SNP (Single Nucleotide Polymorphism) site for detecting banding character of pea and application of SNP site

Abstract

The invention relates to the technical field of plant biology, and particularly provides an SNP site for detecting the banding character of peas and application of the SNP site, the SNP site is located at the 16601390th nucleotide site of a chromosome 4 of a pea genome (CAASPsatZW61.0), and the basic group of the SNP site is G or T. Based on the SNP site, the invention develops a KASP molecular marker, and a primer group of the KASP molecular marker comprises sequences as shown in SEQ ID NO. 1 to SEQ ID NO. 3. KASP genetic typing is carried out through the primer group, the character of peas to be detected can be judged, and when the genotype is GG, the character is banded; when the genotype is TG or TT, the gene shows a normal phenotype. Through verification, the KASP molecular marker shows a group typing effect with high consistency and clear boundary in group typing. The KASP marker provided by the invention can realize early, rapid and low-cost detection of the banding character of peas, and is suitable for molecular marker-assisted breeding of peas.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and particularly relates to SNP loci for detecting pea fasciation traits and their applications. Background Art

[0002] Pea plant fasciation is a phenomenon during the growth of peas, which refers to the gradual flattening and broadening of the plant stem during growth, forming a banded structure, with the inflorescences concentrated at the top and growing luxuriantly ( Figure 1 ). Fasciated pea varieties have more compact plants, with the top pods blooming evenly and maturing at the same time, which is convenient for mechanical harvesting and management, and can greatly improve the harvesting efficiency. In addition, pea fasciation exhibits the characteristic of numerous inflorescences and has great potential for increasing yields. Therefore, the study of pea plant fasciation is of great significance for pea production. At present, most of the research on pea gene mining and genetic regulation is carried out based on the screening of special mutants or genetic mapping methods. Historically, Mendel has already located relevant regulatory loci, but the major genes regulating this trait have not been determined yet.

[0003] Peas are considered a model for the compound inflorescence development of many leguminous plants, and fasciation is one of the seven pea traits discovered by Mendel, having a profound impact on genetics. The fasciation phenomenon in peas was first recorded in 1597, and breeders have been committed to exploring clearly the genetic variation of this stem structure, flowering physiology and maturation mechanism. Fasciated pea varieties have terminal inflorescences, and the fruits are all concentrated at the top, which is convenient for harvesting, but they have poor lodging resistance and are easily affected by drought during the pod-bearing period and when the flowering period is shortened. In 1962, Marx and Hagedorn found that the fasciated phenotype is controlled by a single recessive gene, but shows unstable expressivity and incomplete penetrance; in 1974, Lamprecht proposed that the fasciation mutation is controlled by two recessive genes (fa and fas), the former is located on linkage group IV, and the latter is located on linkage group III; Rod and Vagnerova believe that the fasciated phenotype is controlled by three multiple alleles; Loennig conducted allele detection on 12 fasciated varieties, and the results showed that the two mutants Mut I / 74 and Mut II / 87 of Vasileva are alleles, but are different from the genetic population at the Fa2 locus. M. et al. showed through research on the world's pea genetic resources that the fasciated phenotype is controlled by three loci, namely fa1 (located on LGIV), fa2 (located on LGV) and fas (located on LGIII).

[0004] The research on Arabidopsis thaliana zonation is relatively in-depth. In 1993, Steven E. Clark et al. discovered the CLV1 gene that controls zonation in Arabidopsis thaliana, described the expression pattern of CLV1, and cloned it in 1997. In 1998, Steven E. Clark and Jeffrey M. Kayes cloned the Arabidopsis thaliana CLV2 gene. In 1995, Arabidopsis thaliana CLV3 was discovered and cloned in 1999. The authors found that loss-of-function mutations in the CLAVATA genes of Arabidopsis thaliana would expand its meristem and produce extra floral organs. Genetic analysis showed that CLV1, which encodes a receptor kinase, acts together with CLV3 to control the balance between meristematic cell proliferation and differentiation. In 2001, Hidetaka Kaya et al. cloned the FAS gene of Arabidopsis thaliana and found that the FAS1 and FAS2 genes maintained the cellular and functional tissue activities of the SAM and RAM. FAS is a subunit of the chromatin assembly factor (CAF-1) in Arabidopsis thaliana and plays a role in regulating chromatin assembly and maintaining genome stability in Arabidopsis thaliana. In 2009, Kiyomi Abe et al. cloned the Arabidopsis thaliana BRCA2 gene and found that the mutant atbrca2 plants showed zonation and abnormal phyllotaxy phenotypes, and the expression level of the ATBRCA2 gene was upregulated after γ-irradiation. This may be because the DNA damage caused by γ-irradiation activated the expression of the ATBRCA2 gene, enabling it to carry out DNA repair and cell cycle regulation.

[0005] The zonation phenotype of soybean is similar to that of pea, showing flattened stems, fewer branches, and terminal inflorescences. In 2011, Ryutaku Onda et al. conducted molecular mapping studies on three soybean F2 populations and showed that the zonation locus (F locus) is located on chromosome 2 (LG D1b), and there are two predicted genes, Glyma02g36940 and Glyma02g36960, near the DNA marker, encoding LRR-RLK and WD-repeat proteins respectively. Significant sequence variations occurred in these two genes, resulting in mutant alleles of soybean zonation and forming a phenotype similar to that of the Arabidopsis thaliana mutant clv1. Currently, it is not determined which candidate gene controls soybean zonation and further analysis is needed to determine it.

[0006] Kompetitive Allele Specific PCR (KASP) is a high-throughput genotyping technology based on SNP fluorescence detection. Compared with traditional molecular markers, KASP has the characteristics of high throughput, low cost, and simple operation. First of all, it can meet the requirements of low-, medium-, and high-throughput genotyping. The number of SNPs that can be detected per day can reach 500,000, and the number of samples can range from single to tens of thousands, with great flexibility. Secondly, KASP uses universal probes and does not require re-synthesis of probes for each locus, greatly reducing the experimental cost. In addition, KASP does not require gel electrophoresis detection and can use conventional qPCR instruments for genotyping, with strong compatibility and easy operation.

[0007] KASP markers have been widely used in population genetics research. Swisher Grimm et al. developed two KASP genotyping markers to screen for resistance genes against Pea seed-borne mosaic virus (PSbMV-P1). The KASP markers successfully screened two PSbMV-P1 resistance allele mutants, eIF4E-1 and eIF4E-2. Through experimental verification, the KASP markers achieved 100% accuracy in identifying PSbMV-P1 resistance genotypes. Haibo et al. used SNP markers obtained by Restriction-site Associated DNA sequencing (RADseq) to construct a high-density apple genetic linkage map containing 10,172 markers in a segregating population of 350 offspring generated from the cross between two apple cultivars, 'Honeycrisp' and 'Qinguan'. Under water stress and sufficient irrigation conditions, a total of 33 quantitative trait loci (QTLs) related to carbon isotope composition (δ 13 C) were identified. Through KASP detection and verification, it was found that 3 QTL loci were stable for two consecutive years under water stress conditions, and these loci were located on linkage groups LG8, LG15, and LG16 respectively.

[0008] In summary, at the present stage, most of the research on pea banding-related genes and inheritance patterns is based on mutants or genetic mapping of a few parents. The most popular view at present is that banding is controlled by two independent loci, fa (located on LGIV) and fas (located on LG III), but the specific regulatory genes have not been further determined, and the regulatory network of banding has not been elucidated. With the development of genomics and bioinformatics, using genome sequencing to develop KASP molecular markers closely linked to pea banding genes and mining pea banding regulatory genes through map-based cloning will open up new ideas and methods for pea genetic research and breeding. Summary of the Invention

[0009] The object of the present invention is to overcome at least one deficiency of the prior art, and provide an SNP locus for detecting the banding trait of peas and its application.

[0010] The technical solution adopted by this application is as follows:

[0011] The first aspect of the present invention provides an SNP locus, which is located at the 16,601,390th nucleotide site on chromosome 4 of the pea genome (CAAS_Psat_ZW6_1.0), and its base is G or T.

[0012] The second aspect of the present invention provides a KASP primer set, which includes the sequences shown in SEQ ID NO.1 - SEQ ID NO.3.

[0013] The third aspect of the present invention provides a kit, which includes the above primer set.

[0014] The fourth aspect of the present invention provides the application of the above SNP locus, or the above primer set, or the above kit in any one of the following (A1)-(A5):

[0015] (A1) Application in detecting or assisting in detecting the banding trait of peas;

[0016] (A2) Application in preparing products for detecting or assisting in detecting the banding trait of peas;

[0017] (A3) Application in breeding for the banding trait of peas;

[0018] (A4) Application in identifying and protecting pea germplasm resources and new varieties;

[0019] (A5) Application in improving and innovating pea germplasm resources.

[0020] Furthermore, the above application is carried out by any one of the following technical means (B1)-(B3):

[0021] (B1) Detecting the polymorphism or genotype of the above SNP locus; the detection methods include one or more of mass spectrometry, liquid chromatography, resequencing, targeted sequencing, and multiplex PCR sequencing;

[0022] (B2) Developing PCR markers using the sequence information of the above SNP locus, and the PCR markers include one or more of PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, and HRM markers;

[0023] (B3) Using the above-mentioned SNP sites to carry out molecular manipulation to achieve molecular breeding improvement and germplasm resource innovation of pea banding traits, the molecular manipulation includes gene editing or genetic transformation.

[0024] A fifth aspect of the present invention provides a method for detecting the banding trait of peas, comprising: detecting the nucleotide at the above-mentioned SNP site of the peas to be tested, and determining the banding trait of the peas to be tested based on the detection result.

[0025] Furthermore, the above detection method uses the above primer set and / or uses the above kit to detect the peas to be tested.

[0026] Furthermore, the above detection method comprises the following steps:

[0027] (1) extracting DNA from the pea to be tested;

[0028] (2) using the DNA as a template and the primer set and / or the kit to perform PCR amplification;

[0029] (3) Determine the properties of the peas to be tested based on the amplification test results.

[0030] Furthermore, judging the banding trait of the pea to be tested based on the test results includes: when the genotype test result of the SNP site is GG, the pea to be tested has the banding trait; when the genotype test result of the SNP site is TG or TT, the pea to be tested has a normal phenotype.

[0031] The beneficial effects of this application are:

[0032] (1) The present invention solves the problem of molecular marker selection for pea banding trait by accurately identifying and selecting a high-quality SNP in the gene segment associated with pea banding trait, thus filling the gap in linkage markers for this trait.

[0033] (2) The present invention provides KASP markers and KASP primers, which were validated in 265 pea materials. The results showed that the KASP markers achieved highly consistent and clearly defined population typing effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Comparison of pea plant phenotypes.

[0035] Figure 2 is the G'value and ΔSNP index results of the extreme mixed pool of zonal Figure 2 A is the QTL region associated with the G'value method. Figure 2 B Significant regions calculated using the ΔSNP index method.

[0036] Figure 3 It is the base variation type at 16,601,390 bp on chromosome 4 of the pea genome.

[0037] Figure 4 It is the KASP genotyping result of the striped F2 population; blue is the genotype of the male parent JI0814 (striped phenotype; nucleotide is G), green is the heterozygous genotype, and orange is the genotype of the female parent (normal phenotype; nucleotide is T). Detailed implementation manners

[0038] In the detailed implementation manners, the pea sample to be tested (DNA) can be taken from any one of leaves, roots, stems, flowers, fruits and seeds of a pea plant. In the following embodiments, the DNA is extracted from the leaves of the pea plant, but it is not intended to limit the protection scope of the present invention. The PCR reagents, reaction systems, platform devices and amplification detection procedures used in the following embodiments are the preferred solutions of the present invention. Other similar reasonable domestic or imported reagents, equipment platforms, reaction systems and amplification procedures can also achieve the same detection purpose and are not intended to limit the protection scope of the present invention.

[0039] To better understand the present invention, the following embodiments are used to further specifically elaborate the present invention, but it cannot be understood as a limitation to the present invention. For some non-essential improvements and adjustments made by those skilled in the art according to the above invention content, they are also regarded as falling within the protection scope of the present invention.

[0040] In the embodiments, unless otherwise specified, the test methods used are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0041] Example 1 Construction of the striped F2 population of peas

[0042] Both the male and female parents were selected from 697 pea core germplasm resources with rich variations introduced by the research group from the John Innes Centre (JIC) in the UK in the early stage. The male parent JI0814 was selected, showing a striped phenotype; the female parent Caméor was selected, showing a normal phenotype.

[0043] In June 2022, 20 - 40 flowers were hybridized respectively on the farm of the Shenzhen Institute of Agricultural Genomics. After harvesting in August of the same year, the F1 was planted in the greenhouse of the Shenzhen Institute of Agricultural Genomics for generation acceleration to obtain F2 seeds. In December of the same year, the F2 was planted on the farm of the Shenzhen Institute of Agricultural Genomics, and DNA sampling and phenotype investigation were carried out in February of the following year.

[0044] During the experiment, according to the actual situation of local field production, field management work such as fertilization, irrigation, and weeding was carried out.

[0045] Phenotype and Genotype of the F2 Segregation Population of Pea Banding in Example 2

[0046] The male parent and the female parent were crossed to obtain the F1 generation, and the F1 generation was self-crossed to produce the F2 generation population, with a total of 265 individual plants. The F2 population was planted on the farm of Shenzhen Agricultural Genomics Institute to observe the segregation of the offspring and measure the phenotypic data.

[0047] Through the phenotypic investigation of the constructed F2 population (Table 1), we identified 212 individual plants with normal phenotypes and 53 individual plants with banding phenotypes. Subsequently, a chi-square test analysis was performed, and the results showed that the segregation of the F2 population conformed to the Mendelian genetic law segregation ratio of 3:1 (χ 2 = 3.53 < χ 2 0.05 , 2 = 3.84). Based on the above analysis, it can be speculated that the banding trait is controlled by a single recessive gene and shows recessive inheritance. Specifically, individuals with a banding phenotype should be of the recessive homozygous genotype (fafa), while individuals with a normal phenotype are of the dominant genotype (FaFa or Fafa).

[0048] Table 1 Segregation Ratio of the F2 Population of Pea Banding

[0049]

[0050] Example 3 Gene Mapping of Pea Banding

[0051] 1. Primary Mapping

[0052] Using genome-wide association analysis to identify the locus controlling the banding trait in the natural population, a distinct signal was found at the front end of chromosome 4. Through GWAS analysis, this interval was located within the range of Chr4:0MB - 40MB. However, this interval was relatively large and contained many genes. Therefore, in this study, the F2 population was constructed using the female parent Caméor and the male parent JI0814. By analyzing the distribution of the G' value and ΔSNP index value between the pooled samples across the whole genome, the results were as Figure 2 shown. The genomic region located at approximately 20.24 Mb (7347 bp - 20245297 bp) at the front end of chromosome 4 was significantly associated with the pea banding locus.

[0053] 2. Fine Mapping

[0054] For the genomic DNA of the obtained F2 individuals, the individuals in the F2 population were genotyped based on the KASP genotyping technology to obtain the genotype data of the F2 population. Excel and Spss were used to organize and perform significance analysis on the obtained genotype data. Structure 2.3.4 and Powermaker 3.25 were used to perform genetic structure and genetic diversity analysis on the genotype data.

[0055] Since there were obvious differences in the banding traits between the male and female parents (the male parent was banded and the female parent was normal), the traits of the F2 individuals were analyzed, and the banding gene Fa derived from the male parent was mapped on the genetic map according to the linkage relationship between the traits and molecular markers.

[0056] Specifically, based on the obtained phenotypic data of the F2 population, combined with the population genotype and genetic linkage map, markers were designed on both sides of the interval, and the single exchange plants were screened. Finally, the interval of the banding gene was locked between Chr4:16601390 and Chr4:19945776, with a length of approximately 3.3 Mb.

[0057] Using JI0814 as a control with the known banding genotype (fafa) and Caméor as a control with the known normal phenotype (FaFa), SNP loci tightly linked to the banding trait were successfully screened in the target region using whole-genome resequencing data. It was located at 16601390 bp on chromosome 4 of the pea genome, and the software IGV (Version 2.16.1) was used to visualize the base variation type, and it was found that this locus was a variation from base T to base G (as Figure 2 shown). When the pea had a normal phenotype, the nucleotide at position 16601390 on chromosome 4 was T or heterozygous; when the pea had a banded phenotype, the nucleotide at position 16601390 on chromosome 4 was G.

[0058] To further verify the stability and accuracy of the above locus, the germplasm resources with banded and normal phenotypes were sequenced and analyzed. The results were as Figure 3 shown. In the peas with a normal phenotype, the nucleotide at position 16601390 on chromosome 4 was T; in the peas with a banded phenotype, the nucleotide at this locus was G.

[0059] Example 4 Development of KASP Markers

[0060] 1. KASP Primer Design and Genotyping Detection Method of KASP Technology

[0061] This example provides a method for detecting the banding trait of peas. Based on the KASP technology, SNP loci of the pea material to be tested are genotyped, which specifically includes the following steps:

[0062] (1) Use the IGV (v2.16.1) software to view the BAM files of the striping BSA parents (JI0814, Caméor), and select the markers (Fa5) with better quality in the corresponding section as candidates.

[0063] (2) Extract the gene sequences upstream and downstream of the differential sites, and use the SnapGene (v6.0.2) software to design primers. Note that the tail end of the forward primer should be the SNP site that differentiates the two parents.

[0064] (3) Add the FAM tag sequence (gaaggtgaccaagttcatgct) and the HEX tag sequence (gaaggtcggagtcaacggatt) in front of the forward primer respectively.

[0065] (4) The KASP primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific primer information is shown in Table 2.

[0066] Table 2 KASP primer sequences

[0067]

[0068] (5) Dissolve 100 μL of sterile water in every 5 nM of primers.

[0069] (6) Prepare the primer mixture (Assay mix). Take 12 μL of the JI0814 forward primer and 12 μL of the Caméor forward primer, and 30 μL of the common reverse primer, and add 46 μL of sterile water.

[0070] The KASP experiment is carried out according to the steps provided by LGC Genomics. Taking a 5 μl reaction system as an example, the specific KASP reaction system is shown in Table 3, and the reaction program is shown in Table 4. Among them, Template DNA is the DNA extracted from the leaves of the pea material to be tested.

[0071] Table 3 Configuration of KASP reaction system

[0072]

[0073] The experiment is carried out using a 384-well PCR plate (Axygen), and the PCR reaction program is shown in Table 4.

[0074] Table 4 PCR reaction program

[0075]

[0076]

[0077] 2. Preparation of the kit

[0078] This embodiment applies the above SNP-site primers to the preparation of a kit. The kit includes a primer mixture (Assay mix). Among them, the primer mixture is composed of three primers designed based on the SNP sites provided by the present invention, corresponding to SEQ ID NO: 1 to SEQ ID NO: 3 respectively. In the kit, the three primers should be separately packaged independently and packaged together as a unit.

[0079] Example 5 Verification of KASP Markers

[0080] Based on the SNP sites provided in Example 3, this embodiment uses the kit provided in Example 4 to carry out the verification work of KASP markers.

[0081] The 265 varieties to be tested are the above-mentioned F2 population. According to the KASP technology genotyping detection method provided in Example 4, a reaction is carried out. After the reaction is completed, the Bio-Rad CFX Maestro 1.1 (v4.1) running program is used to read the fluorescence signal to obtain the genotyping results ( Figure 1 ). The genotype data is sorted by importing it into Excel, and a genetic map is drawn.

[0082] A total of 265 striped F2 populations were scanned. Among them, 135 heterozygous genotypes TG (showing a normal phenotype), 77 dominant homozygous genotypes TT (showing a normal phenotype), and 53 recessive homozygous genotypes GG (showing a striped phenotype) were identified. By genotyping the striped F2 population and combining the phenotypic data obtained from field surveys, it shows that all KASP genotype identification results are consistent with the phenotypic identification results. The results show that this marker can accurately identify the genotypes of the striped population.

[0083] The results are as Figure 4 shown. The blue square is the genotype of the male parent JI0814, whose phenotype is striped, and the nucleotide at the SNP site is GG; the green triangle is the heterozygous genotype, whose phenotype is normal, and the nucleotide at the SNP site is TG; the orange circle is the genotype of the female parent, whose phenotype is normal, and the nucleotide at the SNP site is TT.

[0084] The above results show that the KASP markers provided in Example 3 have obtained a highly consistent and clearly defined population genotyping effect.

[0085] The above is a further detailed description of the present invention, and it cannot be regarded as a limitation on the specific implementation of the present invention. For those of ordinary skill in the technical field to which the present invention belongs, any simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. A SNP locus, characterized in that, The SNP locus is located at the 16,601,390th nucleotide site on chromosome 4 of the pea genome (CAAS_Psat_ZW6_1.0), and its base is G or T.

2. A KASP primer set, characterized in that, The primer set includes the sequences shown in SEQ ID NO.1 - SEQ ID NO.

3.

3. A kit, characterized in that, The kit includes the primer set described in claim 2.

4. Use of the SNP locus described in claim 1, or the primer set described in claim 2, or the kit described in claim 3 in any one of the following (A1)-(A5): (A1) Use in detecting or assisting in detecting the banding trait of peas; (A2) Use in preparing a product for detecting or assisting in detecting the banding trait of peas; (A3) Use in breeding for the banding trait of peas; (A4) Use in identifying and protecting pea germplasm resources and new varieties; (A5) Use in improving and innovating pea germplasm resources.

5. The application according to claim 4, characterized in that, Carried out by any one of the following (B1)-(B3) technical means: (B1) Detecting the polymorphism or genotype of the SNP locus described in claim 1; the detection methods include one or more of matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS), liquid chromatography, whole-genome resequencing, targeted sequencing, and multiplex PCR sequencing; (B2) Developing PCR markers using the sequence information of the SNP locus described in claim 1, and the PCR markers include one or more of PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, and HRM markers; (B3) Using the SNP locus described in claim 1 to carry out molecular operations to achieve molecular breeding improvement and germplasm resource innovation of the banding trait of peas, and the molecular operations include gene editing or genetic transformation.

6. A method for detecting the pea zonation trait, characterized in that, Including: Detecting the nucleotide of the SNP locus of the pea to be tested, and judging the banding trait of the pea to be tested according to the detection result.

7. The method according to claim 6, wherein Including: Using the primer set described in claim 2, and / or using the kit described in claim 3 to detect the pea to be tested.

8. The method according to claim 6 or 7, characterized in that, Including the following steps: (1) Extracting the DNA of the pea to be tested; (2) Using the above DNA as a template, and using the primer set described in claim 2, and / or the kit described in claim 3 for PCR amplification; (3) Judging the trait of the pea to be tested according to the amplification detection result.

9. The method according to any one of claims 6 - 8, characterized in that, Judging the banding trait of the pea to be tested according to the detection result includes: when the genotype detection result of the SNP locus is GG, the pea to be tested has the banding trait; when the genotype detection result of the SNP locus is TG or TT, the pea to be tested has a normal phenotype.

Images