Wheat salt-tolerant nuclear factor Y subunit gene TaNF-YC8 and application thereof

By cloning and knocking out the wheat TaNF-YC8 gene, the CRISPR/Cas9 system is used to improve the salt tolerance of wheat, solving the problem of wheat growth affected by salt stress, and achieving high yield and high quality of wheat in a salt stress environment.

CN120424943APending Publication Date: 2025-08-05SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510568892.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-05

Smart Images

  • Figure CN120424943A_ABST
    Figure CN120424943A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological genetic engineering, in particular to a wheat salt-tolerant nuclear factor Y subunit gene TaNF-YC8 and application thereof. The cDNA (complementary deoxyribonucleic acid) sequence of the TaNF-YC8 gene is as shown in SEQ ID NO. 1; according to the application, by silencing the TaNF-YC8 gene or inhibiting the expression activity of the TaNF-YC8 gene, the resistance of wheat to salt stress can be promoted, and the application has extremely important practical significance for cultivating new wheat varieties with higher salt resistance and improving the yield and quality of wheat in a stress environment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a wheat salt-tolerance nuclear factor Y subunit gene TaNF-YC8 and an application thereof. Background Art

[0002] Salt stress is one of the main environmental factors that affect plant growth and development and restrict agricultural production. Efficient agricultural utilization of saline-alkali land is of great significance for improving agricultural production capacity and increasing the amount of arable land.

[0003] Wheat (Triticum aestivum), a core crop for global food security, provides staple food for millions of people worldwide and is of great significance in ensuring food security. However, with the intensification of global climate change, wheat production faces increasingly severe challenges from abiotic stresses. Salt stress severely affects wheat growth, development, yield, and quality, threatening the stability of the global food supply. Exploring the key genes that regulate wheat stress response and analyzing their functions and molecular mechanisms is of great practical significance for breeding new wheat varieties with stronger salt tolerance and maintaining or even improving wheat yield and quality under stressful conditions. Summary of the Invention

[0004] In view of this, the present invention provides a wheat salt-tolerance nuclear factor Y subunit gene TaNF-YC8 and its application.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides the use of the TaNF-YC8 gene or a biomaterial targeting the TaNF-YC8 gene in at least one of the following:

[0007] (A1) Application in regulating salt tolerance in wheat;

[0008] (A2) Application in wheat breeding;

[0009] (A3) Application in breeding salt-tolerant wheat;

[0010] (A4) Application in molecular breeding for improving salt tolerance in wheat or in improving germplasm resources related to salt tolerance;

[0011] The cDNA sequence of the TaNF-YC8 gene is shown in SEQ ID NO.1.

[0012] The biomaterial targeting the TaNF-YC8 gene refers to a biomaterial containing a substance that inhibits the expression activity of the TaNF-YC8 gene or silences the TaNF-YC8 gene.

[0013] In one embodiment of the present invention, the regulation is: inhibiting or down-regulating the expression level of the TaNF-YC8 gene to promote the resistance of wheat to salt stress.

[0014] In one embodiment of the present invention, the biological material includes a recombinant vector, a recombinant microorganism or an expression cassette.

[0015] In one embodiment of the present invention, the recombinant vector is pBUE411-TaNF-YC8.

[0016] In one embodiment of the present invention, the expression cassette contains the nucleotide sequence shown in SEQ ID NO.4.

[0017] In one embodiment of the present invention, the salt tolerance of wheat is regulated by inhibiting the expression of the TaNF-YC8 gene, and salt-resistant wheat germplasm is cultivated.

[0018] The second aspect of the present invention provides use of a substance for inhibiting the expression of the TaNF-YC8 gene in any of the following:

[0019] (B1) Application in regulating salt tolerance in wheat;

[0020] (B2) Application in wheat breeding;

[0021] (B3) Application in breeding salt-tolerant wheat;

[0022] (B4) Application in molecular breeding for improving salt tolerance in wheat or in improving germplasm resources related to salt tolerance.

[0023] In one embodiment of the present invention, the substance includes a substance that inhibits the replication, transcription, translation, post-transcriptional modification and / or post-translational modification of the TaNF-YC8 gene.

[0024] In one embodiment of the present invention, the substance for inhibiting the expression of the TaNF-YC8 gene is an RNA interference molecule or antisense oligonucleotide, siRNA, sgRNA or a substance of the CRISPR / Cas9 system containing sgRNA targeting the TaNF-YC8 gene.

[0025] In one embodiment of the present invention, the substance used to inhibit the expression of the TaNF-YC8 gene is sgRNA or a CRISPR / Cas9 system containing the sgRNA.

[0026] It should be noted that any sgRNA sequence that can inhibit the expression of the TaNF-YC8 gene can be used. In a preferred embodiment of the present invention, the target sequence of the sgRNA is shown in SEQ IN NO. 2-3.

[0027] A third aspect of the present invention provides a method for cultivating salt-tolerant plants, comprising inhibiting or reducing the expression of the TaNF-YC8 gene in a target plant to obtain a plant with improved salt tolerance.

[0028] In one embodiment of the present invention, the inhibition or reduction of the expression of the TaNF-YC8 gene in the target plant is performed using the CRISPR / Cas9 system, and the CRISPR / Cas9 system includes an sgRNA targeting the TaNF-YC8 gene.

[0029] In one embodiment of the present invention, the target sequence of sgRNA is shown as SEQ ID NO.2 and SEQ ID NO.3.

[0030] In one embodiment of the present invention, the plant is preferably wheat, and further, the wheat is the wheat variety Fielder.

[0031] The technical solution of the present invention is to isolate the wheat gene TaNF-YC8 from wheat, then transform the gene into common wheat Fielder, and knock out the TaNF-YC8 gene in Fielder to obtain a wheat mutant with inactivated TaNF-YC8 gene, so as to study the function of the TaNF-YC8 gene and the salt stress response mechanism of wheat.

[0032] The wheat TaNF-YC8 gene described herein was knocked out in wheat to screen for exogenous vector-free TaNF-YC8 mutants. To facilitate screening of transgenic plants or cell lines, the plant expression vector pBUE411-TaNF-YC8 containing the TaNF-YC8 gene can be modified, for example, by adding a selectable marker (e.g., GFP) or an antibiotic resistance marker (e.g., hygromycin, kanamycin, gentamicin, etc.).

[0033] In fact, any vector that can introduce foreign genes into plants for expression can be used. The preferred vector of the present invention is pBUE411.

[0034] The present invention has the following beneficial effects:

[0035] The present invention utilizes plant genetic engineering technology to clone the wheat salt stress response gene TaNF-YC8, and knocks out the gene in common wheat Fielder through an Agrobacterium tumefaciens-mediated method to create mutants. Comparative analysis shows that the TaNF-YC8 mutant promotes wheat resistance to salt stress, and the salt tolerance of the mutant plants is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0037] Figure 1 RT-PCR analysis of TaNF-YC8 gene in SR3 and JN177 under salt stress in the examples of the present invention;

[0038] Figure 2 Figure 1 is an analysis of the mutation sites of the TaNF-YC8 mutants in the examples of the present invention; wherein, the mutation sites of the three homologous genes of TaNF-YC8 in the two mutants nf-yc8-1 and nf-yc8-2 are respectively indicated; the PAM site is underlined, and the mutation site is indicated in red;

[0039] Figure 3 The phenotypes of the TaNF-YC8 mutant under salt stress in wheat according to the examples of the present invention are as follows: (A) the phenotypes of the nf-yc8-ko mutant and Fielder seedlings cultured in a culture medium supplemented with 0 mM NaCl and 150 mM NaCl for 10 days; (B) the statistics of plant height (B), root length (C), and plant fresh weight (D) of the nf-yc8-ko mutant and Fielder seedlings cultured in a culture medium supplemented with 0 mM NaCl and 150 mM NaCl for 10 days. DETAILED DESCRIPTION

[0040] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is merely for the purpose of explaining the present invention and does not limit the present invention in any form. Any simple modifications, equivalent changes, and modifications made to the embodiments based on the technical essence of the present invention fall within the scope of the technical solution of the present invention.

[0041] In the following examples, the materials, reagents, vectors, strains, etc. used were all obtained from commercial sources unless otherwise specified.

[0042] Example 1. Cloning of TaNF-YC8

[0043] 1. RNAiso Plus method for RNA extraction

[0044] This study used the RNAiso Plus method for RNA extraction according to the instructions of RNAiso Plus (Total RNA Extraction Reagent) (TaKaRa, #9109). All centrifugation operations were performed at 4°C. The specific steps are as follows:

[0045] a. Cut 0.25 g of fresh, actively growing tissue into a 2.0 mL centrifuge tube and immediately freeze in liquid nitrogen.

[0046] b. After quick freezing in liquid nitrogen, place the centrifuge tube into a tissue grinder and grind the sample thoroughly for 1 minute;

[0047] c. After grinding thoroughly into powder, immediately add 1 mL of RNAiso Plus extraction solution;

[0048] d. Homogenize thoroughly and let stand at room temperature for 5 minutes;

[0049] e. Centrifuge at 12,000 g at 4°C for 5 min. Carefully aspirate the supernatant and transfer it to a 2.0 mL centrifuge tube containing 200 μL of chloroform. Shake thoroughly until the solution is emulsified and turns milky white. Let stand at room temperature for 5 min.

[0050] f. Centrifuge at 12,000 g for 15 min at 4°C. Pipette the supernatant (approximately 650 μL) into a new 1.5 mL centrifuge tube (do not aspirate the white intermediate layer) and add an equal volume of isopropanol.

[0051] g. Mix thoroughly by turning upside down and let it stand at room temperature for 10 minutes;

[0052] h. Centrifuge at 12,000 g for 15 min, discard the supernatant, add 1 mL of pre-chilled 75% ethanol, and gently invert upside down to thoroughly wash the precipitate;

[0053] i. Discard the washing solution and centrifuge at 7,500g at 4°C for 5 minutes. Carefully aspirate the supernatant without touching the pellet. Place the centrifuge tube in a clean bench for 5-10 minutes to allow the pellet to completely dry.

[0054] j. After the precipitate has dried, add an appropriate amount of RNase-free water to dissolve the precipitate to obtain total RNA. Take an appropriate amount of RNA for RNA purity analysis and store it in a -80°C freezer for subsequent research.

[0055] 2. Synthesis of the First Strand of cDNA

[0056] First-strand cDNA synthesis was performed according to the instructions of the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, #KR116).

[0057] First, thaw the template RNA on ice and thaw all components in the kit at room temperature. After thawing, quickly place them on ice. Make sure to mix all components thoroughly before use.

[0058] Prepare the gDNA removal mixture in a 200 μL RNase-free centrifuge tube as shown in the table below.

[0059]

[0060] Gently and thoroughly mix the above components, centrifuge briefly, incubate at 42°C for 3 minutes, and immediately place on ice. Then, prepare the mixed solution according to the reverse transcription reaction system in the table below.

[0061]

[0062]

[0063] Add the reverse transcription reaction mixture to the gDNA removal system mixture, mix gently, and incubate at 42°C for 15 minutes;

[0064] Incubate at 95°C for 3 minutes and immediately place on ice. The prepared cDNA can be used immediately for PCR reaction or stored at -20°C.

[0065] 3. Cloning and Sequencing of Open Reading Frames

[0066] Acquisition of TaNF-YC8 gene

[0067] TaNF-YC8 gene-specific amplification was performed according to the instructions of the Phanta Max Super-Fidelity DNA Polymerase Kit (Vazyme, #P505).

[0068] The TaNF-YC8 gene information was obtained using the wheat genome website WheatOmics (http: / / 202.194.139.32 / ), and specific primers for gene amplification were designed based on the gene sequence.

[0069] TaNF-YC8-F:5'-ATGAGGAAGAAGCTCGACACC-3'

[0070] TaNF-YC8-R:5'-TCATTCTTCATTGTCATAGTCTTCG-3'

[0071] Thaw all components of the kit on ice and mix thoroughly. Store back to -20°C immediately after use. Prepare the amplification system according to the following table:

[0072]

[0073] The PCR reaction conditions were as follows: pre-denaturation: 95°C, 3 min; (denaturation: 95°C, 15 sec; annealing: 56°C, 15 sec; extension: 72°C, 1 min / kb) × 35 cycles; post-extension: 72°C, 10 min.

[0074] After the PCR reaction was completed, the PCR products were separated using agarose gel and the target bands were detected.

[0075] 4. DNA Purification and Recovery

[0076] DNA purification and recovery were performed according to the instructions of the universal DNA purification and recovery kit (TIANGEN, #DP214).

[0077] After the amplified fragment was recovered, it was ligated with the pEASY-Blunt3 vector (TransGen Biotech, #CB301) and transformed into Escherichia coli Trans1-T1 (TRANS, #CD501). Subsequently, Sanger sequencing was performed to screen the Escherichia coli containing the target gene plasmid and store it for future use.

[0078] 5. Gene Expression Analysis (RT-PCR)

[0079] (1) Salt stress treatment

[0080] a. Select wheat varieties SR3 and JN177 with consistent plumpness and disinfect them by soaking them in 1% sodium hypochlorite.

[0081] b. After 30 minutes, rinse the wheat kernels with running water, place them in a conical flask, and soak them in 1 / 2 Hoagland culture medium containing 150 mM NaCl for 12 hours.

[0082] c. Place the soaked wheat grains in 10×10 cm Petri dishes containing 10 mL of NaCl culture medium of the corresponding concentration;

[0083] d. Select wheat seedlings with uniform germination and place them evenly in a hydroponic box. Add the appropriate culture medium to the box and culture it in a light-controlled culture room for 10 days.

[0084] e. Young leaves and roots were collected at 0, 6, 12, 24 and 48 hours after treatment and stored in liquid nitrogen.

[0085] (2) Extract RNA from selected leaves (same method as above)

[0086] (3) Reverse transcription (RT) to produce cDNA (same method as above)

[0087] (4) RT-PCR analysis

[0088] RT-PCR (Reverse Transcription-Polymerase Chain Reaction) analysis was performed according to The specific operation procedures are as follows:

[0089] a. Perform PCR using cDNA as template. The primers are as follows:

[0090] TaNF-YC8-RT-F:5'-CCTCGGATTAAGAAGATCATGCAAGC-3'

[0091] TaNF-YC8-RT-R:5'-GATGTGATGAACTCACTGTTTTGACC-3'

[0092] b. Thaw all components of the kit on ice and mix thoroughly. After use, store them back at -20°C. Prepare the amplification system according to the following table:

[0093]

[0094] PCR procedure:

[0095] Pre-denaturation: 94°C, 30 sec; (denaturation: 94°C, 5 sec; annealing: 56°C, 15 sec; extension: 72°C, 10 sec) × 40 cycles. Adjust the number of PCR cycles and the amount of cDNA template added based on the amplification of the internal control Actin.

[0096] See the results Figure 1 .

[0097] Example 2 Construction of plant gene knockout vector

[0098] Construction of pBUE411-TaNF-YC8 plant gene knockout vector. Using the CRISPR / Cas9 system for wheat genome gene editing, we first used the CRISPRdirect online tool (http: / / crispr.dbcls.jp / ) to target the conserved region of the first exon of TaNF-YC8 to design two single-stranded sgRNAs (sgRNA1:TGCATGATCTTCTTAATCCGAGG (SEQ ID NO.2); sgRNA2:ATGCAAGCAGATGAAGATGTCGG (SEQ ID NO.3)). By artificially synthesizing the sgRNA1-TaU3 terminator-OsU3 promoter-sgRNA2 sequence (SEQ ID NO.4), we constructed a pBUE411-TaNF-YC8 plant gene knockout vector. The fragment was cloned into the plant expression vector pBUE411 according to the instructions of the Golden Gate Assembly Kit (NEW ENGLANG, D Biolabs, #1602). The construction process of the pBUE411 plasmid is described in the literature: Xing, HL, L. Dong, ZP Wang, HY Zhang, CY Han et al., 2014 A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 14:327.

[0099] The specific construction process of the pBUE411-TaNF-YC8 plant gene knockout vector is as follows:

[0100] a. Add 1 μL of the pBUE411 target plasmid (75 ng / μL), the synthetic sgRNA1-TaU3 terminator-OsU3 promoter-sgRNA2 sequence (2:1 molar ratio to the vector fragment), 2 μL of T4 DNA Ligase Buffer (10×), 1-2 μL of NEBridge Golden Gate Enzyme Mix (BsaI-HFv2), and Nuclease-free HO to a centrifuge tube. Make up to 20 μL.

[0101] b.37℃, 5min; 60℃, 5min;

[0102] c. Remove 50 μL of E. coli Trans1 T1 competent cells (TRANS, #CD501), partially thaw at room temperature, and immediately place on ice;

[0103] d. Add 2 μL of the ligation product to the competent cells, mix gently, and place on ice for 30 minutes; in a 42°C metal bath for 30 seconds, and on ice for 5 minutes;

[0104] e. Add 950 μL of LB liquid medium and incubate at 37°C for 60 minutes. Pipette 100 μL of the recovered bacterial solution onto solid LB medium with the corresponding resistance of the vector. After air drying in a clean hood, incubate upside down at 37°C for 24 hours.

[0105] f. After a single colony is grown, pick a single clone for colony PCR identification, screen out the positive clone, and sequence the PCR product of the positive clone to verify.

[0106] Example 3. Preparation and transformation of competent Agrobacterium

[0107] Transformation of Agrobacterium EHA105 competent cells was performed according to the instructions of the Agrobacterium competent cell kit (Qingke Biotechnology, #TSC-A03 and TSC-A01).

[0108] a. Take out 50 μL of Agrobacterium competent cells, place them at room temperature to partially thaw, and immediately place them on ice;

[0109] b. Add plasmid pBUE411-TaNF-YC8 (0.01-1 μg) to the competent cells, mix gently, and place on ice for 5 minutes; place in liquid nitrogen for 5 minutes, in a 37°C metal bath for 5 minutes, and on ice for 5 minutes;

[0110] c. Add 950 μL YEP liquid medium and resuscitate at 28°C for 3-4 hours;

[0111] d. Pipette 100 μL of the recovered bacterial solution onto solid YEP medium containing the corresponding carrier resistance and rifampicin antibiotics. After air-drying in a clean hood, incubate inverted at 28°C for 24-48 hours.

[0112] e. After a single colony is grown, pick a single clone for colony PCR identification, screen out the positive clone, and sequence the PCR product of the positive clone to verify.

[0113] Example 4: Verification of transgenic function

[0114] 1. Wheat genetic transformation

[0115] After obtaining Agrobacterium containing the pBUE411-TaNF-YC8 vector, wheat was genetically transformed using Agrobacterium-mediated genetic transformation. The wheat variety Fielder was the recipient of this wheat gene editing genetic transformation.

[0116] a. First, pick the wheat ears 13-16d after flowering, then separate the ears from the filling and immature seeds and place them in a centrifuge tube;

[0117] b. Add 70% alcohol to the centrifuge tube for 1 minute, and then treat with sodium hypochlorite solution with an effective chlorine concentration of 5% for 15 minutes;

[0118] c. After disinfection, rinse the seeds three times with ddH2O to clean them;

[0119] d. Remove immature embryos of wheat seeds in a clean bench and place them in a centrifuge tube;

[0120] e. Select the activated Agrobacterium colonies, add MG / L liquid medium without antibiotics, and culture in a 28°C incubator for 12 hours;

[0121] f. Centrifuge to collect the Agrobacterium suspension and resuspend it in WLS-inf liquid medium. Transfer the suspension to the centrifuge tube containing the wheat embryos and invert it to ensure adequate infection. Remove the suspension and add fresh WLS-inf liquid medium.

[0122] g. After infection, the immature embryos were transferred to CIM (Callus Induction Medium) and cultured at 28°C in the dark for 5 days.

[0123] h. After successful callus culture, the material was transferred to regeneration medium, 68μmol / m 2 The cells were cultured at 25°C for 14 days under a light intensity of 1 / s.

[0124] i. Transfer the regenerated wheat seedlings to a rooting medium and culture them under light conditions for 14 days to allow adventitious roots to grow. Finally, transplant the rooted wheat seedlings into a pot filled with nutrient soil.

[0125] 2. Identification of wheat mutant materials

[0126] a. Select approximately 0.1 g of leaves from the T0 generation mutant material and extract genomic DNA from the mutants;

[0127] b. PCR analysis of target editing sites using mutant genomic DNA

[0128] (TaNF-YC8-KO-Hi-TOM-FF:

[0129] ggagtgagtacggtgtgcACTACTTTTCAGATGGTATCAT;

[0130] TaNF-YC8-KO-Hi-TOM-RR:gagttggatgctggatggGGAACTGATAAGAGGCGA);

[0131] c. Use the Hi-TOM platform to detect target editing and select materials with loss-of-function mutations as positive mutants;

[0132] d. Embryo rescue of positive mutants to quickly obtain T1 generation mutants;

[0133] e. Using the Basta test kit to detect T1 generation mutants, Basta-negative mutants were selected;

[0134] f. Extracting genomic DNA of Basta-negative mutants and performing PCR to detect whether the Cas9 gene is negative;

[0135] g. Select Cas9-negative mutants for target editing site PCR and perform Hi-TOM detection again;

[0136] h. The mutant was self-crossed and propagated continuously until a homozygous mutant of the target site was obtained. Figure 2 .

[0137] 3. Phenotypic Verification of Wheat Seedlings

[0138] a. Select wheat grains of uniform plumpness, disinfect them by soaking them in 1% sodium hypochlorite for 30 minutes, rinse them with running water, and place them in a triangular flask;

[0139] b. Add 1 / 2 Hoagland culture medium containing different concentrations of salt (0 mM and 150 mM NaCl) to soak the seeds. After soaking for 12 hours, the wheat grains were placed in a 10×10 cm culture dish containing 10 mL of culture medium containing the corresponding salts and germinated in a dark incubator at 20°C for 36 hours.

[0140] c. Select wheat seedlings with uniform germination and place them evenly in a hydroponic box. Add the appropriate culture medium to the box and culture it in a light-lit room for 10 days.

[0141] d. After 10 days, growth parameters (root length, plant height, and fresh weight, etc.) were tested. During normal growth, there was no significant difference in plant height, root length, and fresh weight between the TaNF-YC8 mutants (nf-yc8-1, nf-yc8-2) and the control wheat Fielder. However, when treated with 150 mM NaCl, the plant height, root length, and fresh weight of the TaNF-YC8 mutants were higher than those of Fielder, indicating that knocking out TaNF-YC8 promoted wheat resistance to salt stress. Figure 3 .

[0142] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of the TaNF-YC8 gene or a biomaterial targeting the TaNF-YC8 gene in at least one of the following: (A1) Application in regulating salt tolerance in wheat; (A2) Application in wheat breeding; (A3) Application in breeding salt-tolerant wheat; (A4) Application in molecular breeding for improving salt tolerance in wheat or in improving germplasm resources related to salt tolerance; The cDNA sequence of the TaNF-YC8 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The regulation is: inhibiting or down-regulating the expression level of the TaNF-YC8 gene to promote the resistance of wheat to salt stress.

3. The use according to claim 1, characterized in that The biological material includes a recombinant vector, a recombinant microorganism or an expression cassette.

4. The use according to claim 1, characterized in that By inhibiting the expression of the TaNF-YC8 gene, the salt tolerance of wheat is regulated and salt-resistant wheat germplasm is cultivated.

5. Use of a substance for inhibiting the expression of TaNF-YC8 gene in any of the following: (B1) Application in regulating salt tolerance in wheat; (B2) Application in wheat breeding; (B3) Application in breeding salt-tolerant wheat; (B4) Application in molecular breeding for improving salt tolerance in wheat or in improving germplasm resources related to salt tolerance.

6. The use according to claim 5, characterized in that The substance includes a substance that inhibits the replication, transcription, translation, post-transcriptional modification and / or post-translational modification of the TaNF-YC8 gene.

7. The use according to claim 5 or 6, characterized in that The substance is sgRNA or a CRISPR / Cas9 system containing the sgRNA.

8. A method for cultivating salt-tolerant plants, characterized in that: The method comprises inhibiting or reducing the expression of TaNF-YC8 gene in target plants, thereby obtaining plants with improved salt tolerance.

9. The method according to claim 8, characterized in that The inhibition or reduction of the expression of the TaNF-YC8 gene in the target plant is performed using the CRISPR / Cas9 system, which includes an sgRNA targeting the TaNF-YC8 gene.

10. The method according to claim 9, characterized in that The target sequences of sgRNA are shown in SEQ ID NO.2 and SEQ ID NO.3.