: knocking out the glcR gene in the initial Bacillus amyloliquefaciens to obtain a glcR gene knockout Bacillus amyloliquefaciens, which is the Bacillus amyloliquefaciens; the nucleotide sequence of the glcR gene is as shown in SEQ ID NO:1.

[0009] Furthermore, knocking out the glcR gene in the initial Bacillus amyloliquefaciens includes: constructing a glcR gene knockout plasmid and transferring the glcR gene knockout plasmid into the initial Bacillus amyloliquefaciens for expression.

[0010] Furthermore, constructing the glcR gene knockout plasmid includes: digesting the glcR gene homologous arm fragment and the T2(2)-ori plasmid with enzymes to obtain a digested homologous arm fragment and a linear plasmid fragment; using DNA ligase to ligate the digested homologous arm fragment and the linear plasmid fragment to obtain the glcR gene knockout plasmid.

[0011] Furthermore, obtaining the glcR gene homologous arm fragment includes: using the first primer set with nucleotide sequences such as SEQ ID NOs: 5-6 and the second primer set with SEQ ID NOs: 7-8, and performing PCR amplification using the genomic DNA of the initial Bacillus amyloliquefaciens as a template to obtain an upstream homologous arm and a downstream homologous arm respectively; ligating the upstream homologous arm and the downstream homologous arm through overlap extension PCR to obtain the glcR gene homologous arm fragment.

[0012] Furthermore, after knocking out the glcR gene, the construction method further includes: transferring a plasmid carrying at least one copy number of the gene encoding glutaminase into the Bacillus amyloliquefaciens after glcR gene knockout to obtain Bacillus amyloliquefaciens.

[0013] Furthermore, the nucleotide sequence of the gene encoding glutaminase is as shown in SEQ ID NO: 2.

[0014] To achieve the above object, according to the third aspect of the present invention, there is provided an application of the Bacillus amyloliquefaciens obtained by using the above-mentioned Bacillus amyloliquefaciens and the above-mentioned construction method in the preparation of glutaminase.

[0015] Applying the technical solution of the present invention, by knocking out the stress response transcription factor glcR gene in Bacillus amyloliquefaciens, the level of glutaminase expression using this strain can be enhanced, and the enzyme activity of the expressed glutaminase is relatively high. Using this transformed strain can further improve the enzyme activity, providing strong technical support for the commercial production of glutaminase and having great economic benefits and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The specification drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings:

[0017] Figure 1It shows the PCR electrophoresis verification diagram of the free expression of glutaminase gene in the glcR gene-deleted strain in Example 4;

[0018] Figure 2 It shows the enzyme activity detection results of the glutaminase obtained by fermentation using the stress-responsive transcription factor-deleted strain in Example 5. Detailed implementation manners

[0019] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0020] Glossary:

[0021] Stress-responsive transcription factor: When an organism faces various environmental stresses (such as temperature changes, oxidative stress, nutrient deficiency, pH value changes, osmotic pressure changes, etc.), it can regulate gene expression to help the organism adapt to environmental changes, thereby improving its survival ability. These transcription factors activate or inhibit the transcription of genes related to the stress response by recognizing and binding to specific DNA sequences, namely stress response elements.

[0022] As mentioned in the background art, in the existing process of preparing glutaminase, most are to optimize the expression elements of glutaminase or the fermentation conditions of the strains, and the enzyme activity of the obtained glutaminase after optimization is still not high. Therefore, this application aims to provide a method for preparing glutaminase with relatively high enzyme activity.

[0023] In the first typical implementation manner of this application, a Bacillus amyloliquefaciens is provided. The Bacillus amyloliquefaciens is a Bacillus amyloliquefaciens with the stress-responsive transcription factor glcR gene knocked out; the nucleotide sequence of the glcR gene is as shown in SEQ ID NO:1. By knocking out the glcR gene in Bacillus amyloliquefaciens, the stress response mechanism of Bacillus amyloliquefaciens is readjusted, thereby improving the enzyme activity of glutaminase. And the Bacillus amyloliquefaciens before knocking out mentioned in this application is not limited to a specific type of Bacillus amyloliquefaciens, and any type of Bacillus amyloliquefaciens is applicable to this application.

[0024] SEQ ID NO:1:

[0025] TCACATGTCCTCATCCTCTTCTTCAGATTCAGTTACAAGCAATTCTACGCCGTGCCGGTCGAGCAGATCGCAAAAATCCTGATCAGGCAGCCGATCGGTAATCAGCAGGTCAACCTCGTGCAGGTCTGCATACTGATAAAAACTCGTACGGCCAAGCTTCGAGTGATCGCTCAGCGCAATCACCTGTTCAGCCTGTCGGATCATTTTACGCTTTACCATGCCGTCTTCTTCATGCGGAATCGTCAGGCCGTTTTCCGAGATGCCGACAACGCCGATCAGCACCTTATCAGCGTGATAATCCCCCAGTTTTTCTACAACGGAAGCCCCGTATAAAAACCGGTGTTCCTTCTGGAGCTTTCCGCCGAGCAGGTGAATATCAATTCCCTCTTTTGCGGAAAGGATATCGGCCTGATTGATCGAATTTGTAATAACAGTGCAGCCGGTGACATTTAAATGCTCCGCGCAGGCCTGAACGGTTGTCGATGTGTCCAGGATGATCCGGTCTCCTTTATGAATCAGGGATGCGGCCAGCTTGCCGATTTTGTTTTTCTCTTCAGAAACGGTTTTCAGCCGGCCCGAATAGCCCGGAACTTCCTGATTCACTGACGGCAGAATCGCGCCGCCCCGTGTTCTGATAATGGCCCCTCGCTCTTTCAGCTTTACAAGGTCCCTTCTTGCGGTATCTCTTGAAATATGAAGCAGCGAACATATCTGTTCAGCGGTGATCCGCCGGTGCTGTTTCAAATATTCCATTATCGCAATCAGTCTTTCTTCTTGATACAC。

[0026] In order to further improve the production of glutaminase in a single strain, the copy number of the gene encoding this enzyme in the strain can be increased. In a preferred embodiment, the copy number of the gene encoding glutaminase in Bacillus amyloliquefaciens is ≥2. By additionally transferring the gene encoding glutaminase, the enzyme production efficiency of this strain is further enhanced, showing significant advantages in the industrial fermentation for preparing glutaminase.

[0027] In a preferred embodiment, the nucleotide sequence of the gene encoding glutaminase (gene glu3(S467H)) is as shown in SEQ ID NO:2 (including the signal peptide, glu3(S467H) and the terminator).

[0028] SEQ ID NO:2:

[0029]

[0030] In the second typical embodiment of the present application, a construction method of the above-mentioned Bacillus amyloliquefaciens is provided. The construction method includes: knocking out the glcR gene in the initial Bacillus amyloliquefaciens to obtain a glcR gene knockout Bacillus amyloliquefaciens, which is the Bacillus amyloliquefaciens; the nucleotide sequence of the glcR gene is as shown in SEQ ID NO:1. By knocking out the glcR gene in Bacillus amyloliquefaciens, the obtained Bacillus amyloliquefaciens can improve the enzyme activity of glutaminase. Among them, the initial Bacillus amyloliquefaciens mentioned in the present application is not limited to a specific type of Bacillus amyloliquefaciens, and any type of Bacillus amyloliquefaciens is applicable to the present application.

[0031] In a preferred embodiment, knocking out the glcR gene in the initial Bacillus amyloliquefaciens includes: constructing a glcR gene knockout plasmid, transferring the glcR gene knockout plasmid into the initial Bacillus amyloliquefaciens for expression, and using the knockout plasmid carrying the glcR gene to knock out the gene from the genomic DNA of Bacillus amyloliquefaciens to obtain the above-mentioned modified strain. The principle is that a DNA fragment containing a certain known sequence undergoes homologous recombination and exchange with the gene having the same sequence in the genome of Bacillus amyloliquefaciens, and its homologous arms are integrated into the genome of the recipient cell, replacing the original gene sequence to obtain a gene deletion strain with an endogenous gene knocked out.

[0032] In a preferred embodiment, constructing the glcR gene knockout plasmid includes: digesting the glcR gene homologous arm fragment and the T2(2)-ori plasmid to obtain a digested homologous arm fragment and a linear plasmid fragment; using DNA ligase to ligate the digested homologous arm fragment and the linear plasmid fragment to obtain the glcR gene knockout plasmid. Using this plasmid can quickly achieve homologous recombination of the upstream and downstream homologous arms, and genetically engineer Bacillus amyloliquefaciens by the method of scarless gene knockout, without introducing any foreign genes and without generating other accessory substances. Using this strain for production is harmless to humans and other organisms.

[0033] In order to obtain the recombinant plasmid more accurately and efficiently, in a preferred embodiment, obtaining the glcR gene homologous arm fragment includes: using the first primer set with nucleotide sequences such as SEQ ID NOs: 5-6 and the second primer set with SEQ ID NOs: 7-8, performing PCR amplification with the genomic DNA of the initial Bacillus amyloliquefaciens as the template to obtain the upstream homologous arm (shown as SEQ ID NO: 3) and the downstream homologous arm (shown as SEQ ID NO: 4); connecting the upstream homologous arm and the downstream homologous arm through overlap extension PCR to obtain the glcR gene homologous arm fragment. Among them, the overlap extension PCR technology is to design a pair of primers with overlapping sequences, enabling the PCR products to anneal and extend to each other, thereby achieving seamless ligation of DNA fragments. The use of this overlap extension PCR technology further ensures the seamless and accurate ligation of DNA fragments.

[0034] Upstream homologous arm (SEQ ID NO: 3):

[0035] AGATCTTTCTGACCGCTGAATCGGTCCCAGCCCGCTTTCAGCTTCCGCTCATCAAACGAAAATCCGAGAATATTATAAAAATCCAGATGCTCTTCTTTCTCAAAGAGCTCACGGTATGAATGAATGTAAGCAAAGCCGGACTGGCTGTATTGCACTGAAGCCGCCTGTTCCAAAACGGAAAGATCGGTTTCCGGATTGGCGCTTTTCACCCGGTCCATTTCGATATCGAGCAGCTGCCTGCCGGTTTCAGGCGTATAGATGGCTTTGTTTGTAAACACCTCATAATAATATTGATTCTCTTCAAGCCATGACAAAATCCCCCGGGCTCTTGATTCTTCAATCGCTTCACAATGGTACAGGCTGCCGTCAGGAGCATGAATGGCGGCTCCGTTTGCGCTGATAATCCATGTTTTTATGCCGAGCGGTTCGAATATGGAGTGCACATCAAAATGCGCGCGTCCAGTGGAAACCACGATTTCAATTCCCGCTTGCCGGGCTTCCCTTAAAGCCCGCTTGTTTTCATCACTTACTTGATGACTGCTGTTCAGCAGTGTGCCGTCCAGATCTATGGCAATCAGTT。

[0036] Downstream homologous arm (SEQ ID NO:4):

[0037] GTCCTCATTCCCTTTTTTTCGTCACTTATCTGTAAGTAATTATAAGTTTTTATCCCAATATATTCAATGTTTTTAAGTATTTATAAGCGAAATCACTTCTTTTTAACCATTTTTCAGCTCCCGCACAAAAAAACCAGTCTTTCGACTGGCGAATGGGAAGGAGGTATTGCGGGGCCCGCTGAAAGGCGGGAAATCGAGGAAAAAAGCATGCTATTCAGCCAGCGGCTCTTTCCGTTTTTGATCCATAAACCGAACGGTATCAGCCATGACCTCGGTCACATAAACTTTTACGCCGTCTGTCTTTTCATAGCTTCTCGTCTGGATTCTGCCGCTTACACCGACCATTGACCCTTTTTGGCAGTACAATGCCGTGTTTTCAGCGTTTTTCCTCCAGATGGTGCAGTTGACAAAGTCGGTTCCGGTTTCACCCGACGCGCTTTTAAAATTGCGGTTTACCGCCAACGTAATATGAGCGACGGGAATGCCCGCTGATGTAAAACGGAGCTCCGGGTCTTTCGTCAGCCGGCCGACAAGCATAACGTGGTTAAAC。

[0038] glcR-F1 (SEQ ID NO:5): CGGGATCCGAGATCTTTCTGACCGCTGA (containing BamHI restriction site).

[0039] glcR-R1 (SEQ ID NO:6):

[0040] GATTGCGATAATGGAATATTTGAACTGATTGCCATAGATCTGGAC。

[0041] glcR-F2 (SEQ ID NO:7):

[0042] GTCCAGATCTATGGCAATCAGTTCAAATATTCCATTATCGCAATC。

[0043] glcR-R2 (SEQ ID NO:8): GCTCTAGAGTTTAACCACGTTATGCTTGTC (containing XbaI cleavage site).

[0044] In order to further increase the copy number of the gene encoding glutaminase in the above-mentioned genetically modified strain with the glcR gene knocked out, in a preferred embodiment, after knocking out the glcR gene, the construction method further includes: transferring a plasmid carrying at least one copy of the gene encoding glutaminase into the Bacillus amyloliquefaciens with the glcR gene knocked out to obtain Bacillus amyloliquefaciens.

[0045] In a preferred embodiment, the nucleotide sequence of the gene encoding glutaminase is as shown in SEQ ID NO:2.

[0046] In the third typical embodiment of the present application, there is provided an application of the Bacillus amyloliquefaciens obtained by using the above-mentioned Bacillus amyloliquefaciens and the above-mentioned construction method in the preparation of glutaminase. Using the above-mentioned Bacillus amyloliquefaciens can obtain glutaminase with improved enzyme activity.

[0047] The following further describes the present application in detail with specific examples, and these examples should not be construed as limiting the scope claimed by the present application.

[0048] For the molecular biology experimental methods without specific conditions indicated in the following examples, all are carried out under conventional conditions with reference to "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor).

[0049] Description of biological materials used in the examples of the present application:

[0050] Bacillus amyloliquefaciens HZ-12, thermosensitive plasmid T2(2)-ori, and free expression vectors pHY300 and pMA5-g8 are publicly available biomaterials that have been reported in the articles (Ruan Liying, Li Lu, Zou Dian, Jiang Cong, Wen Zhiyou, Chen Shouwen, Deng Yu, Wei Xuetuan, (2019) Metabolic engineering of Bacillus amyloliquefaciens for enhanced production of S-adenosylmethionine by coupling of an engineered S-adenosylmethionine pathway and the tricarboxylic acid cycle. Biotechnol. Biofuels 12, 211) and (Mao Zijing, Zhang Zuzheng, Chen Ming, Wang Songbai, Niu Shuo, Yu Huashun, Zhang Yan, Zheng Xianliang, (2024) Optimization of promoter and signal peptide for enhanced secretion expression of glutaminase in Bacillus subtilis. Acta Microbiologica Sinica, 51(5): 1536-1549) and are currently stored in the Microbial Engineering Laboratory of Huazhong Agricultural University.

[0051] Example 1: Construction of free expression vector

[0052] According to the gene sequence of glu3 in the existing plasmid pMA5-g8 sequence in the laboratory (as shown in SEQ ID NO:25, where the underlined part at the front of the sequence is the signal peptide region, the underlined part at the back of the sequence is the terminator region, and the middle is the gene glu3(S467H) shown in SEQ ID NO:3), upstream primers (glu3-F-X and SH1R) and downstream primers (SH1F and glu3-R-N) of the glu3 gene were designed; using the full gene sequence of plasmid pMA5-g8 as a template, upstream sequence A and downstream sequence B were amplified respectively. After purification and recovery of the PCR products, using glu3-F-X and glu3-R-N as primers, the two fragments were ligated by SOE-PCR to obtain the fusion fragment A+B. The primer sequences are as follows:

[0053] glu3-F-X (SEQ ID NO:9): CCCCCC GGGGTTCGGATTCATCTATGGGAG (containing XbaI restriction site).

[0054] SH1R (SEQ ID NO:10): GTAGGCGTCATATGACTCAACGGGCGTTTATTAGGTTGAA.

[0055] SH1F (SEQ ID NO: 11): CTAATAAACGCCCGTTGAGTCATATGACGCCTACGATTCTG.

[0056] glu3-RN (SEQ ID NO: 12): GGAATTCCATATGAGACATACCGGGATCCCA (containing NdeI restriction enzyme cleavage site).

[0057] PCR system: ddH2O 25.0 μL, 5× TransStart TM FastPfu Buffer 5.0 μL, dNTPs 2.5 μL, FastPfu DNA Polymerase 1.0 μL, forward primer 1.0 μL, reverse primer 1.0 μL, template DNA 0.5 μL.

[0058] PCR reaction conditions: 95°C for 5 min; 32 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 60 s; and 72°C for 5 min.

[0059] SOE-PCR reaction conditions: 95°C for 5 min; 32 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 60 s; and 72°C for 5 min.

[0060] The fusion fragment A+B and the episomal expression plasmid pHY300 were double-digested with XbaI and NdeI restriction endonucleases to obtain a digested gene fragment and a linearized plasmid fragment. The digested gene fragment and the linearized plasmid fragment were ligated using T4 DNA ligase to obtain a ligation product. This ligation product was transformed into Escherichia coli DH5α via the calcium chloride transformation method and screened at 37°C in LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.2) containing tetracycline (20 μg / mL) resistance. Transformants were obtained and verified by colony PCR and plasmid PCR (primers pHY300F and pHY300R) to obtain the episomal expression vector pHY-glu3(S467H). Other knockout vectors described in this application were constructed using the same method.

[0061] Among them, the sequences of pHY300F and pHY300R are:

[0062] pHY300F (SEQ ID NO: 13): GTTTATTATCCATACCCTTAC.

[0063] pHY300R (SEQ ID NO:14): CAGATTTCGTGATGCTTGTC。

[0064] Gene sequence of glu3 (SEQ ID NO:25):

[0065] GTTCGGATTCATCTATGGGAGGCAAGTGATGAAGGCTGGCGCTCTCGTAGTAATGATTCACCGGTTTG TACAGGTGCGGAGTCGTTTATTGCTGGTACTGCTAGTTGCCGCATTGAAGTAGAGGGAATTGATGAATTATATCAA CATATTAAGCCTTTGGGCATTTTGCACCCCAATACATCATTAAAAGATCAGTGGTGGGATGAACGAGACTTTGCAG TAATTGATCCCGACAACAATTTGATTAGCTTTTTTCAACAAATAAAAAGCTAAAATCTATTATTAATCTGTTCAGC AATCGGGCGCGATTGCTGAATAAAAGATACGAGAGACCTCTCTTGTATCTTTTTTATTTTGAGTGGTTTTGTCCGT TACACTAGAAAACCGAAAGACAATAAAAATTTTATTCTTGCTGAGTCTGGCTTTCGGTAAGCTAGACAAAACGGAC AAAATAAAAATTGGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCTTCTCAAAAAATACTACCTGTCCCTTGC TGATTTTTAAACGAGCACGAGAGCAAAACCCCCCTTTGCTGAGGTGGCAGAGGGCAGGTTTTTTTGTTTCTTTTTT CTCGTAAAAAAAAGAAAGGTCTTAAAGGTTTTATGGTTTTGGTCGGCACTGCCGACAGCCTCGCAGAGCACACACT TTATGAATATAAAGTATAGTGTGTTATACTTTACTTGGAAGTGGTTGCCGGAAAGAGCGAAAATGCCTCACATTTG TGCCACCTAAAAAGGAGCGATTTACATGGCGGCGTTCTGTTTCTGCTTCGGTATGTGATTGTGAAGCTGGCTTACA GAAGAGCGGTAAAAGAAGAAATAAAAAAGAAATCATCTTTTTTGTTTGGAAAGCGAGGGAAGCGTTCACAGTTTCG GGCAGCTTTTTTTATAGGAACATTGATTTGTATTCACTCTGCCAAGTTGTTTTGATAGAGTGATTGTGATAATTTT AAATGTAAGCGTTAACAAAATTCTCCAGTCTTCACATCGGTTTGAAAGGAGGAAGCGGAAGAATGAAGTAAGAGGG ATTTTTGACTCCGAAGTAAGTCTTCAAAAAATCAAATAAGGAGTGTCAAGAATGTTTGCAAAACGATTCAAAACCT CTTTACTGCCGTTATTCGCTGGATTTTTATTGCTGTTTCATTTGGTTCTGGCAGGACCGGCGGCTGCGAGTGCTGA AGGTAATAAAAAAACACCTCCAAGCTGAGTGCGGGTATCAGCTTGGAG GTGCGTTTATTTTTTCAGCCGTATGACAAGGTCGGCATCAGGTGTGACAAATACGGTATGCTGGCTGTCATAGGTG ACAAATCCGGGTTTTGCGCCGTTTGGCTTTTTCACATGTCTGATTTTTGTATAATCAACAGGCACGGAGCCGGAAT CTTTCGCCTTGGAAAAATAAGCGGCGATCGTAGCTGCTTCCAATATGGATTGTTCATCGGGATCGCTGCTTTTAAT CACAACGTGGGATCCCGGTATGTCT 。

[0066] Example 2: Construction of a temperature-sensitive knockout vector

[0067] According to the gene sequence of the glcR gene in the genomic DNA sequence of Bacillus amyloliquefaciens HZ-12, upstream homologous arm primers (glcR-F1, glcR-R1) and downstream homologous arm primers (glcR-F2, glcR-R2) of the glcR gene were designed; and using the genomic DNA of Bacillus amyloliquefaciens HZ-12 as a template, the upstream homologous arm fragment of the glcR gene and the downstream homologous arm fragment of the glcR gene were obtained by PCR amplification with the upstream homologous arm primers and downstream homologous arm primers of the glcR gene respectively (the upstream homologous arm fragment of the glcR gene is 580 bp; the downstream homologous arm fragment of the glcR gene is 550 bp). The primer sequences are as follows:

[0068] glcR-F1 (SEQ ID NO:15): CGGGATCCGAGATCTTTCTGACCGCTGA (containing BamHI restriction site).

[0069] glcR-R1 (SEQ ID NO:16):

[0070] GATTGCGATAATGGAATATTTGAACTGATTGCCATAGATCTGGAC.

[0071] glcR-F2 (SEQ ID NO:17):

[0072] GTCCAGATCTATGGCAATCAGTTCAAATATTCCATTATCGCAATC.

[0073] glcR-R2 (SEQ ID NO:18): GCTCTAGAGTTTAACCACGTTATGCTTGTC (containing XbaI restriction site).

[0074] PCR system: ddH2O 25.0 μL, 5×TransStart TM FastPfu Buffer 5.0 μL, dNTPs 2.5μL, FastPfu DNA Polymerase 1.0 μL, forward primer 1.0 μL, reverse primer 1.0 μL, template DNA 0.5μL.

[0075] PCR reaction conditions: 95°C for 5 min; 95°C for 30 s, 50 - 60°C for 30 s, 72°C for 30 - 60 s, with 30 - 35 cycles; 72°C for 5 min.

[0076] According to the above PCR reaction system and conditions, the upstream gene fragment of glcR (580 bp) was obtained by PCR amplification using the primer pair (glcR-F1 / glcR-R1), and its sequence is shown in SEQ ID NO:3. The downstream gene fragment of glcR (550 bp) was obtained by PCR amplification using the primer pair (glcR-F2 / glcR-R2), and its sequence is shown in SEQ ID NO:4. The upstream homologous arm and the downstream homologous arm were connected together by overlap extension PCR to form a homologous arm fusion fragment (1130 bp).

[0077] The homologous arm fusion fragment and the temperature-sensitive plasmid T2(2)-ori stored in our laboratory were double-digested with XbaI and BamHI restriction endonucleases to obtain digested gene fragments and linear plasmid fragments. The digested gene fragments and linear plasmid fragments were ligated with T4 DNA ligase to obtain a ligation product. This ligation product was transformed into Escherichia coli DH5α by the calcium chloride transformation method and screened on an LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.2) containing kanamycin (20 μg / mL) resistance at 37°C. The transformants were obtained, and the transformants were verified by colony PCR and plasmid PCR (the primers used were: T2-F-1 and T2-R-1) to obtain the gene knockout vector T2(2)-ΔglcR. Other knockout vectors involved in this application were constructed in the same way.

[0078] Among them, the sequences of T2-F-1 and T-R-1 are:

[0079] T2-F-1 (SEQ ID NO:19): ATGTGATAACTCGGCGTA.

[0080] T2-R-1 (SEQ ID NO:20): GCAAGCAGCAGATTACGC.

[0081] Example 3: Construction of the gene knockout engineering bacterium HZ-12ΔglcR

[0082] The knockout vector T2(2)-ΔglcR was transferred into Bacillus amyloliquefaciens HZ-12 and screened on a medium containing kanamycin (20 μg / mL) resistance at 37°C. The transformants were obtained and verified by colony PCR (the primers used were: T2-F-2 and T2-R-2), and positive transformants (i.e., Bacillus amyloliquefaciens HZ-12 into which the knockout vector T2(2)-ΔglcR was transferred) were obtained.

[0083] Among them, the sequences of T2-F-2 and T2-R-2 are as follows:

[0084] T2-F-2 (SEQ ID NO:21): ATGTGATAACTCGGCGTATGT.

[0085] T2-R-2 (SEQ ID NO:22): TTGAAGTGGTGGCCTAACTAC.

[0086] The positive transformants were subcultured 3 times on a medium containing kanamycin resistance at 45°C, with each culture for 12 h, and colony PCR was performed using T2-F-2 and ΔglcR-KYR as primers (or using T2-R-3 and ΔglcR-KYF as primers) to detect single crossover strains. A band with a length of 1465 bp or 1422 bp was amplified, indicating the obtained single crossover strains.

[0087] Among them, the sequences of ΔglcR-KYF and ΔglcR-KYR are as follows:

[0088] ΔglcR-KYF (SEQ ID NO:23): GCCCTTTTGAGGCGTTTC.

[0089] ΔglcR-KYR (SEQ ID NO:24): CATAAAAGCAGCCCAAACG.

[0090] The single crossover strains were inoculated and cultured, subcultured several times in a medium without kanamycin at 37°C, and the transformants were picked for colony PCR verification (the primers were ΔglcR-KYF and ΔglcR-KYR), and single colonies with a band size of 1296 bp were picked. Subsequently, DNA sequencing was performed on the positive transformants for further verification, and a glcR knockout strain with successful double crossover (i.e., Bacillus amyloliquefaciens HZ-12ΔglcR) was obtained.

[0091] Example 4: Construction of an engineered strain for free expression of glutaminase gene glu3(S467H)

[0092] The free plasmid vector pHY-glu3(S467H) obtained in Example 1 was electrotransformed into competent cells of HZ-12 and HZ-12ΔglcR, and then spread on plates with tetracycline (Tet) resistance. The cells were cultured in a constant temperature incubator at 37 °C for 16 - 24 h to obtain the corresponding transformants. A certain number of transformants were picked and streaked on the corresponding plates for about 8 h for colony PCR verification. The verification primers were pHY300F and pHY300R. The colonies with correct verification were picked and inoculated into 5 mL of liquid LB medium (containing an appropriate amount of one-thousandth tetracycline antibiotic), and cultured in a constant temperature shaker at 37 °C at 180 r / min for 12 h. 800 µL was taken and stored in a glycerol tube, and the glycerol tube was stored in an ultra-low temperature freezer at -80 °C. The PCR verification results of the engineering bacteria HZ-12ΔglcR / pHY-glu3(S467H) are as Figure 1 shown. The target band amplified by the above verification primers pHY300F and pHY300R was 3485 bp (as shown by the band in lane "1" in Figure 1 ).

[0093] Example 5: Effect of knocking out stress-responsive transcription factors on the fermentation enzyme activity of glutaminase

[0094] Fermentation medium: peptone 12 g / L, yeast powder 24 g / L, dipotassium hydrogen phosphate 21.52 g / L, potassium dihydrogen phosphate 2.32 g / L, glycerol 10 g / L;

[0095] pH 10.0 Na2B4O7·10H2O-NaOH buffer: Weigh 19.069 g of Na2B4O7·10H2O, dissolve it in 800 mL of pure water, adjust the pH to 10.0 with sodium hydroxide solution, and then make up the volume to 1000 mL.

[0096] Terminator: 4 mol / L acetic acid. Weigh 24.02 g of CH3COOH and make up the volume to 100 mL with pure water.

[0097] Substrate A: Accurately weigh 0.67 g of γ-L-glutamyl-p-nitroanilide monohydrate (γ-GPNA), dissolve it with the above buffer and make up the volume to 250 mL, and store it in a refrigerator at 4 °C;

[0098] Substrate B: Accurately weigh 5.29 g of glycylglycine (Gly-Gly), dissolve it with the above buffer and make up the volume to 250 mL, and store it in a refrigerator at 4 °C.

[0099] For the fermentation seeds, use LB liquid medium (50 mL in a 250 mL Erlenmeyer flask; for the strain with enhanced expression, add Tet at a concentration of 20 μg / mL). Inoculate the engineered strains HZ-12 / pHY-glu3(S467H) and HZ-12ΔglcR / pHY-glu3(S467H) separately. After inoculation, culture at 140 r / min and 37°C for 8 - 12 h; when OD600 reaches 3.5 - 4.0, inoculate into the fermentation medium (50 mL in a 250 mL Erlenmeyer flask) at an inoculation amount of 3% and culture at 37°C and 140 r / min for 72 h.

[0100] Enzyme solution: Dilute the different enzyme solutions after the above culture to about 1 U / mL respectively.

[0101] Detection method and reagents: Take 980 μL of substrate A and 980 μL of substrate B in a 10 mL stoppered test tube, preheat in a 37°C water bath for 5 min; add 40 μL of the above diluted different enzyme solutions respectively, mix well, react accurately for 5 min, add 800 μL of the terminator, and mix immediately; measure the absorbance value A by colorimetry with a blank tube as the reference blank at a wavelength of 410 nm. For the blank tube, just add the enzyme solution after adding the terminator, and the fermentation enzyme activity can be obtained by calculation and conversion.

[0102] Calculation formula: E = △A × 0.1057 × 2.8 × n / (5 × 0.04)

[0103] 0.1057: Concentration of p-nitroaniline is 0.1057 μmol / mL;

[0104] 2.8: Total volume of the reaction solution;

[0105] n: Dilution factor of the enzyme solution;

[0106] 5: Enzymatic reaction time;

[0107] 0.04: Volume of the enzyme solution participating in the reaction.

[0108] The fermentation results are as Figure 2 shown. The glutaminase fermentation activity of the engineered strain HZ-12ΔglcR / pHY-glu3(S467H) reached 0.72 U / mL, which was 350% higher than that of the control strain HZ-12 / pHY-glu3(S467H), indicating that the deletion of glcR is a new way to significantly improve the enzyme activity of glutaminase.

[0109] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: By freely expressing the glutaminase gene glu3(S467H) in Bacillus amyloliquefaciens with the glcR gene knocked out using the present application, the enzyme activity of glutaminase can be significantly improved. Compared with Bacillus amyloliquefaciens HZ-12 / pHY-glu3(S467H) without the glcR gene knocked out, the enzyme activity is increased by 350%. Moreover, the Bacillus amyloliquefaciens obtained by the construction method of the present application does not introduce any foreign genes, does not produce other accessory substances, and is harmless to humans and other organisms.

[0110] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A Bacillus amyloliquefaciens, characterized in that, The Bacillus amyloliquefaciens is a Bacillus amyloliquefaciens with the stress response transcription factor glcR gene knocked out; The nucleotide sequence of the glcR gene is as shown in SEQ ID NO:

1.

2. The Bacillus amyloliquefaciens according to claim 1, characterized in that, The Bacillus amyloliquefaciens contains ≥2 copies of the gene encoding glutaminase.

3. The Bacillus amyloliquefaciens according to claim 2, wherein The gene encoding glutaminase is derived from Bacillus amyloliquefaciens, and its nucleotide sequence is as shown in SEQ ID NO:

2.

4. The construction method of Bacillus amyloliquefaciens according to any one of claims 1-3, characterized in that, The construction method includes: knocking out the glcR gene in the initial Bacillus amyloliquefaciens to obtain the glcR gene knockout Bacillus amyloliquefaciens, which is the Bacillus amyloliquefaciens; The nucleotide sequence of the glcR gene is as shown in SEQ ID NO:

1.

5. The construction method according to claim 4, characterized in that The knocking out of the glcR gene in the initial Bacillus amyloliquefaciens includes: Constructing a glcR gene knockout plasmid and transferring the glcR gene knockout plasmid into the initial Bacillus amyloliquefaciens for expression.

6. The construction method according to claim 5, characterized in that, The construction of the glcR gene knockout plasmid includes: Restricting the glcR gene homologous arm fragment and the T2(2)-ori plasmid to obtain a restricted homologous arm fragment and a linear plasmid fragment; Using DNA ligase to ligate the restricted homologous arm fragment and the linear plasmid fragment to obtain the glcR gene knockout plasmid.

7. The construction method according to claim 6, characterized in that Obtaining the glcR gene homologous arm fragment includes: Using the first primer set with nucleotide sequences as SEQ ID NOs:5-6 and the second primer set with nucleotide sequences as SEQ ID NOs:7-8, and using the genomic DNA of the initial Bacillus amyloliquefaciens as a template for PCR amplification to obtain the upstream homologous arm and the downstream homologous arm respectively; Connecting the upstream homologous arm and the downstream homologous arm by overlapping extension PCR to obtain the glcR gene homologous arm fragment.

8. The construction method according to claim 4, characterized in that After knocking out the glcR gene, the construction method further includes: Transferring a plasmid carrying at least one copy of the gene encoding glutaminase into the glcR gene knockout Bacillus amyloliquefaciens to obtain the Bacillus amyloliquefaciens.

9. The construction method according to claim 8, characterized in that, The nucleotide sequence of the gene encoding glutaminase is as shown in SEQ ID NO:

2.

10. Use of the Bacillus amyloliquefaciens obtained by using the Bacillus amyloliquefaciens according to any one of claims 1-3 and the construction method according to any one of claims 4-9 in the preparation of glutaminase.

Images