Nucleic acid detection product, system containing nucleic acid detection product, kit and method for detecting Zika virus

Abstract

The invention discloses a nucleic acid detection product, a system containing the nucleic acid detection product, a kit and a method for detecting Zika virus. The system comprises Tris, potassium acetate, DTT, polyethylene glycol 20000, deoxyribonucleoside triphosphate (dNTP), adenosine triphosphate (ATP), phosphocreatine, creatine kinase, Bsu, gp32, uvs X, uvs Y, Superscript IV Reverse Transcriptase, a primer pair, LbCas12a, a crRNA sequence, RNase H and magnesium acetate, and an RPA / CRISPR one-pot reaction can be realized, and detection is carried out through an electrochemical method. The system or the kit containing the system can realize rapid diagnosis of the Zika virus in different scenes, is simple and convenient in operation method and low in cost, has relatively high sensitivity and specificity, and is suitable for being applied to airports, disease control units and other grassroots units.

Description

Technical Field

[0001] This application relates to the technical field of microbial detection, and particularly to nucleic acid detection products, systems containing the same, kits, and methods for detecting Zika virus. Background Art

[0002] Zika virus is a flavivirus pathogen transmitted by Aedes mosquitoes, and its potential association with birth defects and neurological complications. The transmission routes of this virus include mother-to-child transmission, which causes birth defects in newborns. Therefore, early and rapid diagnosis is crucial for identifying infected individuals and controlling the spread of the disease.

[0003] Electrochemical nucleic acid detection technology is a technology that applies electrochemical sensing principles to nucleic acid analysis, and is a new method that can be used for nucleic acid sequence detection and quantitative analysis. By detecting changes in current, potential, and resistance, the detection results are converted into electrochemical signals for output, which has significant advantages of high sensitivity, high specificity, ultra-fast speed, and low cost. Currently, electrochemical nucleic acid diagnosis has been applied to disease diagnosis, gene mutation analysis, environmental detection, and food safety.

[0004] The gold standard for nucleic acid detection is qPCR (quantitative Polymerase Chain Reaction) technology, also known as real-time quantitative PCR. qPCR is a nucleic acid amplification technology used for quantitatively measuring DNA or RNA. qPCR combines the functions of PCR amplification and simultaneous quantitative analysis, and realizes quantitative analysis of the target nucleic acid sequence by measuring the accumulation of PCR products during the amplification process. qPCR is widely used in fields such as diagnosis, drug development, and basic research due to its high sensitivity and high specificity. However, this technology has many limitations. For example, it requires a professional laboratory site with strict zoning in the laboratory to avoid contamination; it requires technically trained personnel to operate; it requires expensive equipment, etc. Therefore, its flexibility in use is limited and it cannot meet the applications in different scenarios.

[0005] Traditional pathogen diagnosis techniques such as lateral flow immunoassay chromatography are widely used rapid detection techniques. Lateral flow immunoassay chromatography is based on antigen-antibody immune reactions. By binding colloidal gold to antibodies or antigens, stable markers are formed, and color changes can be detected visually after binding to biomolecules. Samples are chromatographically migrated on test strips and react with antibodies immobilized in different regions of the test strips during this process, forming colored visible bands for result judgment. It has the characteristics of rapidity, portability, simple operation, and low cost, and is widely used in pregnancy testing, food safety detection, medical diagnosis, etc. The limitations of this technique at least include relatively low detection sensitivity and a relatively high possibility of false negatives; there is a risk of false positives, and it is vulnerable to interference by substances in the sample or factors such as non-specific binding, resulting in false positives. Therefore, lateral flow immunoassay chromatography has certain limitations in detection sensitivity and accuracy.

[0006] In summary, there is an urgent need in this field to develop new and rapid methods for detecting Zika virus. Summary of the Invention

[0007] Based on this, it is necessary to provide at least one nucleic acid detection product, a kit containing the same, and a method for detecting Zika virus.

[0008] In the first aspect of the present application, a one-pot RT-RPA / CRISPR system is provided, which comprises: 40 mM - 60 mM Tris, 90 mM - 110 mM potassium acetate, 1 mM - 3 mM dithiothreitol (DTT), 4% w / v - 6% w / v polyethylene glycol 20000, 100 μM - 300 μM deoxynucleoside triphosphate (dNTP), 2 mM - 5 mM adenosine triphosphate (ATP), 40 mM - 60 mM creatine phosphate, 80 ng / μL - 120 ng / μL creatine kinase, 20 ng / μL - 50 ng / μL Bsu, 200 ng / μL - 300 ng / μL gp32, 100 ng / μL - 150 ng / μL uvs X, 20 ng / μL - 40 ng / μL uvs Y, and 0.2 μL - 0.5 μL Superscript IV Reverse Transcriptase, 200 nM - 400 nM primers, 20 nM - 100 nM LbCas12a, 50 nM - 150 nM crRNA, 0.2 μL - 0.5 μL RNase H, and 14 mM - 30 mM magnesium acetate;

[0009] Among them, the sequences of the primers are as shown in SEQ ID NO: 1 or SEQ ID NO: 5;

[0010] The sequence of the crRNA is shown in SEQ ID NO: 6.

[0011] In the second aspect of the present application, a system for electrochemical detection of Zika virus based on RPA / CRISPR is provided, which comprises the RT-RPA / CRISPR system described in the first aspect; and a gold nanoparticle modified electrode.

[0012] In the third aspect of the present application, a nucleic acid detection product is provided, which comprises one or more of the following 1) and 2): 1) crRNA with a nucleic acid sequence shown in SEQ ID NO: 6; and 2) a primer set.

[0013] Wherein, the sequences of the primers in the primer set are shown in SEQ ID NO: 1 and SEQ ID NO: 5.

[0014] In the fourth aspect of the present application, a kit for detecting Zika virus is provided, which comprises one or more of the RT-RPA / CRISPR system described in the first aspect, the system described in the second aspect, and the nucleic acid detection product described in the third aspect.

[0015] In the fifth aspect of the present application, a method for detecting Zika virus for non-disease diagnosis purposes is provided, which includes using the RT-RPA / CRISPR system described in the first aspect, the system described in the second aspect, the nucleic acid detection product described in the third aspect, or the kit described in the fourth aspect to detect a sample.

[0016] The detection method in an embodiment of the present application can achieve rapid diagnosis of Zika virus in different scenarios, with a simple operation method, low cost, high sensitivity and specificity, and is suitable for application in grass-roots units such as airports and disease control centers. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments and implementation manners of the present application and to more completely understand the present application and its beneficial effects, the accompanying drawings required for use in the description of the embodiments or implementation manners will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative efforts. It should also be noted that the drawings are all drawn in a simplified form and are only used for conveniently and clearly assisting in the description of the present application.

[0018] Figure 1 It is a curve after amplification using different primer pairs in an embodiment of the present application.

[0019] [[ID=3), Figure 2 It is a schematic diagram of the results of screening different crRNAs in an embodiment of the present application.

[0020] Figure 3 Performance comparison between the electrode modified with gold nanoparticles and the ordinary gold electrode in an embodiment of the present application.

[0021] Figure 4A and Figure 4B Detection ability comparison between the ordinary gold electrode ( Figure 4A ) and the electrode modified with gold nanoparticles in an embodiment of the present application ( Figure 4B ).

[0022] Figure 5 Amplification and detection effect comparison between the optimized one-pot system and the conventional two-step system in an embodiment of the present application.

[0023] Figure 6 Electrochemical signal changes of different concentration samples in an embodiment of the present application; in the figure, the samples from left to right are 100 copies / mL, 200 copies / mL, 400 copies / mL, 800 copies / mL, 1×10 3 copies / mL, 5×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 copies / mL, 1×10 6 copies / mL.

[0024] Figure 7 Current curve of the electrochemical sensor in response to different concentration samples in an embodiment of the present application.

[0025] Figure 8 Linear relationship between the electrochemical signal change and the logarithm of the test sample concentration in an embodiment of the present application.

[0026] Figure 9 Electrochemical signal changes of different samples in an embodiment of the present application.

[0027] Figure 10 Current display of samples generated by probes of different lengths in an embodiment of the present application. Detailed implementation mode

[0028] To facilitate the understanding of the present application, the present application will be described more comprehensively below with reference to the relevant drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs. The terms used in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0030] In this application, unless otherwise stated, "one or more" means any one of the listed items or any combination of the listed items. Similarly, in other cases where "one or more" and other expressions indicate "one or more", unless otherwise stated, the same understanding shall apply.

[0031] As used in this application, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or more of the listed items.

[0032] In this application, "suitable combination mode", "suitable mode", "any suitable mode", etc., the "suitable" shall be based on being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0033] In this application, terms such as "further", "even further", "especially", "for example", "such as", "example", "exemplification", etc. are used for descriptive purposes, indicating that there is an association in the covered content between the different technical solutions before and after, but should not be understood as a limitation on the previous technical solution, nor as a limitation on the protection scope of this application. In this application, unless otherwise stated, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0034] In this application, "optionally", "optional", "option", mean having or not having, that is, either of the two parallel options of "having" or "not having". If "optional" appears multiple times in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction relationship, each "optional" is independent. Unless otherwise stated, descriptions such as "optionally include" and "optionally contain" in this application, taking "optionally include" as an example, mean "may include or may not include".

[0035] The terms "contain", "include" and "comprise" used in this application are synonyms, which are inclusive or open-ended and do not exclude additional, unrecited members or features. Members or features such as materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features also include actions, conditions for the occurrence of actions, timing, states, etc.

[0036] In this application, in the technical features or technical solutions described in an open language, it includes the closed technical features or technical solutions composed of the listed content, and also includes the open technical features or technical solutions containing the listed content.

[0037] In this application, the exemplary descriptions such as "in some embodiments" or "in one embodiment" can cover, but are not limited to, the following meanings: These solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0038] In this application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0039] In this application, regarding the numerical interval (i.e., numerical range), unless otherwise specifically stated, the distribution of the optional numerical values within this numerical interval is considered continuous and includes the two numerical endpoints of this numerical interval (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specifically stated, when the numerical interval only refers to the integers within this numerical interval, it includes the two endpoint integers of this numerical range, as well as each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be combined. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein. The "numerical value" in this numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. The "numerical interval" allows for a broad inclusion of numerical interval types such as percentage intervals, ratio intervals, and ratio value intervals.

[0040] In this application, when there are multiple steps involved in the method flow, unless there are clear different descriptions in this article, the execution of these steps has no strict order limit, and they can be executed in an order other than the described one. Moreover, any one step can include multiple sub-steps or multiple stages. These sub-steps or stages do not necessarily need to be completed at the same moment, but can be executed at different moments, and their execution order does not necessarily need to be sequential, but can be executed alternately or simultaneously with other steps or a part of the sub-steps or stages of other steps.

[0041] This application relates to an RT-RPA / CRISPR one-pot system (hereinafter also referred to as the "RPA / CRISPR one-pot system" for short), which is used to detect Zika virus target molecules. Using the Zika virus E gene as the detection target, after optimizing the reaction temperature, primer and crRNA sequences, concentrations, enzyme concentration, Buffer, etc., a one-pot system is obtained. And the reaction system can also be freeze-dried in advance to obtain reaction freeze-dried balls for subsequent detection.

[0042] One aspect of this application provides an RT-RPA / CRISPR system, which comprises: primers with sequences as shown in SEQ ID NO: 1 or SEQ ID NO: 5 and a crRNA with a sequence as shown in SEQ ID NO: 6.

[0043] Unless otherwise specified, in this application, "RT" in "RT-RPA / CRISPR" represents "reverse transcription", "RPA" represents "isothermal amplification", and "CRISPR" represents "CRISPR-Cas system". Without wishing to be bound by any theory, it is believed that the RT-RPA / CRISPR system combines reverse transcription recombinase polymerase amplification (RT-RPA) and the CRISPR-Cas system. First, the target RNA / DNA is rapidly amplified at a constant temperature by RT-RPA, and then the guide RNA (gRNA) of CRISPR-Cas12a / Cas13a specifically recognizes the amplification product, triggering the collateral cleavage activity of the Cas protein to degrade the fluorescently labeled reporter molecule, and nucleic acid detection is achieved through fluorescence or lateral flow chromatography signals.

[0044] Through the creative design of the inventor and the screening of different primer pairs and crRNAs, the primer pair with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 5 and the crRNA with a sequence as shown in SEQ ID NO: 6 finally obtained for the RT-RPA / CRISPR system have at least advantages such as high sensitivity and high specificity.

[0045] In some embodiments, the RT-RPA / CRISPR system comprises: Tris, potassium acetate, DTT, polyethylene glycol with an average molecular weight of 18 kDa - 22 kDa, deoxynucleoside triphosphate (dNTP), adenosine triphosphate (ATP), creatine phosphate, creatine kinase, Bsu, gp32, uvs X, uvs Y, Superscript IV Reverse Transcriptase, primer pair, LbCas12a, crRNA, RNase H and magnesium acetate.

[0046] Dithiothreitol (DTT) is a small molecule reducing agent. Without being bound by any theory, it is believed to have at least the following functions in the RT-RPA / CRISPR system:

[0047] Maintaining enzyme activity (especially recombinase and Cas protein), stabilizing nucleic acid structure, inhibiting the contamination of nucleases (such as RNase), and optimizing the trans-cleavage activity of the CRISPR system, etc. Exemplarily, in this RT-RPA / CRISPR system, the concentration of DTT can be 1 mM to 3 mM, such as 1 mM, 2 mM, 3 mM, or the range or value between any two values. In some embodiments, the concentration of DTT can be 1.5 mM to 2.5 mM.

[0048] Without being bound by any theory, it is believed that potassium acetate, polyethylene glycol, and tris(hydroxymethyl)aminomethane (Tris), etc., as buffer components in the RT-RPA / CRISPR system, each play roles including but not limited to pH buffering, ion balance, enzyme activity regulation, stabilizing protein structure, etc.

[0049] In some embodiments, in this RT-RPA / CRISPR system, the concentration of potassium acetate is 90 mM to 110 mM. Exemplarily, 90 mM, 100 mM, 110 mM, or the range or value between any two values.

[0050] In some embodiments, in this RT-RPA / CRISPR system, the concentration of Tris is 40 mM to 60 mM. Exemplarily, for example, 40 mM, 50 mM, 60 mM, or the range or value between any two values.

[0051] In some embodiments, in this RT-RPA / CRISPR system, the concentration of polyethylene glycol 20000 is 4% w / v to 6% w / v; for example, 4% w / v, 5% w / v, 6% w / v, or the range or value between any two values.

[0052] In some embodiments, in this RT-RPA / CRISPR system, the concentration of deoxynucleoside triphosphate (dNTP) is 100 μM to 300 μM. Exemplarily, for example, 100 μM, 150 μM, 200 μM, 250 μM, 300 μM, or the range or value between any two values. In some embodiments, the concentration of dNTP is 150 μM to 250 μM.

[0053] In some embodiments, in the RT-RPA / CRISPR system, the concentration of adenosine triphosphate (ATP) is 2 mM to 5 mM. Exemplarily, for example, it is 2 mM, 3 mM, 4 mM, 5 mM, or the range or value between any two values. In some embodiments, the concentration of ATP is 2.5 mM to 4 mM.

[0054] In some embodiments, in the RT-RPA / CRISPR system, the concentration of creatine phosphate is 40 mM to 60 mM. Exemplarily, for example, it is 40 mM, 45 mM, 50 mM, 55 mM, 60 mM, or the range or value between any two values. In some embodiments, the concentration of creatine phosphate is 45 mM to 55 mM.

[0055] In some embodiments, in the RT-RPA / CRISPR system, the concentration of creatine kinase is 80 ng / μL to 120 ng / μL. Exemplarily, for example, it is 80 ng / μL, 90 ng / μL, 100 ng / μL, 110 ng / μL, 120 ng / μL, or the range or value between any two values. In some embodiments, the concentration of creatine kinase is 90 ng / μL to 110 ng / μL.

[0056] In this application, unless otherwise specified, "Bsu" is the abbreviation of Bacillus subtilis DNA polymerase. In some embodiments, in the RT-RPA / CRISPR system, the concentration of Bsu is 20 ng / μL to 50 ng / μL. Exemplarily, for example, it is 20 ng / μL, 30 ng / μL, 40 ng / μL, 50 ng / μL, or the range or value between any two values. In some embodiments, the concentration of Bsu is 40 ng / μL to 50 ng / μL.

[0057] In some embodiments, in the RT-RPA / CRISPR system, the concentration of gp32 is 200 ng / μL to 300 ng / μL. Exemplarily, for example, it is 200 ng / μL, 210 ng / μL, 220 ng / μL, 230 ng / μL, 240 ng / μL, 250 ng / μL, 260 ng / μL, 270 ng / μL, 280 ng / μL, 290 ng / μL, 300 ng / μL, or the range or value between any two values. In some embodiments, the concentration of gp32 is 225 ng / μL to 275 ng / μL.

[0058] In some embodiments, in the RT-RPA / CRISPR system, the concentration of uvs X is 100 ng / μL to 150 ng / μL. Exemplarily, for example, it is 100 ng / μL, 105 ng / μL, 110 ng / μL, 115 ng / μL, 120 ng / μL, 125 ng / μL, 130 ng / μL, 135 ng / μL, 140 ng / μL, 145 ng / μL, 150 ng / μL, or the range or value between any two values. In some embodiments, the concentration of uvs X is 100 ng / μL to 120 ng / μL.

[0059] In some embodiments, in the RT-RPA / CRISPR system, the concentration of uvs Y is 20 ng / μL to 40 ng / μL. Exemplarily, for example, it is 20 ng / μL, 25 ng / μL, 30 ng / μL, 35 ng / μL, 40 ng / μL, or the range or value between any two values. In some embodiments, the concentration of uvs Y is 20 ng / μL to 30 ng / μL.

[0060] In some embodiments, in the RT-RPA / CRISPR system, the dosage of Superscript IV ReverseTranscriptase is 0.2 μL to 0.5 μL. Exemplarily, for example, it is 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, or the range or value between any two values. In some embodiments, the dosage of Superscript IV ReverseTranscriptase is 0.4 μL to 0.5 μL.

[0061] In some embodiments, in the RT-RPA / CRISPR system, the concentration of the primer is 200 nM to 400 nM. Exemplarily, for example, it is 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, or the range or value between any two values. In some embodiments, the concentration of the primer is 200 nM to 300 nM.

[0062] In some embodiments, in the RT-RPA / CRISPR system, the concentration of LbCas12a is 20 nM to 100 nM. Exemplarily, for example, it is 20 nM, 30 nM, 40 nM, 50 nM, �0 nM, 70 nM, 80 nM, 90 nM, 100 nM, or the range or value between any two values. In some embodiments, the concentration of LbCas12a is 90 nM to 100 nM.

[0063] In some embodiments, in the RT-RPA / CRISPR system, the concentration of crRNA is 50 nM to 150 nM. Exemplarily, for example, it is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM, 130 nM, 140 nM, 150 nM, or a range or value between any two values. In some embodiments, the concentration of crRNA is 50 nM to 70 nM.

[0064] In some embodiments, in the RT-RPA / CRISPR system, the dosage of RNase H is 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, or a range or value between any two values.

[0065] In some embodiments, in the RT-RPA / CRISPR system, the concentration of magnesium acetate is 14 mM to 30 mM. Exemplarily, for example, it is 14 mM, 16 mM, 18 mM, 20 mM, 22 mM, 24 mM, 26 mM, 28 mM, 30 mM, or a range or value between any two values. In some embodiments, the concentration of magnesium acetate is 14 mM to 16 mM.

[0066] In some embodiments, the RT-RPA / CRISPR system comprises 40 mM to 60 mM tris(hydroxymethyl)aminomethane (Tris), 90 mM to 110 mM potassium acetate, 1 mM to 3 mM dithiothreitol (DTT), 4% w / v to 6% w / v polyethylene glycol 20000, 100 μM to 300 μM dNTP, 2 mM to 5 mM ATP, 40 mM to 60 mM creatine phosphate, 80 ng / μL to 120 ng / μL creatine kinase, 20 ng / μL to 50 ng / μL Bsu, 200 ng / μL to 300 ng / μL gp32, 100 ng / μL to 150 ng / μL uvs X, 20 ng / μL to 40 ng / μL uvs Y, and 0.2 μL to 0.5 μL Superscript IV Reverse Transcriptase, 200 nM to 400 nM primer, 20 nM to 100 nM LbCas12a, 50 nM to 150 nM crRNA, 0.2 μL to 0.5 μL RNaseH, and 14 mM to 30 mM magnesium acetate;

[0067] Among them, the sequence of the primer is as shown in SEQ ID NO: 1 or SEQ ID NO: 5;

[0068] The sequence of the crRNA is shown in SEQ ID NO: 6.

[0069] In some embodiments, the RT-RPA / CRISPR system comprises: 50 mM Tris, 100 mM potassium acetate, 2 mM DTT, 5% polyethylene glycol 20000, 200 μM dNTP, 3 mM ATP, 50 mM phosphocreatine, 100 ng / μL creatine kinase, 50 ng / μL Bsu, 250 ng / μL gp32, 100 ng / μL uvs X, 20 ng / μL uvs Y, 0.5 μL Superscript IV Reverse Transcriptase, 200 nM primer, 100 nM LbCas12a; 50 nM crRNA, 0.5 μL RNase H, and 14 mM magnesium acetate.

[0070] Another aspect of the present application provides a system for electrochemically detecting Zika virus based on RPA / CRISPR, which comprises the RT-RPA / CRISPR system as described above; and a gold nanoparticle-modified electrode.

[0071] By immobilizing the probe on the electrode surface and placing the RPA-CRISPR one-pot system on the working electrode for reaction, if there is a target molecule in the system, a large number of target molecules are generated after RPA amplification, thereby activating the collateral cleavage activity of the Cas enzyme in the CRISPR system and cleaving the probe immobilized on the electrode surface, causing a change in potential. If there is no target molecule, no potential change occurs. Signal determination can be performed by cyclic voltammetry, square wave voltammetry, or differential pulse voltammetry.

[0072] In some embodiments, the method for preparing the gold nanoparticle-modified electrode comprises:

[0073] Dropwise add chloroauric acid solution on the electrode surface and electrochemically deposit gold nanoparticles on the electrode surface.

[0074] Exemplarily, 10 μL to 100 μL of 2 mM to 50 mM chloroauric acid solution is dropwise added on the electrode surface and gold nanoparticles are electrochemically deposited on the electrode surface.

[0075] Electrodeposition can be achieved by conventional technical means in the art. Exemplarily, cyclic voltammetry or chronoamperometry is selected by an electrochemical workstation to achieve electrodeposition.

[0076] In some embodiments, cyclic voltammetry is selected by an electrochemical workstation to achieve electrodeposition. Exemplarily, in cyclic voltammetry, the low voltage is -0.8 V to -0.2 V, the highest voltage is 0 V, and the number of cycles is 2 to 20.

[0077] In some embodiments, the number of cycles is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0078] In some embodiments, chronoamperometry is used to achieve electrodeposition. Exemplarily, the voltage is -0.8V to -0.1V and the duration is 30s to 300s.

[0079] In some embodiments, the voltage in chronoamperometry is -0.8V, -0.7V, -0.6V, -0.5V, -0.4V, -0.3V, -0.2V, or -0.1V.

[0080] In some embodiments, the duration in chronoamperometry is 30s, 40s, 50s, 60s, 70s, 80s, 90s, 100s, 110s, 120s, 130s, 140s, 150s, 160s, 170s, 180s, 190s, 200s, 210s, 220s, 230s, 240s, 250s, 260s, 270s, 280s, 290s, 300s, or a range or value between any two values. In some embodiments, the voltage in chronoamperometry is -0.2V and the duration is 100s.

[0081] In some embodiments, a carbon electrode is used for the working electrode and the counter electrode, and a silver chloride electrode is used for the reference electrode.

[0082] Without wishing to be bound by any theory, it has been found that after surface modification of the counter electrode, its response ability is improved, and gold nanoparticles significantly enhance the electron output ability and specific surface area.

[0083] In some embodiments, the above preparation method further includes the design and fixation of the probe.

[0084] In some embodiments, the surface of the gold nanoparticle modified electrode is modified with a probe.

[0085] Without wishing to be bound by any theory, it is believed that when a probe with a modification group is fixed on the electrode surface, if there is a product sequence complementary to crRNA in the CRISPR-Cas system, the collateral activity of the Cas enzyme will be activated, cutting the probe and causing a potential change.

[0086] Exemplarily, one or more of methylene blue (MB) and ferrocene are labeled at the 3' end of the probe, and / or a thiol group is labeled at the 5' end.

[0087] In some embodiments, the probe comprises a polyA sequence, such as a polyA sequence with a length of 15 bp to 35 bp.

[0088] In some embodiments, the length of the polyA sequence is 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, or a range or value between any two values.

[0089] In some embodiments, the length of the polyA sequence is 22 bp.

[0090] In some embodiments, a method including the following steps is used to modify the probe on the surface of the gold nanoparticle-modified electrode:

[0091] S100: Place the probe in a 25 mM to 75 mM TCEP solution or a 5 mM to 25 mM DTT solution for reduction treatment, and place the treated probe solution on the electrode surface;

[0092] S200: Let it stand for 4 hours to 10 hours at 15°C to 25°C to complete the fixation of the probe.

[0093] In some embodiments, in step S100, the concentration of the TCEP solution is 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, 50 mM, 55 mM, 60 mM, 65 mM, 70 mM, 75 mM, or a range or value between any two values.

[0094] In some embodiments, in step S100, the concentration of the DTT solution is 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, or a range or value between any two values.

[0095] In some embodiments, in step S200, the temperature for standing is 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, or a range or value between any two values.

[0096] In some embodiments, in step S200, the time for standing is 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, or a range or value between any two values.

[0097] In some embodiments, in step S200, it is left standing at 20 °C for 6 hours.

[0098] In the above RT-RPA / CRISPR system or the system for electrochemical detection of Zika virus based on RPA / CRISPR, the components contained therein can exist in a lyophilized form. Exemplarily, some of the components are mixed and then lyophilized.

[0099] In some embodiments, the RT-RPA / CRISPR system or the system for electrochemical detection of Zika virus based on RPA / CRISPR includes a lyophilized system.

[0100] In some embodiments, the lyophilized system is prepared by lyophilizing all or part of the premix.

[0101] In some embodiments, the lyophilized system includes a lyophilized part of the premix and magnesium acetate lyophilized spheres.

[0102] Exemplarily, the part of the premix includes: 40 mM - 60 mM Tris, 90 mM - 110 mM potassium acetate, 1 mM - 3 mM DTT, 4% w / v - 6% w / v polyethylene glycol 20000, 100 μM - 300 μM dNTP, 2 mM - 5 mM ATP, 40 mM - 60 mM phosphocreatine, 80 ng / μL - 120 ng / μL creatine kinase, 20 ng / μL - 50 ng / μL Bsu, 200 ng / μL - 300 ng / μL gp32, 100 ng / μL - 150 ng / μL uvs X, 20 ng / μL - 40 ng / μL uvs Y, and 0.2 μL - 0.5 μL Superscript IV Reverse Transcriptase, 200 nM - 400 nM primers, 20 nM - 100 nM LbCas12a, 50 nM - 150 nM crRNA, and 0.2 μL - 0.5 μL RNase H.

[0103] In some embodiments, the method for preparing the lyophilized part of the premix includes: mixing a lyoprotectant with the above part of the premix and then lyophilizing.

[0104] The lyoprotectant used can be a conventional lyoprotectant in the art.

[0105] In some embodiments, the above lyoprotectant includes trehalose, mannitol, glycine, and bovine serum albumin (BSA).

[0106] In some embodiments, the above-mentioned lyoprotectant comprises 5% w / v - 10% w / v trehalose, 5% w / v - 20% w / v mannitol, 2% w / v - 5% w / v glycine, and 2% w / v - 5% w / v BSA.

[0107] In some embodiments, the concentration of trehalose in the lyoprotectant is 5% w / v, 6% w / v, 7% w / v, 8% w / v, 9% w / v, 10% w / v, or a range or value between any two of these values.

[0108] In some embodiments, the concentration of mannitol in the lyoprotectant is 5% w / v, 10% w / v, 15% w / v, 20% w / v, or a range or value between any two of these values.

[0109] In some embodiments, the concentration of glycine in the lyoprotectant is 2% w / v, 2.5% w / v, 3% w / v, 3.5% w / v, 4% w / v, 4.5% w / v, 5% w / v, or a range or value between any two of these values.

[0110] In some embodiments, the concentration of BSA in the lyoprotectant is 2% w / v, 2.5% w / v, 3% w / v, 3.5% w / v, 4% w / v, 4.5% w / v, 5% w / v, or a range or value between any two of these values.

[0111] In some embodiments, the lyoprotectant comprises 5% w / v trehalose, 20% w / v mannitol, 2% w / v glycine, and 2% w / v BSA.

[0112] Another aspect of the present application also provides a nucleic acid detection product, which comprises a crRNA having a nucleic acid sequence as shown in SEQ ID NO: 6; and one or more of the primer sets;

[0113] Wherein, the sequences of the primers in the primer set are as shown in SEQ ID NO: 1 and SEQ ID NO: 5.

[0114] Another aspect of the present application also provides a kit for detecting Zika virus, which comprises one or more of the above-mentioned RT-RPA / CRISPR system, the above-mentioned system, and the above-mentioned nucleic acid detection product.

[0115] Another aspect of the present application also provides the use of the RT-RPA / CRISPR system as described above, the system as described above, the nucleic acid detection product as described above, or the kit as described above in the preparation of a product for detecting Zika virus.

[0116] Another aspect of the present application also provides a method for detecting Zika virus, which includes using the RT-RPA / CRISPR system as described above, the system as described above, the nucleic acid detection product as described above, or the kit as described above to detect a sample.

[0117] It should be understood that the above method can be used for disease diagnosis or for non-disease diagnosis purposes.

[0118] Exemplarily, the method includes:

[0119] S100’: Prepare a reaction system;

[0120] S200’: Conduct the reaction; and,

[0121] S300’: Determine the result.

[0122] In some embodiments, the reaction system in step S100’ contains the following premix: 40 mM - 60 mM Tris, 90 mM - 110 mM potassium acetate, 1 mM - 3 mM DTT, 4% w / v - 6% w / v polyethylene glycol 20000, 100 μM - 300 μM dNTP, 2 mM - 5 mM ATP, 40 mM - 60 mM creatine phosphate, 80 ng / μL - 120 ng / μL creatine kinase, 20 ng / μL - 50 ng / μL Bsu, 200 ng / μL - 300 ng / μL gp32, 100 ng / μL - 150 ng / μL uvs X, 20 ng / μL - 40 ng / μL uvs Y, and 0.2 μL - 0.5 μL Superscript IV Reverse Transcriptase, 200 nM - 400 nM primer, 20 nM - 100 nM LbCas12a, 50 nM - 150 nM crRNA, 0.2 μL - 0.5 μL RNase H, and 14 mM - 30 mM magnesium acetate.

[0123] The content range or value of each component in this reaction system can be referred to the above definition.

[0124] In some embodiments, step S100’ includes: After mixing 25 μL of the sample to be tested with the freeze-dried system, drop it on the gold nanoparticle modified electrode defined in the present application for reaction.

[0125] Exemplarily, the reaction conditions include:

[0126] 38°C to 42°C, reacting for 15 min to 30 min.

[0127] Among them, the reaction temperature can be, for example, 38°C, 38.5°C, 39°C, 39.5°C, 40°C, 40.5°C, 41°C, 41.5°C, 42°C, or a value or range between any two values; the reaction time can be, for example, 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, or a value or range between any two values.

[0128] In some embodiments, step S300' includes: measuring the signal on the gold nanoparticle-modified electrode by one or more of cyclic voltammetry, square wave voltammetry, and differential pulse voltammetry.

[0129] Some examples are provided below.

[0130] The embodiments of the present application will be described in detail below in conjunction with the examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specified conditions in the following examples, the guidance given in the present application is preferably referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.

[0131] Example 1

[0132] 1) Preparation of the electrode:

[0133] The working electrode and the counter electrode use carbon electrodes, and the reference electrode uses a silver chloride electrode. 20 μL of 50 mM chloroauric acid solution is dropped on the electrode surface, and the electrochemical workstation is connected to select cyclic voltammetry (low voltage -0.8 to -0.2 V, maximum voltage 0 V, 10 cycles) or chronoamperometry (voltage between -0.2 V, duration 100 s), and gold nanoparticles are successfully modified on the surface of the working electrode by electrodeposition.

[0134] 2) Probe design and fixation:

[0135] Design a probe that includes a 15-35 bp polyA sequence, with a thiol group labeled at the 5' end and a methylene blue group or a ferrocene group or other groups labeled at the 3' end. First, the probe is placed in a TCEP or DTT solution for reduction treatment, and the treated probe solution is placed on the electrode surface. After 6 hours at 20°C, the fixation of the probe on the chip surface is completed.

[0136] 3) RT-RPA / CRISPR one-pot system:

[0137] The reaction system was pre-lyophilized to obtain reaction lyophilized beads for subsequent detection.

[0138] The system includes: 50 mM Tris, 100 mM potassium acetate, 2 mM DTT, 5% w / v PEG2W, 200 μM dNTP, 3 mM ATP, 50 mM creatine phosphate, 100 ng / μL creatine kinase, 50 ng / μL Bsu, 250 ng / μL gp32, 100 ng / μL uvs X, 20 ng / μL uvs Y and 0.5 μL Superscript IV Reverse Transcriptase, 200 nM primer, 100 nM LbCas12a; 50 nM crRNA, 0.5 μL RNase H and 14 mM magnesium acetate.

[0139] The above system was lyophilized using a cryoprotectant containing 5% w / v trehalose, 20% w / v mannitol, 2% w / v glycine and 2% w / v BSA. Among them, the magnesium acetate reagent was made into a lyophilized bead separately. 25 μL of the sample to be tested was added to the lyophilized system. After mixing, the reaction solution was dropped onto the working electrode and reacted at 40 °C for 15 min, and then detected.

[0140] Screening of primer pairs:

[0141] 2 upstream primers and 3 downstream primers were designed and amplified after matching. The results are as follows:

[0142] The combinations shown in Table 1 below were set respectively.

[0143] Table 1

[0144]

[0145] Table 2

[0146]

[0147] After preparing the reaction system, SYBR Ⅰ dye was added to the system, and the amplification curve was observed to select a better primer combination for amplification.

[0148] Prepare a 25 μL reaction system: 50 mM Tris, 100 mM potassium acetate, 2 mM DTT, 5% PEG2W, 200 μM dNTP, 3 mM ATP, 50 mM phosphocreatine, 100 ng / μL creatine kinase, 50 ng / μL Bsu, 250 ng / μL gp32, 100 ng / μL uvsX, 20 ng / μL uvsY and 0.5 μL Superscript IV Reverse Transcriptase, 200 nM primer, 0.2 μL SYBRⅠ and 5 μL sample nucleic acid, and make up the volume with an appropriate amount of ddH2O. Perform fluorescence detection in a real-time PCR instrument. After reacting at 40 °C for 15 min, read the amplification curve (see Figure 1 ). Judge the amplification performance of the primer according to the amplification curve, and finally select combination 3 as the amplification primer.

[0149] Screen the crRNA required for the subsequent CRISPR reaction, design two sequences, and the experimental procedure is as follows:

[0150] Prepare a 25 μL reaction system as follows: 50 mM Tris, 100 mM potassium acetate, 2 mM DTT, 5% PEG2W, 200 μM dNTP, 3 mM ATP, 50 mM phosphocreatine, 100 ng / μL creatine kinase, 50 ng / μL Bsu, 250 ng / μL gp32, 100 ng / μL uvs X, 20 ng / μL uvs Y and 0.5 μL Superscript IV Reverse Transcriptase, 200 nM primer, 5 μL sample nucleic acid and 14 mM magnesium acetate, and make up the volume with an appropriate amount of ddH2O. Incubate the reaction system at 40 °C for 20 min. Prepare a 25 μL CRISPR system: 100 nM LbCas12a; 50 nM crRNA, 0.5 μL RNase H, 5 μL of the above product and 200 nM single-stranded DNA reporter probe, and make up the volume with an appropriate amount of ddH2O. Place the reaction system in a real-time PCR instrument, set the reaction at 37 °C for 15 min, and observe the experimental results.

[0151] Table 3

[0152]

[0153] Since a single-stranded fluorescent reporter probe is added to the system, in the RPA-CRISPR system, if there is a target molecule, a large amount of product will be generated. This activates the collateral cleavage activity of the Cas enzyme in the CRISPR reaction to cleave the probe and release the fluorophore, and the curve can be observed by a fluorescence quantitative PCR instrument. By observing the fluorescence curve, the most efficient crRNA sequence can be judged. As shown in the results (see Figure 2 ), crRNA1 is a better crRNA.

[0154] The primer sequences and crRNA sequences that can be used for the one-pot method after optimization and screening:

[0155] F: GTTGCCCAACACAAGGTGAAGCCTACCTTGA (SEQ ID NO: 1)

[0156] R: GCTCTTCCCGGTCATCTTCTTAGAACACGTAA (SEQ ID NO: 5)

[0157] crRNA sequence: UAAUUUCUACUAAGUGUAGAUCCCAACCUCUGUCCACUAAU (SEQ ID NO: 6)

[0158] The influence of chip modification on the detection effect:

[0159] Through the method in this example, after the electrode is modified with gold nanoparticles and tested by cyclic voltammetry, its reduction peak (red) is significantly enhanced compared with that of the ordinary gold electrode (black) (see Figure 3 ), indicating that its conductivity is enhanced, the electrode surface area is increased, the current response ability is high, and the electrode detection ability is strong.

[0160] Samples of 10 2 copies / μL were measured using a chip modified with an ordinary gold electrode and gold nanoparticles, respectively. The results showed that the ΔI value of the modified chip increased significantly, indicating that its detection ability was enhanced (see Figure 4A and Figure 4B ). Taking ∆I as the judgment standard, the ∆I = I2 - I1.

[0161] Probes of different lengths were selected and fixed on the surface of the gold electrode, and the detection effects of probes with different lengths were preliminarily detected. PolyA sequences with lengths of 15bp, 22bp, and 35bp were synthesized respectively, and the probes were fixed on the chip surface according to the above conditions. Samples with concentrations of 1×10 4 copies / mL and 1×10 5 copies / mL were used for detection. The results are shown in Figure 10:Electrodes modified with probes of three lengths can all cause changes in the current response of the sample. By comparison, the current response effect of the 22bp-length probe is better and its detection ability is optimal.

[0162] One-pot system preparation:

[0163] The present invention relates to an RT-RPA / CRISPR one-pot system for detecting Zika virus target molecules. Using the Zika virus E gene as the detection target, corresponding primers and crRNAs were designed. After optimizing the reaction temperature, primer and crRNA concentrations, enzyme concentration, buffer, etc., the optimal one-pot system was obtained. Buffer system: 50 mM Tris, 100 mM potassium acetate, 2 mM DTT, 5% PEG2W, 200 μM dNTP, 3 mM ATP, 50 mM creatine phosphate, 100 ng / μL creatine kinase, 50 ng / μL Bsu, 250 ng / μL gp32, 100 ng / μL uvsX, 20 ng / μL uvs Y and 0.5 μL Superscript IV Reverse Transcriptase, 200 nM primers, 100 nM LbCas12a; 50 nM crRNA, 0.5 μL RNase H and 14 mM magnesium acetate, which also includes components of a lyoprotectant, 5% w / v trehalose, 20% w / v mannitol, 2% w / v mannitol and 2% w / v BSA and other protectants. Among them, the magnesium acetate reagent is made into a freeze-dried ball alone. Add 25 μL of the sample to be tested into the freeze-dried system, mix well, then drop the reaction solution on the working electrode, and detect after reacting at 38 - 42 °C for 15 min.

[0164] The optimized one-pot system has the same amplification and detection effects as the conventional two-step system. A single-stranded DNA reporter probe was added to the system to verify the detection performance. The results show that the reaction speeds of the two-step method and the one-step method are similar (see Figure 5 ).

[0165] Minimum detection limit test

[0166] Using this method to measure samples of different concentrations, add samples of different concentrations to the prepared RPA-CRISPR freeze-dried one-pot system, place it on the electrode and react at 37 °C for 15 minutes, and then perform cyclic voltammetry detection. The results show that obvious current changes occur when the sample concentration is above 400 copies / mL, and there is no current signal change below this concentration. Its detection sensitivity is 400 copies / mL; and there is a good linear relationship in the range of 400 copies / mL - 10 6 copies / mL (see Figures 6 - 8 ).

[0167] Specificity verification

[0168] Using this method to detect the nucleic acids of Zika virus samples, dengue virus samples (DENV-1, DENV-2), influenza A virus (INFA), influenza B virus (INFB) and respiratory syncytial virus (RSV), only the nucleic acid of Zika virus can be detected. By voltammetry, its peak current decreases, resulting in a change in the response current. The results of other samples are consistent with those of the negative control. The experiment confirms that this method has good specificity and no cross-reaction with other viruses (see Figure 9 ).

[0169] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0170] The above-described embodiments only represent several implementation manners of the present application. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims, and the specification and drawings can be used to explain the content of the claims.

Claims

1. An RT-RPA / CRISPR system, characterized in that, It comprises: 40 mM to 60 mM tris(hydroxymethyl)aminomethane (Tris), 90 mM to 110 mM potassium acetate, 1 mM to 3 mM dithiothreitol (DTT), 4% w / v to 6% w / v polyethylene glycol 20000, 100 μM to 300 μM deoxynucleoside triphosphates (dNTPs), 2 mM to 5 mM adenosine triphosphate (ATP), 40 mM to 60 mM phosphocreatine, 80 ng / μL to 120 ng / μL creatine kinase, 20 ng / μL to 50 ng / μL Bsu, 200 ng / μL to 300 ng / μL gp32, 100 ng / μL to 150 ng / μL uvs X, 20 ng / μL to 40 ng / μL uvs Y, and 0.2 μL to 0.5 μL Superscript IV Reverse Transcriptase, 200 nM to 400 nM primer, 20 nM to 100 nM LbCas12a, 50 nM to 150 nM crRNA, 0.2 μL to 0.5 μL RNase H, and 14 mM to 30 mM magnesium acetate; Among them, the sequence of the primer is as shown in SEQ ID NO: 1 or SEQ ID NO: 5; The sequence of the crRNA is as shown in SEQ ID NO:

6.

2. An RPA / CRISPR-based electrochemical detection system for Zika virus, characterized in that, It comprises the RT-RPA / CRISPR system as described in claim 1; and, a gold nanoparticle modified electrode; Optionally, the preparation method of the gold nanoparticle modified electrode includes: Drop 10 μL to 100 μL of 2 mM to 50 mM chloroauric acid solution on the electrode surface, and electro-deposit to modify gold nanoparticles on the electrode surface; optionally, cyclic voltammetry or chronoamperometry is selected by an electrochemical workstation to achieve electro-deposition; among them, in cyclic voltammetry, the low voltage is -0.8V to -0.2V, the highest voltage is 0V, and the number of cycles is 2 to 20; in chronoamperometry, the voltage is -0.8V to -0.1V, and the duration is 30s to 300s.

3. The system according to claim 2, wherein The surface of the gold nanoparticle modified electrode is modified with a probe; the probe satisfies one or more of the conditions shown in the following (1) to (3): (1) One or more of methylene blue and ferrocene are labeled at the 3' end of the probe; (2) A thiol group is labeled at the 5' end of the probe; (3) The probe contains a polyA sequence, optionally a polyA sequence with a length of 15bp to 35bp; Optionally, the following method is used to modify the probe on the surface of the gold nanoparticle modified electrode: Place the probe in a 25 mM to 75 mM TCEP solution or a 5 mM to 25 mM DTT solution for reduction treatment, and place the treated probe solution on the electrode surface; let it stand at 15°C to 25°C for 4 hours to 10 hours, and then complete the fixation of the probe.

4. The RT-RPA / CRISPR system according to claim 1 or the system according to claim 2 or 3, characterized in that, It comprises a freeze-dried system, and the freeze-dried system comprises a freeze-dried partial premix and magnesium acetate freeze-dried spheres; the freeze-dried partial premix is prepared from a partial premix containing the following components: 40 mM - 60 mM Tris, 90 mM - 110 mM potassium acetate, 1 mM - 3 mM DTT, 4 % w / v - 6 % w / v polyethylene glycol 20000, 100 μM - 300 μM dNTPs, 2 mM - 5 mM ATP, 40 mM - 60 mM phosphocreatine, 80 ng / μL - 120 ng / μL creatine kinase, 20 ng / μL - 50 ng / μL Bsu, 200 ng / μL - 300 ng / μL gp32, 100 ng / μL - 150 ng / μL uvs X, 20 ng / μL - 40 ng / μL uvs Y, 0.2 μL - 0.5 μL Superscript IV Reverse Transcriptase, 200 nM - 400 nM primers, 20 nM - 100 nM LbCas12a, 50 nM - 150 nM crRNA, and 0.2 μL - 0.5 μL RNase H; Among them, the preparation method of the freeze-dried partial premix optionally includes: mixing a cryoprotectant with the partial premix and then freeze-drying; The cryoprotectant contains 5 % w / v - 10 % w / v trehalose, 5 % w / v - 20 % w / v mannitol, 2 % w / v - 5 % w / v glycine, and 2 % w / v - 5 % w / v bovine serum albumin.

5. Nucleic acid detection product, characterized in that, It includes one or more of the following 1) and 2): 1) crRNA with a nucleic acid sequence as shown in SEQ ID NO: 6; and 2) a primer set; Among them, the sequences of the primers in the primer set are as shown in SEQ ID NO: 1 and SEQ ID NO:

5.

6. A kit for detecting Zika virus, characterized in that, It includes one or more of the RT-RPA / CRISPR system as claimed in claim 1 or 4, the system as claimed in any one of claims 2 - 4, and the nucleic acid detection product as claimed in claim 5.

7. Use of the RT-RPA / CRISPR system as claimed in claim 1 or 4, the system as claimed in any one of claims 2 - 4, the nucleic acid detection product as claimed in claim 5, or the kit as claimed in claim 6 in the preparation of a product for detecting Zika virus.

8. A method for detecting Zika virus for non-disease diagnosis purposes, characterized in that, It includes using the RT-RPA / CRISPR system as claimed in claim 1 or 4, the system as claimed in any one of claims 2 - 4, the nucleic acid detection product as claimed in claim 5, or the kit as claimed in claim 6 to detect a sample; Optionally, the method includes: Preparing a reaction system; Carrying out the reaction; and Judging the result.

9. The method according to claim 8, wherein The reaction system contains the following premixed solution: 40 mM - 60 mM Tris, 90 mM - 110 mM potassium acetate, 1 mM - 3 mM DTT, 4% w / v - 6% w / v polyethylene glycol with an average molecular weight of 18 kDa - 22 kDa, 100 μM - 300 μM dNTP, 2 mM - 5 mM ATP, 40 mM - 60 mM phosphocreatine, 80 ng / μL - 120 ng / μL creatine kinase, 20 ng / μL - 50 ng / μL Bsu, 200 ng / μL - 300 ng / μL gp32, 100 ng / μL - 150 ng / μL uvs X, 20 ng / μL - 40 ng / μL uvs Y, and 0.2 μL - 0.5 μL Superscript IV Reverse Transcriptase, 200 nM - 400 nM primer, 20 nM - 100 nM LbCas12a, 50 nM - 150 nM crRNA, 0.2 μL - 0.5 μL RNase H, and 14 mM - 30 mM magnesium acetate; Optionally, the step of preparing the reaction system includes: after mixing the sample to be tested and the freeze-dried system, dropping the mixture onto the gold nanoparticle-modified electrode defined in claim 2 or 3 for reaction; Optionally, the volume of the sample to be tested is 25 μL.

10. The method according to claim 8 or 9, characterized in that, The reaction conditions include: 38°C - 42°C, reacting for 15 min - 30 min; and / or, The step of result determination includes: Measuring the signal on the gold nanoparticle-modified electrode by one or more of cyclic voltammetry, square wave voltammetry, and differential pulse voltammetry.

Images