Inhibitory transporter ribonucleic acids for treatment of nonsense mutations of cancer suppressor genes

Abstract

The present invention provides for inhibitory transporter ribonucleic acids (sup-tRNAs) that inhibit premature termination codons (PTCs) during translation and promote full length readthrough of cancer suppressor gene nonsense mutation transcripts, as well as the use of the sup-tRNAs to treat disease conditions of cancer that contain cancer suppressor gene nonsense mutations. In particular, Arg-tRNAUGA and Gln-tRNAUAG can restore the tumor suppressor gene function of tumor cells and indirectly regulate and control the expression of downstream target genes of the tumor suppressor genes, so that the clone number, the total clone area and / or the single clone area of in-vitro cultured tumor cells are reduced, and the volume and / or the weight of in-vivo tumors are reduced.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to a transfer RNA drug for treating cancer, and in particular to an inhibitory transfer RNA for treating nonsense mutations in tumor suppressor genes and a method for using the same. Background Art

[0002] Numerous types of gene mutations exist in the human genome, and nonsense mutations are one such category. Gene mutations are heritable variations in genomic DNA molecules, including frameshift mutations and base substitutions. Frameshift mutations include base insertions and deletions, while base substitutions are primarily missense and nonsense mutations. A nonsense mutation occurs when a base within a coding gene mutates, generating the stop codons UAG, UAA, and UGA. Under normal physiological conditions, stop codons do not encode any amino acid. These stop codons cannot pair with the anticodon of transfer RNA (tRNA), but are recognized by termination or release factors, terminating peptide bond synthesis and protein synthesis, leading to loss of protein function. Nonsense mutations result in premature termination codons (PTCs) within the gene frame, leading to two outcomes in gene coding: the production of truncated proteins or decreased stability and abundance of the PTC-containing mRNA, which can cause corresponding diseases. According to statistics, approximately 11.2% of monogenic genetic diseases will produce PTC mutations. On the other hand, many cancers will also produce PTC mutations (KEELING KM et al. Critical reviews in biochemistry and molecular biology, 2012, 47: 444-463.). Nonsense mutations occur in tumor suppressor genes in about 10% of sporadic cancer cases. Sporadic cancer affects 40% of the population and is by no means rare. For example, TP53 The R213X mutation in the gene is present in 1% of all human cancers. TP53 A large proportion (approximately 10%) of mutations are nonsense mutations, generating premature termination codons (PTCs) that lead to the expression of truncated or inactive p53 protein in response to nonsense-mediated mRNA decay (NMD).

[0003] Tumor sequencing and mutation analysis have not yet been incorporated into routine cancer diagnostics, but personalized medicine has achieved significant breakthroughs in cancer treatment. It is expected that within the next decade, detection technologies for nonsense mutations in tumor genomes will gradually become an integral part of routine clinical diagnostics. WO2017 / 049386A2 discloses the use of aminoglycoside antibiotics to inhibit premature stop codons during translation and promote full-length readthrough of transcripts, such as p53, that incorporate nonsense mutations, as well as their use in treating conditions such as cancer caused by such gene mutations. Ataluren (PTC124) is an oral small molecule drug used to treat genetic diseases caused by PTCs. It can induce ribosome readthrough of the PTC, allowing cells to resume full-length protein synthesis interrupted by nonsense mutations. It is currently used primarily to treat cystic fibrosis and Duchenne muscular dystrophy (DMD).

[0004] tRNAs were once considered abundant, ubiquitous, and passively involved in mRNA decoding and protein translation. By binding the anticodon on the tRNA to the codon on the mRNA, the designated amino acid is transported to complete protein translation. tRNAs that carry the same amino acid but different anticodons are called "isoacceptors," while tRNAs that carry the same amino acid and have the same anticodon but different sequences are called "isodecoders." Recent scientific advances have unexpectedly discovered that tRNAisoacceptors and isodecoders possess specific, non-passive, active regulatory functions in translation, which can significantly influence biological processes and disease progression. As a result, scientists have gradually shifted their focus from mRNA to the next generation of RNA technology, exploring its potential. Among these technologies, tRNA, previously overlooked by the industry, has emerged as a standout.

[0005] tRNA, short for transfer RNA, is part of the cellular protein synthesis machinery. It "reads" the three-nucleotide codon on mRNA and then transports the corresponding amino acid to the ribosome for incorporation into the growing polypeptide chain. This process continues until the ribosome encounters a stop codon, at which point it detaches from the mRNA, completing protein synthesis. However, in some cases, genetic mutations can convert the codon encoding an amino acid into a stop codon, prematurely terminating protein synthesis and resulting in a dysfunctional protein. It is estimated that approximately 11% of genetic diseases are caused by genetic mutations that result in premature stop codons and premature termination of protein translation (so-called nonsense mutations).

[0006] 61 codons in the human genome are recognized by tRNAs, encoding 20 amino acids. Three stop codons (UAG, UAA, and UGA) lack corresponding tRNAs and, therefore, do not encode amino acids, thereby terminating translation. However, studies have discovered that there are tRNAs that can recognize stop codons, allowing them to encode amino acids and allow protein translation to proceed normally. These tRNAs that recognize stop codons are called suppressor tRNAs (sup-tRNAs). Suppressor tRNAs can overcome premature stop codons. After binding to these erroneous stop codons, they do not halt protein synthesis but instead add a specific amino acid in its place, allowing protein synthesis to complete smoothly. For diseases caused by PTC, theoretically, a single suppressor tRNA could eliminate the premature translation interruption caused by nonsense mutations, thereby curing thousands of different genetic diseases. In 2017, the inventors completed patent applications CN201610134656.1 and WO2017152809A2, which disclosed the use of inhibitory tRNA to extend the truncated protein of nonsense mutants of pathogenic genes, so that full-length functional proteins are produced in mammalian cells, thereby restoring the normal structure and function of the mutants, and disclosed the technical concept of using inhibitory tRNA to read through nonsense mutation sites of tumor suppressor genes in tumor cells. In 2024, the University of Massachusetts' patent application WO2024025824A2 disclosed a combination of suppressive transfer ribonucleic acid (sup-tRNA) and nucleic acid antisense oligomers to promote the translation read-through of premature (nonsense) termination codons of mRNA, thereby treating diseases caused by PTC including cancer. The specific sup-tRNA used is ser-tRNA UGA . Summary of the Invention

[0007] In response to the technical problems of sup-tRNA therapy in the above-mentioned prior art, the present invention provides an inhibitory transfer RNA (sup-tRNA) that inhibits premature termination codons (PTCs) during translation and promotes full-length readthrough of nonsense mutation transcripts of tumor suppressor genes, as well as the use of sup-tRNA in treating cancer diseases containing nonsense mutations in tumor suppressor genes. In particular, Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG It can restore the function of tumor suppressor genes in tumor cells and indirectly regulate the expression of downstream target genes of tumor suppressor genes, thereby reducing the number of clones, total clone area, and / or single clone area of tumor cells cultured in vitro, and reducing the volume and / or weight of tumors in vivo.

[0008] Specifically, on one hand, the present invention provides a use of a premature termination codon (PTC) decoding reagent in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that the decoding reagent is a tRNA that can cause a tumor suppressor gene containing a PTC to read through and produce an expression product with restored function, wherein the tumor suppressor gene is selected from TP 53、RB1、 PTEN, APC gene, wherein the tRNA is Arg-tRNA UGA , Gln-tRNA UAG .

[0009] Furthermore, the use of the premature termination codon (PTC) decoding reagent of the present invention in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth is characterized in that the cancer is selected from colorectal cancer and lung cancer.

[0010] Furthermore, the use of the premature termination codon (PTC) decoding reagent of the present invention in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth is characterized in that the tRNA is selected from arginine inhibitory transfer RNA and glutamine inhibitory transfer RNA.

[0011] Furthermore, the use of the premature termination codon (PTC) decoding reagent of the present invention in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth is characterized in that the arginine inhibitory transport RNA is Arg-TCT-3-1 TGA The glutamine inhibitory transport RNA is Gln-CTG-1-1 TAG .

[0012] Furthermore, the use of the premature termination codon (PTC) decoding reagent of the present invention in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth is characterized in that the drug reduces the volume and / or weight of the tumor.

[0013] Furthermore, the use of the premature termination codon (PTC) decoding reagent of the present invention in the preparation of drugs for treating cancer and / or drugs for inhibiting tumor cell growth is characterized in that the drugs include other tumor therapeutic agents such as chemotherapy agents, and pharmaceutically acceptable excipients.

[0014] In a second aspect, the present invention provides a method for regulating cell growth, characterized in that a premature termination codon (PTC) decoding reagent is contacted with a cell in which a tumor suppressor gene has a PTC mutation, The decoding reagent is Arg-tRNA UGA , Gln-tRNA UAG , The tumor suppressor gene is selected from TP 53. RB1, PTEN, APC Gene, The cells are cells or cell lines cultured in vitro, The regulating cell growth includes changing the number of cell clones, the total area of clones, and / or the area of a single clone.

[0015] Furthermore, the method for regulating cell growth of the present invention is characterized in that the cells are selected from colorectal cancer cells and lung cancer cells; and the regulating cell growth includes reducing the number of cell clones, the total clone area, and / or the area of a single clone.

[0016] Furthermore, the method for regulating cell growth of the present invention is characterized in that the tRNA is selected from arginine inhibitory transfer RNA and glutamine inhibitory transfer RNA; preferably, the tRNA is selected from Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG .

[0017] In a third aspect, the present invention provides a method for regulating the expression of p53 target genes in cells, characterized in that a premature termination codon (PTC) decoding reagent is combined with TP53 Contact with cells in which a PTC mutation occurs in the gene, wherein the decoding reagent is Arg-tRNA UGA , Gln-tRNA UAG , the p53 target gene is selected from FAS Gene, CDKN1A Gene, BBC3 Gene.

[0018] Furthermore, the method for regulating the expression of p53 target genes in cells of the present invention is characterized in that the decoding reagent increases the expression of p53 target genes; changes the expression of colorectal cancer cells FAS gene expression, altered lung cancer cells CDKN1A Genes and BBC3 Gene expression.

[0019] Furthermore, the method for regulating the expression of the p53 target gene in cells of the present invention is characterized in that the tRNA is selected from arginine inhibitory transfer RNA and glutamine inhibitory transfer RNA; preferably, the tRNA is selected from Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG .

[0020] The advantages and beneficial effects of the present invention include:

[0021] Based on the fact that different tRNAs have different abilities to decode the PTC of target genes, the present invention targets tumor suppressor genes carrying PTC mutations and screens out tRNAs that can efficiently decode the PTC mutations of tumor suppressor genes. Through mechanism analysis, in vitro cell culture, and in vivo transplanted tumor models, it is confirmed that tRNAs have definite application value in cancer treatment.

[0022] First, the present invention uses tumor suppressor genes, especially p53, as target genes, studies the decoding efficiency of different tRNAs on PTC in p53 mutant genes, and screens and obtains tRNAs that can efficiently decode PTC in p53 mutant genes.

[0023] Second, the tRNA obtained by screening of the present invention, especially Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG In decoding TP53 While activating PTC in the mutant gene, it not only restores the full-length expression of the p53 gene, but also regulates its downstream target genes through p53. FAS Gene, CDKN1A Gene, BBC3 gene expression, thereby restoring the function of mutant p53.

[0024] Third, the present invention not only studies the Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG The tRNA has the function of inhibiting tumor growth, and the tRNA also shows the technical effect of reducing tumor volume and / or weight in a mouse transplant tumor animal model, and has high potential clinical value for cancer treatment, especially colorectal cancer and lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without any creative work.

[0026] Figure 1 : Schematic diagram of PTC mutation producing truncated expression products and tRNA decoding PTC restoring full-length expression products.

[0027] Figure 2 :A flowchart of establishing a nonsense mutation model for tumor suppressor genes and testing the read-through efficiency of inhibitory transfer RNA for nonsense mutations of different tumor suppressor genes.

[0028] Figure 3: To study the codon expansion (GCE) system, sup-tRNA, aminoglycoside antibiotics, and the readthrough rate of tumor suppressor genes overexpressing PTC in nonsense mutation models of four tumor suppressor genes: TP53, RB1, PTEN, and APC.

[0029] Figure 4A :Arg-TCT-3-1 TGA Western-Blot image showing efficient restoration of full-length tp53 expression and increased expression of the p53 target gene CDKNIA.

[0030] Figure 4B :Gln-CTG-1-1 TAG Western-Blot image showing efficient restoration of full-length tp53 expression and increased expression of the p53 target gene CDKNIA.

[0031] Figure 4C : In Calu-6 TP53 R196* With Caco-2 TP53 E204* Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG Immunofluorescence images showing restoration of full-length P53 expression and increase in the expression of the p53 target gene CDKNIA.

[0032] Figure 5A :The effect of sup-tRNA readthrough of endogenous TP53 nonsense mutation on the relative expression of p53 target genes.

[0033] Figure 5B : PCR Matrix Analysis of Calu-6 TP53 R196* With Caco-2 TP53 E204* p53 target genes whose expression levels change after administration of sup-tRNA.

[0034] Figure 6A : Restoration of Caco-2 using high-throughput Gln inhibitory transport RNA TP53 E204 Effects of p53 on cell growth in vitro.

[0035] Figure 6B : Using high-throughput Arg inhibitory transfer RNA Calu-6 TP53 R196* Effects of p53 on the growth of cultured cells in vitro.

[0036] Figure 6C :The effect of high-readthrough sup-tRNA transfection on cell number in tumor cell lines.

[0037] Figure 7A :Arg-TCT-3-1 TGAWestern-blot images of the effects of Calu-6 xenografts on P53 and CDKN1A protein levels.

[0038] Figure 7B :Gln-CTG-1-1 TAG Western-blot images of the effects of P53 and CDKN1A protein levels on Caco-2 xenografts.

[0039] Figure 7C :Arg-TCT-3-1 TGA Increase Calu-6 R196* The relative expression of CDKN1A / GADPH, Gln-CTG-1-1 TAG Increase Caco-2 E204* The relative expression levels of CDKN1A / GADPH in the 36-well tissues were analyzed.

[0040] Figure 8A :Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG Reduces xenograft tumor weight and volume.

[0041] Figure 8B :Arg-TCT-3-1 TGA H&E histological examination of heart, liver, spleen, lung, and kidney in the treatment groups.

[0042] Figure 8C :Gln-CTG-1-1 TAG H&E histological examination of heart, liver, spleen, lung, and kidney in the treatment groups. Figure 9 : Readthrough efficiency (%) of inhibitory tRNAs with highly mutant amino acids. Figure 10 : Fluorescence images of eight glutamine-carrying sup-tRNAs restoring the expression and function of the hypermutated site TP53 Q192X. Figure 11 : Fluorescence images of eight arginine-carrying sup-tRNAs restoring the expression and function of the hypermutated site TP53 R196X. DETAILED DESCRIPTION

[0043] To make the purpose, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention. Rather than all embodiments, it should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. All other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0044] The key data, main reagents and materials, experimental methods and operating procedures used in the implementation of the present invention are disclosed as follows: (1) Acquisition of tumor suppressor gene mutation data: Tumor suppressor gene mutation data were downloaded from the COSMIC database (https: / / cancer.sanger.ac.uk / cosmic) and the IntOGen database (https: / / www.intogen.org / ). The amino acid type data of nonsense mutations in tumor suppressor genes were collected from the COSMIC database, including TP53 (COSMIC gene: COSG501), RB1 (COSMIC gene: COSG16), PTEN (COSMIC gene: COSG15) and APC (COSMIC gene: COSG257430).

[0045] (2) Cell culture and transfection: Human HEK293T cells (ATCC CRL-11268) were cultured in DMEM medium (Procell) supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 mg / mL streptomycin.

[0046] Human Calu-6 cells (ATCC HTB-56) were cultured in MEM medium (Procell) supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 mg / mL streptomycin.

[0047] Human Caco-2 cells (ATCC HTB-37) were cultured in MEM medium (Procell) supplemented with 20% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 mg / mL streptomycin.

[0048] Plasmid transfection was performed using Lipo3000 and P3000 (Invitrogen), and cell transfection procedures were performed according to the supplier's recommendations.

[0049] (3) Plasmid construction: Tumor suppressor genes (TP53, RB1, PTEN, and APC) were constructed into the PCAGGS-FLAG-GUSB-myc-T2A-GFP plasmid. Subsequently, targeted mutagenesis was achieved by introducing primers containing mismatched bases during PCR, resulting in plasmids harboring nonsense mutations at specific sites.

[0050] tRNA was constructed in the pcDNA3.1(+) vector and its expression was driven by the 7SK promoter. tRNA gene sequences were obtained from the GtRNA database (http: / / gtrnadb.ucsc.edu / ).

[0051] (4) Western blotting: will be equivalent to 3×10 5 Samples of 10 cells were subjected to 10% SDS-PAGE electrophoresis, followed by protein transfer to a 0.22 μm PVDF membrane using the eBlot® L1 Rapid Wet Blot System (GenScript, USA). The membrane was incubated overnight at 4°C with a 1 / 200 dilution of anti-p53 antibody (DO1) (Santa Cruz Biotechnology, Dallas, TX, USA; Catalog No. sc-126), which recognizes human p53. Subsequently, anti-p21 antibody (Proteintech, China; Catalog No. 10355-1-AP) and anti-GAPDH antibody (Proteintech, China; Catalog No. 1E6D9) were used at a 1 / 2000 dilution, respectively. After washing the membrane three times in TBS-Tween solution, the membrane was exposed to horseradish peroxidase-conjugated secondary antibody solution for detecting mouse- or rabbit-derived antibodies (Proteintech, China) at a dilution of 1 / 2000 (Catalog No.: SA00001-1, SA00001-2).

[0052] The antibody was subsequently detected using the BeyoECL Moon (P0018FS, Beyotime, China). Images were captured using a 5200 imaging system (Tanon, Shanghai, China). Raw, unprocessed gel images are provided in the source data file. Western blot results were semi-quantitatively analyzed using ImageJ software.

[0053] (5) Quantitative real-time PCR (qRT-PCR) 1.5×10 5Cells were plated in 6-well plates in a total volume of 2 mL. The next day, cells were transfected with different plasmids (corresponding to the indicated drugs) for 48 hours. RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme, China) according to the manufacturer's recommendations. RNA was quantified using a NanoDrop spectrophotometer (Thermo Scientific, USA). cDNA was synthesized from RNA using HiFair® AdvanceFast One-Step RT-gDNA Digestion Supermix (Yeasen, China). Real-time quantitative PCR was performed using the Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix (Yeasen, China) on a Roche LightCycler® 480 II (Roche, Switzerland) using the following primers: GAPDH mRNA Sense primer: 5′- GGAGCGAGATCCCTCCAAAAT-3′ Antisense primer: 5′- GGCTGTTGTCATACTTCTCATGG-3′ TP53 mRNA (TP53-AA167-208) Sense primer: 5′- CAGCACATGACGGAGGTTGT-3′ Antisense primer: 5′- TCATCCAAATACTCCACACGC-3′ CDKN1A mRNA Sense primer: 5′- TGTCCGTCAGAACCCATGC -3′ Antisense primer: 5′-AAAGTCGAAGTTCCATCGCTC -3′ BBC3 mRNA Sense primer: 5′- GCCAGATTTGTGAGACAAGAGG -3′ Antisense primer: 5′- CAGGCACCTAATTGGGCTC -3′ GADD45A mRNA Sense primer: 5′- GAGAGCAGAAGACCGAAAGGA -3′ Antisense primer: 5′- CACAACACCACGTTATCGGG -3′ BAX mRNA Sense primer: 5′-CCCGAGAGGTCTTTTTCCGAG -3′ Antisense primer: 5′-CCAGCCCATGATGGTTCTGAT-3′ ZMAT3 mRNA Sense primer: 5′- AGAAGCCTTTTGGGCAGGAG -3′ Antisense primer: 5′- TGCTGCATAGTAATTTCGGAGTT -3′ FAS mRNA Sense primer: 5′- TCTGGTTCTTACGTCTGTTGC -3′ Antisense primer: 5′-CTGTGCAGTCCTAGCTTTCC-3′ PMAIP1 mRNA Sense primer: 5′-ACCAAGCCGGATTTGCGATT -3′ Antisense primer: 5′-ACTTGCACTTGTTCCTCGTGG -3′ The relative expression fold was calculated using the 2⁻ΔΔCt formula.

[0054] (6) PCR matrix: After cell transfection, total RNA was extracted and cDNA was synthesized as described above. The cDNA was mixed with qPCR SYBR and added to a p53 PCR Array 96-well plate (WcGENE Biotech, WC-MRNA0117-H) to detect the expression of a panel of p53-related genes.

[0055] (7) Transcriptome sequencing: Total RNA was extracted from nude mouse human xenograft tumors using TRIzol reagent (three biological replicates per group). Illumina sequencing libraries were constructed according to the instructions for the Vazyme VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (Cat. No. NR604-02). Nucleic acid concentration was determined using a Nanodrop 2000 (Thermo Fisher), and RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Vazyme, G2939BA). Library quality was verified using an Agilent BioAnalyzer 2100 system (Agilent Technologies) before paired-end 150 bp sequencing was performed on the Illumina NovaSeq X Plus platform. Raw sequencing data were screened using the Q30 quality control standard. 3'-end adapter trimming and low-quality read filtering were performed using fastp software (v0.20.1; https: / / github.com / OpenGene / fastp). Clean reads were aligned to the reference genome using HISAT2 (v2.0.4; https: / / daehwankimlab.github.io / hisat2 / ). Based on the gffcompare annotation results, gene expression levels (FPKM: fragments per kilobase of transcript length per million aligned fragments) were calculated using the ballgown package. The total number of expressed genes and the log2-transformed FPKM distributions were systematically compared between groups. Finally, differential expression analysis was performed using DESeq2. Significantly differentially expressed genes with a fold change > 2 and a corrected P value < 0.01 were selected for further analysis.

[0056] (8) Clone formation experiment: Eight hours after transfection, cells were digested and resuspended. Cancer cells were seeded at a density of 1,000 cells per well in six-well plates and cultured in complete medium at 37°C for 7–10 days. After gentle washing twice with PBS, cells were fixed with 4% formaldehyde for 30 minutes. Fixed cells were stained with crystal violet stain (Beyotime, China; Catalog No. C0121) for 30 minutes. The number of colonies, total colony area, and individual colony area were counted using an IncuCyte SX5 imaging system (Sartorius AG, Göttingen, Germany).

[0057] (9) Cell counting and Cell Counting Kit-8 (CCK-8): Cell transfection, digestion, and resuspension were performed as described above. For cell counting, cells were seeded into 24-well plates at appropriate numbers, digested 24, 48, 72, and 96 hours after seeding, and then counted using a cell counter (CountstarBioTech, China). For CCK-8 experiments, cells were seeded into 96-well plates at a density of 2,000 cells per well. At the designated time points, the original culture medium for each group was replaced with 10 µL of CCK-8 solution diluted in 100 µL of complete culture medium, according to the protocol for CCK-8 solution (Beyotime, China; Catalog No. C0040). After incubation at 37°C in the dark for 1 hour, viable cells were detected using a microplate reader AMR-100 (Allsheng, China) at a wavelength of 450 nm.

[0058] (10) Xenograft tumor model: Animal experiments were approved by the Institutional Animal Care and Use Committee of Peking University Health Science Center (animal protocol number: DLASBD0468). Female BALB / c nude mice aged 6–8 weeks were housed in an SPF-grade facility with a 12-h light–dark cycle and free access to water and food. For tumor establishment, Calu-6 cells (5 × 10 5 cells / mouse; 1:1 suspension in BD Matrigel™) and Caco-2 cells (1 × 10 7 cells / mouse; suspended in BD Matrigel™ at a 1:1 ratio) were injected subcutaneously into each mouse (day 0). Eight days later, when tumors reached approximately 100-200 mm³, treatment was initiated. Mice were randomly divided into different groups. Using Entranster technology, sup-tRNA and vector plasmids were delivered intratumorally every four days. D-PBS (100 µL) and G418 (20 mg / kg, 100 µL) were administered in the same manner and frequency. Tumor volume and body weight were calculated every two days using the standard formula: volume = 0.5 × length × width². At the end of treatment, mice were sacrificed. Tumors were dissected, weighed, and cut into two aliquots: one half frozen in liquid nitrogen for protein analysis, and the other half stored in RNAlater (Beyotime, China; Catalog No. R0118) for qPCR analysis.

[0059] (11) Hematological and histological analysis: Blood samples were collected from the orbital vein of mice and stored at 4°C in tubes containing K2-ethylenediaminetetraacetic acid (EDTA). Hematological parameters were analyzed using a BC-2800Vet® fully automated hematology analyzer (Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Hamburg, Germany). Heart, liver, spleen, lung, and kidney tissues from the different groups of mice were isolated and fixed in 4% formaldehyde, dehydrated in 70%, 95%, and 100% ethanol, defatted in xylene for 2 hours, and then embedded in paraffin. 10-μm-thick sections were cut and stained with hematoxylin and eosin (H&E). Sections were viewed using a pathology slide scanner, the WS-10 (Wisleap, China). Images were analyzed and recorded using NDPView2 software (Hamamatsu, Japan).

[0060] Example 1: Establishing a nonsense mutation model for tumor suppressor genes and testing the readthrough efficiency of inhibitory transfer RNA for nonsense mutations in different tumor suppressor genes We established four nonsense mutation models for tumor suppressor genes based on the mutation rates of patients in the real world for evaluation (see Figure 2 ). Figure 3 Results indicate that in multiple models with nonsense mutations in tumor suppressor genes, the inhibitory transfer RNA system exhibits a significantly higher readthrough rate than traditional aminoglycosides. Using fluorescence semi-quantitative analysis, we found that the inhibitory transfer RNA system exhibits a readthrough rate of approximately 60-70%, while the traditional readthrough-enhancing drug G418 exhibits a readthrough rate of less than 10%, with significant site specificity.

[0061] Example 2: Using the cell lines Calu-6 and Caco-2 harboring TP53 nonsense mutations, we tested whether inhibitory tRNAs could restore full-length p53 protein after reading through endogenous TP53 nonsense mutations. Inhibitory transfer RNA readthrough of endogenous TP53 nonsense mutations can restore full-length p53 protein. We selected human lung cancer Calu-6 and colorectal cancer cell lines Caco-2 for subsequent experiments, both of which carry TP53 nonsense mutations. Figure 4A-4B Western blot results showed that after the inhibitory transfer RNA read-through of TP53 nonsense mutation, p53 protein was restored and the expression of p53 target gene CDKN1A protein was enhanced. Figure 4C The immunofluorescence results further confirmed this conclusion.

[0062] Example 3: Is it possible to restore full-length p53 protein to normal transcriptional function after inhibitory transfer RNA reads through endogenous TP53 nonsense mutations in Calu-6 and Caco-2 cell lines? Figure 5AResults indicate that readthrough of the endogenous TP53 nonsense mutation by inhibitory transfer RNA (tRNA) in Calu-6 and Caco-2 cell lines restores full-length p53 protein to normal transcriptional function. As a transcription factor, restoration of p53 protein can upregulate target gene expression. Quantitative quantitative PCR (qPCR) and PCR matrix analysis confirmed that the inhibitory transfer RNA restored p53 protein to normal transcriptional function. qPCR results showed that readthrough of p53 protein resulted in varying degrees of upregulation of RNA expression in p53 target genes, with the level of upregulation becoming more pronounced over time. Figure 5B The PCR matrix results showed that after the restoration of TP53 in the colorectal cancer cell line Caco-2, the RNA expression levels of TP53 target genes including TP53 were upregulated to varying degrees, with the FAS gene upregulated most significantly. After the restoration of p53 protein in the degenerative lung cancer cell line Calu-6, CDKN1A, BBC3 The RNA expression levels of p53 target genes such as glioma and glioma were upregulated to varying degrees.

[0063] Example 4: Whether inhibitory transfer RNA can exert a growth inhibitory effect on tumor cells after reading through the endogenous TP53 nonsense mutation in the TP53 nonsense mutation cell lines Calu-6 and Caco-2 and restoring the full-length p53 tumor suppressor protein with normal transcriptional function.

[0064] The human colorectal cancer cell line Caco-2 carries the TP53 nonsense mutation E204*. Figure 6A Results showed that restoration of p53 using high-throughput Gln inhibitory tRNA significantly reduced the number of clones, the total clone area, and the area of individual clones. Comparison of the treatment and control groups revealed that the number of clones in the treatment group decreased by approximately 50%, the total clone area decreased by 70%, and the area of individual clones decreased by 60%.

[0065] Calu-6 carries the TP53 nonsense mutation R196*. Figure 6B Results showed that restoration of p53 using a high-throughput arginine inhibitory tRNA significantly reduced the number of clones, the total clone area, and the area of individual clones. Comparison of the treatment and control groups revealed a 40% decrease in the number of clones, a 75% decrease in the total clone area, and a 60% decrease in the area of individual clones in the treatment group.

[0066] To further evaluate the growth inhibitory effect of inhibitory tRNAs on TP53 nonsense mutation tumor cell lines, we transfected multiple inhibitory tRNAs of arginine and glutamine into tumor cells for 8 hours, then resuspended them and detected by CCK8 and cell counting. Figure 6CThe results showed that high-readthrough inhibitory transfer RNA had a strong growth inhibitory effect on TP53 nonsense mutation tumor cells.

[0067] The experimental results of this example demonstrate that after the inhibitory transfer RNA reads through the endogenous TP53 nonsense mutation and restores the full-length p53 tumor suppressor protein with normal transcriptional function, it exerts a significant growth inhibitory effect on tumor cells with TP53 nonsense mutations.

[0068] Example 5: Can inhibitory transfer RNA read through the endogenous TP53 nonsense mutation in TP53 nonsense mutation xenograft tumors and restore the full-length p53 tumor suppressor protein with normal transcriptional function?

[0069] Figure 7A Arg-TCT-3-1 TGA Western-Blot analysis of Calu-6, Figure 7C Arg-TCT-3-1 TGA Increase Calu-6 TP53 R196* The relative expression of CDKN1A / GADPH in Calu-6 xenografts showed that compared with the control group, inhibitory tRNA treatment increased the TP53 protein and CDKN1A protein levels by 3.7-fold and 1.9-fold, respectively, and increased the CDKN1A gene mRNA level by 4.3-fold.

[0070] Figure 7B Gln-CTG-1-1 TAG Western-Blot analysis of Caco-2 Figure 7C Gln-CTG-1-1 TAG Increase Caco-2 TP53 E204* The relative expression of CDKN1A / GADPH in Caco-2 xenografts was investigated. Compared with the control group, treatment with inhibitory tRNA increased the p53 protein and CDKN1A protein levels by 2.35-fold and 1.1-fold, respectively, and increased the CDKN1A gene mRNA level by 3.2-fold.

[0071] in, The nucleotide sequence of the inhibitory transfer RNA (sup-tRNA) Arg-TCT-3-1TGA is: GGCTCTGTGGCGCAATGGATAGCGCATTGGACTTCAAATTCAAAGGTTGTGGGTTCGAGTCCCACCAGAGTC The nucleotide sequence of the inhibitory transfer RNA (sup-tRNA) Gln-CTG-1-1TAG is: GGTTCCATGGTGTAATGGTTAGCACTCTGGACTCTAAATCCAGCGATCCGAGTTCAAATCTCGGTGGAACCT The experimental results of this example confirmed that after the inhibitory transfer RNA read through the endogenous TP53 nonsense mutation in the TP53 nonsense mutation xenograft tumor, the full-length p53 was significantly restored, and the restored full-length p53 protein significantly increased the transcription level of the P53 target gene CDKN1A.

[0072] Example 6: Inhibitory transfer RNA reads through endogenous TP53 nonsense mutations in TP53 nonsense mutation xenograft tumors, and its in vivo efficacy and safety evaluation.

[0073] Figure 8A and Figure 8B The results showed that in the Calu-6 & Caco-2 xenograft model, the tumor volume of the inhibitory transfer RNA treatment group was reduced by about 70% and the tumor weight was reduced by about 60%.

[0074] Figure 8C H&E histological examinations of the heart, liver, spleen, lung, and kidney of mice treated with inhibitory transfer RNA (tRNA) showed no abnormalities. This suggests that inhibiting tRNA readthrough of nonsense mutations in tumor suppressor genes is a highly effective and safe therapeutic strategy for treating tumors.

[0075] The experimental results of this example confirm that the inhibitory transfer RNA reads through the endogenous TP53 nonsense mutation in the xenograft tumor with TP53 nonsense mutation, exerts a significant growth inhibitory effect on the xenograft tumor and has a high safety.

[0076] Example 7: sup-tRNA readthrough efficiency corresponding to amino acids with high incidence of nonsense mutations We constructed a dual-luciferase reporter system containing nonsense mutations, introducing TAG, TAA, and TGA stop codons, respectively, between the firefly and renilla reporter genes. A GGGGS linker was attached to the C-terminus of the renilla reporter gene, followed by the TMV leaky sequences CAATAG / TAA / TGACAATAA containing TAG, TAA, and TGA, respectively. These sequences were then concatenated to the N-terminus of the firefly gene and cloned into the pGL4 vector (Promega), resulting in the pGL4-2luc-TAG, pGL4-2luc-TAA, and pGL4-2luc-TGA vectors, respectively. During normal protein translation, when a translational element encounters a nonsense stop codon, translation terminates prematurely, resulting in the expression of only the renilla protein. However, when a read-through sup-tRNA is added, it recognizes and reads through the nonsense stop codon, allowing translation to continue. This allows both renilla and firefly proteins to be expressed in the cell. When enzyme substrates are added, the luminescence readings of firefly and renilla are measured using a microplate reader. Renilla serves as an internal control to eliminate background and other influences. The ratio of luminescence between firefly and renilla reflects the efficiency of the sup-tRNA in reading through nonsense mutations.

[0077] Table 1: Inhibitory transfer RNA sequences

[0078]

[0079] The results showed that ( Figure 9 With the exception of glutamate, all other highly mutated amino acids have corresponding inhibitory tRNAs that could be used for readthrough therapy. The highest readthrough efficiency for arginine (Arg) inhibitory tRNA is approximately 40%, and for glutamine (Gln) inhibitory tRNA is approximately 55%. This makes it possible to effectively restore tumor suppressor proteins caused by nonsense mutations through inhibitory tRNAs.

[0080] Example 8: Arg-tRNA UGA , Gln-tRNA UAG Able to restore p53 function The tumor suppressor gene TP53 was constructed into the pCAGGS-FLAG-GUSB-myc-T2A-GFP plasmid. Subsequently, targeted mutagenesis was achieved by introducing primers containing mismatched bases during PCR, resulting in a plasmid with a nonsense mutation at a specific site.

[0081] tRNA was constructed in the pcDNA3.1(+) vector and its expression was driven by the 7SK promoter. The tRNA gene sequence was derived from the GtRNA database ( http: / / gtrnadb.ucsc.edu / We purchased the PG13-luc (wild-type p53 binding site) plasmid from Addgene (Addgene ID: 16442). Next, we replaced the luciferase reporter gene with an mCherry reporter gene to create the PG13-mCherry plasmid.

[0082] To investigate the role of sup-tRNAs in restoring p53 function, we co-transfected NCI-H1299 cells (TP53-deficient cells) with sup-tRNAs, a p53 reporter gene, and a genetically encoded sensor (which can characterize the expression of full-length p53 protein by green fluorescence and assess the restoration of full-length p53 protein transcriptional activity by red fluorescence). Figure 10-11 ), 8 sup-tRNAs carrying glutamine (Gln-CTG-1-1 TAG 、Gln-CTG-5-1 TAG 、Gln-CTG-2-1 TAG 、Gln-CTG-6-1 TAG 、Gln-CTG-3-1 TAG 、Gln-CTG-7-1 TAG 、Gln-CTG-9-1 TAG 、Gln-CTG-10-1 TAG ) can restore the expression and function of the high mutation site TP53 Q192X, and 8 sup-tRNAs carrying arginine (Arg-TCT-3-1 TGA 、Arg-CCT-3-1 TGA 、Arg-CCG-2-1 TGA 、Arg-ACG-2-1 TGA 、Arg-TCT-4-1 TGA 、Arg-TCG-2-1 TGA 、Arg-TCG-1-1 TGA 、Arg-TCG-4-1 TGA) can restore the expression and function of the high mutation site TP53R196X, and its functional recovery is significantly correlated with the read-through efficiency.

[0083] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may be modified or some of the technical features thereof may be replaced with equivalents. Such modifications or replacements do not deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention. The scope of patent protection of the present invention shall be based on the claims described.

Claims

1. Use of a premature termination codon (PTC) decoding reagent in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The decoding reagent is a tRNA that can cause the tumor suppressor gene containing PTC to read through and produce an expression product with restored function, and the tumor suppressor gene is selected from TP 53. RB1, PTEN, APC gene, wherein the tRNA is Arg-tRNA UGA , Gln-tRNA UAG .

2. Use of the premature termination codon (PTC) decoding reagent according to claim 1 in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The cancer is selected from colorectal cancer and lung cancer.

3. Use of the premature termination codon (PTC) decoding reagent according to claim 1 in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The tRNA is selected from arginine inhibitory transfer RNA and glutamine inhibitory transfer RNA.

4. Use of the premature termination codon (PTC) decoding reagent according to claim 3 in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The arginine inhibitory transport RNA is Arg-TCT-3-1 TGA ; The glutamine inhibitory transport RNA is Gln-CTG-1-1 TAG .

5. Use of the premature termination codon (PTC) decoding reagent according to any one of claims 1 to 4 in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The drug reduces the volume and / or weight of the tumor.

6. Use of the premature termination codon (PTC) decoding reagent according to any one of claims 1 to 4 in the preparation of a drug for treating cancer and / or a drug for inhibiting tumor cell growth, characterized in that: The drugs include other tumor therapeutic agents such as chemotherapy agents, and pharmaceutically acceptable excipients.

7. A method for regulating cell growth, characterized in that: The premature termination codon (PTC) decoding reagent is brought into contact with cells with PTC mutations in tumor suppressor genes. The decoding reagent is Arg-tRNA UGA , Gln-tRNA UAG , The tumor suppressor gene is selected from TP 53. RB1, PTEN, APC Gene, The cells are cells or cell lines cultured in vitro, The regulating cell growth includes changing the number of cell clones, the total area of clones, and / or the area of a single clone.

8. The method for regulating cell growth according to claim 7, wherein: The cells are selected from colorectal cancer cells and lung cancer cells; and regulating cell growth includes reducing the number of cell clones, the total clone area, and / or the area of a single clone.

9. The method for regulating cell growth according to claim 7, wherein: The tRNA is selected from arginine inhibitory transfer RNA, glutamine inhibitory transfer RNA; preferably, the tRNA is selected from Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG .

10. A method for regulating the expression of p53 target genes in cells, characterized in that: Combine the premature termination codon (PTC) decoding reagent with TP53 Contact with cells in which a PTC mutation occurs in the gene, wherein the decoding reagent is Arg-tRNA UGA , Gln-tRNA UAG , the p53 target gene is selected from FAS Gene, CDKN1A Gene, BBC3 Gene.

11. The method for regulating the expression of p53 target genes in cells according to claim 10, wherein: The decoding agent increases the expression of p53 target genes.

12. The method for regulating the expression of p53 target genes in cells according to claim 10, wherein: The tRNA is selected from arginine inhibitory transfer RNA, glutamine inhibitory transfer RNA; preferably, the tRNA is selected from Arg-TCT-3-1 TGA 、Gln-CTG-1-1 TAG .

Images