Application of P5CR and / or P5CDH genes in improvement of rice fragrance quality

Abstract

The invention discloses an application of P5CR and / or P5CDH genes in improvement of rice fragrance quality. According to the invention, expression of endogenous P5CR and P5CDH of rice is knocked down by using a transgenic means, and proline and 2-AP content, yield, resistance and other agronomic traits of transgenic rice are analyzed. Preliminary research results show that knock-down of the expression of P5CR and P5CDH can increase the accumulation of proline, greatly increase the content of 2-AP and further improve the rice fragrance, and at the same time has no adverse effect on the agronomic traits of fragrant rice. The method provided by the invention can improve the fragrance quality of the rice variety, and is beneficial to increasing the market economic value of the rice variety.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to the application of P5CR and / or P5CDH genes in improving the aroma quality of rice. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop worldwide. Aromatic rice, known as a treasure among rice varieties, exudes a unique and pleasant aroma during cooking. In recent years, demand for aromatic rice has continued to increase both domestically and internationally. Aroma is a key factor in determining the price of aromatic rice in international trade, with high-quality aromatic rice fetching three times the price of non-aromatic rice. Currently, aroma has become a key indicator of quality in the evaluation system for high-quality indica rice in southern my country. Therefore, breeding high-quality aromatic rice has important economic and social benefits for establishing premium rice brands, improving agricultural quality and efficiency, and increasing farmers' incomes.

[0003] 2-Acetyl-1-pyrroline (2AP) is a characteristic aroma component common to all fragrant rice varieties. Factors such as fragrant rice variety, cultivation method, climate conditions, and storage methods all influence 2AP accumulation. The 2AP content in rice grains is a key determinant of rice price. Therefore, research on increasing 2AP content in rice grains is crucial for enhancing the economic value of fragrant rice. Summary of the Invention

[0004] In order to overcome the problems existing in the prior art, one of the objectives of the present invention is to provide an application of P5CR and / or P5CDH genes in improving the aroma quality of rice.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] Application of P5CR and / or P5CDH genes in improving the aroma quality of rice.

[0007] Furthermore, the nucleotide sequence of the P5CR gene is shown as SEQ ID NO.1, and the nucleotide sequence of the P5CDH gene is shown as SEQ ID NO.2.

[0008] Furthermore, the application is: knocking down the expression of P5CR and / or P5CDH genes in rice grains to improve the aroma quality of rice.

[0009] Furthermore, the knockdown of the expression of P5CR and / or P5CDH genes in rice grains can be achieved by miRNA-induced gene silencing (MIGS), RNA interference (RNAi), and the like.

[0010] Furthermore, the MiRNA-induced gene silencing method comprises the following steps:

[0011] S1. Insert the gene fragments of P5CR and / or P5CDH genes into the pZHY932 vector, and replace the ubi promoter in the pZHY932 vector with the endosperm-specific promoter LOC_Os03g31360 to obtain recombinant vectors for knocking down the P5CR and / or P5CDH genes, respectively;

[0012] S2. The recombinant vector is transformed into callus tissue through Agrobacterium-mediated transformation. After screening of resistant callus tissue and plant regeneration, rice with knockdown of P5CR and / or P5CDH genes is obtained.

[0013] Furthermore, when the knocked-down gene is P5CR, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.4;

[0014] When the knockdown gene is P5CDH, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.5;

[0015] When the knockdown genes are P5CR and P5CDH, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.6;

[0016] The nucleotide sequence of the endosperm-specific promoter LOC_Os03g31360 is shown in SEQ ID NO.3.

[0017] Furthermore, the specific operations of step S1 are:

[0018] (1) Using rice DNA as a template, primers LOC_Os03g31360F and LOC_Os03g31360R were used for PCR amplification to obtain the endosperm-specific promoter LOC_Os03g31360 gene fragment;

[0019] (2) Using rice DNA as a template, PCR amplification was performed using primers OsP5CR-2F and OsP5CR-2R to obtain an OsP5CR gene fragment; PCR amplification was performed using primers OsP5CDH-2F and OsP5CDH-2R to obtain an OsP5CDH gene fragment; PCR amplification was performed using primers OsP5CR-2F and OsP5CDH-2R to obtain an OsP5CR-OsP5CDH gene fragment;

[0020] (3) Selecting vector pZHY932 as the backbone vector for vector construction, Sbf I and Sma I as the restriction enzyme sites for vector construction, and connecting the OsP5CR, OsP5CDH or OsP5CR-OsP5CDH gene fragment obtained in step (2), and the endosperm-specific promoter LOC_Os03g31360 gene fragment obtained in step (1) with the backbone vector by homologous recombination method to obtain recombinant vectors for knocking down the P5CR and / or P5CDH genes, respectively.

[0021] Among them, the sequence of the primer pair for PCR amplification is:

[0022] LOC_Os03g31360F:5'-ccgaatcggggggatcctgcaggGTTCTACAAACCGAACTAGCTGTGAAAC-3';

[0023] LOC_Os03g31360R:5'-TTCGCTTGTAGAGAAAAATCACGTTTTTGTGGGACTGAACT CA-3';

[0024] OsP5CR-2F: 5'-GATTTTTCTCTACAAGCGAAatcggcccgggtaacctc-3';

[0025] OsP5CR-2R: 5'-CAACATGGGAGTCCAAGATTACAGCAAGGGTTTTAGCTC-3';

[0026] OsP5CDH-2F: 5'-GATTTTTCTCTACAAGCGAAgcctcatccttTCCCGG-3';

[0027] OsP5CDH-2R: 5'-CAACATGGGAGTCCAAGATTTAAACTCTCTACAAATGGC-3'.

[0028] Furthermore, the Agrobacterium is EHA105 Agrobacterium.

[0029] Furthermore, the improved rice aroma quality includes: increasing the content of aroma substances in rice grains.

[0030] Furthermore, the rice grain aroma substance includes 2-acetyl-1-pyrroline (2AP).

[0031] Furthermore, the rice is fragrant rice.

[0032] Furthermore, the aromatic rice includes japonica aromatic rice.

[0033] Furthermore, the japonica aromatic rice includes Yunjingyou 14.

[0034] Application of the above-mentioned MiRNA-induced gene silencing method in preparing transgenic plants.

[0035] Furthermore, the application comprises the following steps: cultivating the obtained rice with knocked-down expression of P5CR and / or P5CDH genes into plants.

[0036] The present invention has the following advantages and effects compared to the prior art:

[0037] This study used transgenic methods to knock down the expression of endogenous rice genes P5CR and P5CDH. The results were then analyzed to determine the proline and 2-AP content, as well as agronomic traits such as yield, in the transgenic rice. Preliminary results showed that knocking down P5CR and P5CDH expression increased proline accumulation and significantly boosted 2-AP content, further enhancing rice aroma while maintaining a negative impact on the agronomic traits of aromatic rice.

[0038] The method provided by the present invention can improve the aroma quality of rice varieties, which is beneficial to increasing their market economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the result of proline content test in brown rice of genetically modified material;

[0040] Figure 2 This is the result graph of the pyrroline-5-carboxylic acid (P5C) content in brown rice of genetically modified material;

[0041] Figure 3 This is the result of the detection of 2-acetyl-1-pyrroline (2-AP) content in brown rice, a genetically modified material;

[0042] Figure 4 The results of agronomic traits determination of transgenic materials are shown in Figure 1. A is grain length, B is grain width, C is thousand-grain weight, and D is a photograph.

[0043] In the figure, * indicates significant difference compared with the control (P<0.05), and ** indicates extremely significant difference compared with the control (P<0.01). DETAILED DESCRIPTION

[0044] The present invention will be described in further detail below with reference to embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0045] Unless otherwise defined, all scientific and technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention relates.

[0046] The gene fragments and their sequences involved in the following examples are as follows:

[0047] The promoter of LOC_Os03g31360 (2033bp, SEQ ID NO.3):

[0048] GTTCTACAAACCGAACTAGCTGTGAAACTGCATTTGGCAGAATAGTCTAAGCAAAA

[0049] TCTGATTCTAAACGATGAAGGCTACTGAATAAATTTGATTAGGGATGTCCTAAGGTTAGC

[0050] CCTAGGGCATCTACCCCTTGGTCTTAGCCCATGACATAATTACAAGGTCCAAGGCCAAAT

[0051] CAGACTTGGTCAGGATAAGGTACGTGGCTTGTTTTGCATATTCCTAACAACTTAGGAGAT

[0052] GAAAGTATACTCCATAAGCTTTCCAACGAGTACTCATGGACTGTGAGAGTTGTAGTTCCT

[0053] CATCAACATCCTAACATAGTCCATGGGCCTCCGTTTGAAGTTGATGCTGTCAGAAGGCCC

[0054] GAATCCGAATTCAAAATGTACAGAACTTAATGTCTTGCCTCTTGTGGACCAAAAGTGAC

[0055] GTGGTGATGTAGGAGTAGACTAAGGAATGTCACTTATTTGATCATCCATTCATCCCTTGCG

[0056] TTCGGTGTCTTTCCCGTCACCCAAAAACGTAACTCTGCAAATAAGAACACACAAAACTC

[0057] ATGGTGCAATAATATTTGTTCAAATATATAACACATAAATCTTACATAGAATACATGCACCT

[0058] TTGGTTGATATATAGATAATGTAGCCATGGTCATATCCGAACTAGTGTTGTCCTCATCACAT

[0059] CACTTTTGAAGGAACCTATATGCCTAGACCATGATGTTTTACAAGACATGCATTTTTTCCA

[0060] TGCATTTACCTAACCTCATATCTCAAAGTGGAATTCAACCAAATGAAGTTAAACTTGCGG

[0061] CAATGGTTAAATTTCTTATAACTTAGGAGAAAAATCCCACCGTCTAAACATGGGCTAAAG

[0062] TATGGCTGATGTAATTTCCCAACGCATAAAATGGTTCTATGAGAAGTGCTTCTTGCTAAG

[0063] GTATATGTCCCTGAATTCATTGCAGTAAAGGCTTTGTGGGATGTCTCCTACAGCCAAGGC

[0064] TTTCCTCGGCTGTAACTGTCCCATTTGTTACGTGTTTTCTTTGCTTTCTAAAATGAAGACA

[0065] TGCAATCTACCTGAAAACAAATTGTTCTAGAAGAAAGATAAATAACCGAAACTATTTGG

[0066] AGAGCATTCAGGTTACATGGTTAGTCCATGGTGCTAGATATTGCTATATAATACTCAATGC

[0067] AATGCTCAATAGATATAAGTTTCAAAGCTGTATAAGAATTTTAGGTTAGTGTGCAATGTAA

[0068] GTGTAGCTTCTTATAGCTTAGTGCTTTACTATCTTCACAAGCACATGCTATAGTATTGTTCC

[0069] AAGATGAAAGAATAATTCATCCTTGCTACCAACTTGCATGATATTATATTTGTGAATATCCT

[0070] ATCCTTGGCTTATATAATGAAATGTGCTGCTGGGTTATACCTGACCATGGTATTTGAGAGAC

[0071] CTTTGTATAGCTGAAACCAACGTATATGCGAGCATGGAACAAGAGAACAAAATGCAAGG

[0072] ATTTTTTATACTGGTTCATGCCCCTGGATGGGTTAATATCGTGATCATCAAAAAAGATAT

[0073] GCATAAAATTAAAGTAATAAATTTGCTCATAAGAAACCAAAACCAAAAGCACATATGTCC

[0074] TAAACAAACTGCATTTTGTTTGTCATGTAGCAATACAAGAGATAATAATATGACGTGGTTAT

[0075] GACTTATTCACTTTTTGTGACTCCAAAATGTAGTAGGTCTAACTGATTGTTTAAAGTGATG

[0076] TGCTTACTGTAGAAGTTTCATCCCAAGCAATCACTAAAGCAACACACAACGTATAGT

[0077] CCACCTTGCACGTAATTCTTTGTGGAAGATAACAAGAAGGCTCACTGAAAAATAAAAGC

[0078] AAAGAAAAGGATATCAAACAGACCATTGTGCATCCCATTGATACTTGTATGTCTATTTATC

[0079] TATCCACCTTTTGTGTACCTTACTTCTATCTAGTGAGTCACTTCATATGTGGACATTAACA

[0080] AACTCTATCTTAACATCTAGTCGATCACTACTTTACTTCACTATAAAAGGACCAACATATATCACCATTTCTCACAAAAGCATTGAGTTCAGTCCCACAAAAAC。

[0081] OsP5CR gene fragment (241 bp, SEQ ID NO.4):

[0082] ATCGGCCCGGGTAACCTCGCGGAGAGCATCGCCCGCGGCGTGGCGGCGTCGGGCGTCCTCCCGGCCACCGCGATCCGCACCGCGCCACACCGCCGCCCCGAGCGCGCCGAGGCCTTCTCATCCATCGGAGCTCACATCTTGGAGACCAACGCGCAGGTAGTTGATGACAGTGACGTGATCGTCATCTCTGTGAAGCCGCAGATCGTAAGGCAGGTACTGGTTGAGCTAAAACCCTTGCTGT;

[0083] OSP5CDH gene fragment (272 bp, SEQ ID NO.5):

[0084] GCCTCATCCTTTCCCGGCGGCGCCTCGCCGCCGCCGTCCGGCGGTCAGGCCCCGCCGCGCTCGCCTCCAGGTGGATGCACACGCCGCCATTCGCGACGGTGTCTCCTCAGGAAATTTCAGGTTCGAGCCCGGCGGAAGTGCAGAATTTTGTGCAGGGCAGTTGGACAACATCTGGTAACTGGAATTGGCTAGTTGATCCTTTAAATGGTGAAAAATTTATCAAAGTTGCTGAGGTTCAGGAAGCAGAAATAAAGCCATTTGTAGAGAGTTTA;

[0085] OsP5CR - OSP5CDH gene fragment (535 bp, SEQ ID NO.6):

[0086] .

[0087] The japonica aromatic rice variety Yunjingyou 14 involved in the following embodiments has been disclosed in the document "Xie Wenjun. Effects of γ-aminobutyric acid (GABA) and light on aroma accumulation and yield quality of aromatic rice [D]. South China Agricultural University, 2020."

[0088] The rice RNAi backbone vector pZHY932 involved in the following examples has been disclosed in the document “CN105349575A A Construction and Application of Rice RNAi Backbone Vector Based on Artificial tasiRNA Pathway”.

[0089] Example 1

[0090] 1. To knock down the expression of OsP5CR (nucleotide sequence shown in SEQ ID NO. 1) and / or OsP5CDH (nucleotide sequence shown in SEQ ID NO. 2), we employed miRNA-induced gene silencing (MIGS). Based on existing RNA-seq data, we identified an endosperm-specific promoter, LOC_Os03g31360 (nucleotide sequence shown in SEQ ID NO. 3), and replaced the ubi promoter in the pZHY932 vector with this endosperm-specific promoter. The specific method is as follows:

[0091] 1.1 Obtaining the endosperm-specific promoter LOC_Os03g31360 gene fragment:

[0092] Appropriate samples were selected from the Southern University of Science and Technology RNA-seq database (https: / / ipf.sustech.edu.cn / pub / ricerna / ). The selection criteria were: Nipponbare variety; wild-type genotype; experimental treatment as control; and paired-end sequencing data from 2019 onwards. Data were downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Sequencing data were quality-controlled using Fastqc software, with the first 10 bp of adapter sequences removed and sequences with a quality score less than 30 filtered. Clean data files were generated after filtering. The clean data, after quality control and filtering, were aligned to the reference genome using HISAT2 software. The reference genome file (genome) and genome annotation file (gtf) were from the Rice RGAP project (http: / / rice.uga.edu / index.shtml). Expression quantification was performed using featureCounts software, and expression matrices were merged. Tissue-specific expression analysis of the gene expression matrix was performed using TBtools software to generate tissue-specific expression results. The tissue-specific results were sorted and screened. The closer the TAUindex is to 1, the higher the gene's specific expression level in that tissue. A TAUindex of 1 indicates that the gene is specifically expressed in that tissue. Finally, a gene with high endosperm expression, LOC_Os03g31360 (0.981399545), was selected.

[0093] Using rice DNA as a template, primers LOC_Os03g31360F and LOC_Os03g31360R were used for PCR amplification to obtain the endosperm-specific promoter LOC_Os03g31360 gene fragment. The PCR amplification reaction conditions were: 95°C for 5 min; 95°C for 40 s, 58°C for 50 s, and 72°C for 3 min, 35 cycles; 72°C for 10 min. The sequences of the PCR amplification primers were:

[0094] LOC_Os03g31360F:5'-ccgaatcggggggatcctgcaggGTTCTACAAACCGAACTAGCTGTGAAAC-3';

[0095] LOC_Os03g31360R:5'-TTCGCTTGTAGAGAAAAATCACGTTTTTGTGGGACTGAACT CA-3'.

[0096] 1.2 Obtaining OsP5CR, OsP5CDH and OsP5CR-OsP5CDH gene fragments from rice:

[0097] (1) Using rice cDNA as a template, PCR amplification was performed using primers OsP5CR-2F and OsP5CR-2R to obtain the OsP5CR gene fragment; using rice cDNA as a template, PCR amplification was performed using primers OsP5CDH-2F and OsP5CDH-2R to obtain the OsP5CDH gene fragment; using rice cDNA as a template, PCR amplification was performed using primers OsP5CR-2F and OsP5CDH-2R to obtain the OsP5CR-OsP5CDH gene fragment; the PCR amplification reaction conditions were: 95°C for 5 min; 95°C for 40 s, 58°C for 50 s, and 72°C for 3 min, 35 cycles; 72°C for 10 min; the sequences of the PCR amplification primers were:

[0098] OsP5CR-2F: 5'-GATTTTTCTCTACAAGCGAAatcggcccgggtaacctc-3';

[0099] OsP5CR-2R: 5'-CAACATGGGAGTCCAAGATTACAGCAAGGGTTTTAGCTC-3';

[0100] OsP5CDH-2F: 5'-GATTTTTCTCTACAAGCGAAgcctcatccttTCCCGG-3';

[0101] OsP5CDH-2R: 5'-CAACATGGGAGTCCAAGATTTAAACTCTCTACAAATGGC-3'.

[0102] (2) Electrophoresis detection: After PCR amplification, gel electrophoresis detection is performed, and the results show the target band.

[0103] (3) Purification of target fragment: After electrophoresis, the PCR product is purified.

[0104] 1.3 Construction of recombinant vector

[0105] (1) Based on the cloned OsP5CR, OsP5CDH and OsP5CR-OsP5CDH gene fragments and the endosperm-specific promoter LOC_Os03g31360, the vector pZHY932 was selected, Sbf I and Sma I were used as restriction enzyme sites for vector construction, and the purified vector backbone and the target fragment were connected by homologous recombination.

[0106] (2) Heat shock transformation of DH5α strain was performed, and screening was performed on LB plates containing kanamycin and colony PCR was performed. The positive plasmids with correct sequencing results were selected and named p932-OsP5CR, p932-OsP5CDH, and p932-OsP5CR / OsP5CDH, and stored at -20°C for future use.

[0107] 1.4 Transformation of recombinant vector into EHA105 Agrobacterium

[0108] (1) Place 5 μL of plasmid (about 500 ng) and EHA105 competent Agrobacterium cells on ice for 5 min, freeze in liquid nitrogen for 5 min, heat shock in a 37°C water bath for 5 min, and finally place on ice for 5 min.

[0109] (2) Activate in a shaker at 200 rpm for 2 h at 28°C;

[0110] (3) The transformed bacterial solution was spread on an LB plate containing spectinomycin and rifampicin antibiotics to screen and obtain positive strains.

[0111] 1.5 Transformation of callus tissue

[0112] (1) Obtaining rice callus from mature embryos:

[0113] 1) Take mature Yunjing You 14 seeds that are well-filled and free of mildew and lesions, and use a small rice huller to remove the husks, leaving intact rice kernels.

[0114] 2) In a clean bench, add an appropriate amount of rice to a sterile Erlenmeyer flask. Sterilize the surface with 75% alcohol for 1 minute, then rinse 3-5 times with sterile distilled water.

[0115] 3) Add 10% sodium hypochlorite solution, add sealing film, and sterilize in a shaker at room temperature at 160 rpm for 30 minutes;

[0116] 4) Discard the sodium hypochlorite solution, rinse the seeds 3-5 times with sterile distilled water, transfer to sterile filter paper, and air-dry until the surface turns white.

[0117] 5) Transfer the seeds to callus induction medium plates and culture at 30°C in the light for 4-6 days;

[0118] (2) Agrobacterium-mediated transformation of rice callus:

[0119] 1) Streak agar plates containing 50 mg / L kanamycin and 50 mg / L rifampicin (containing EHA105 Agrobacterium tumefaciens strains containing p932-OsP5CR, p932-OsP5CDH, and p932-OsP5CR / OsP5CDH plasmids stored at -80°C and incubate at 28°C for two days.

[0120] 2) Pick a single colony and incubate in 5 mL of LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampicin) at 28°C and 200 rpm for 24 hours.

[0121] 3) Add 50 μL of the bacterial suspension from the previous step to 50 mL of LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampicin) and incubate at 28°C, 200 rpm, until the absorbance OD600 reaches 0.5;

[0122] 4) Centrifuge the culture at 6000 rpm for 10 minutes at room temperature, discard the supernatant, and collect the precipitated cells. Resuspend the cells in AAM liquid medium (containing 150 μM acetosyringone) and adjust the OD600 to 0.1.

[0123] 5) In a laminar flow hood, select pale yellow, compact, healthy rice callus tissue (1-2 mm in size) and immerse it in the prepared bacterial resuspension solution. Gently shake for 1 minute.

[0124] 6) Discard the culture medium, rinse 2-3 times with sterile distilled water, and then air-dry on sterile filter paper;

[0125] 7) Place a piece of filter paper soaked in liquid co-cultivation medium on the surface of the solid co-cultivation medium, spread the callus tissue on it, and culture in a dark room at 25-26°C for 2 days;

[0126] (3) Screening of resistant callus and plant regeneration:

[0127] 1) Transfer the dark-cultured callus to a sterile Erlenmeyer flask, rinse five times with sterile distilled water, add sterile distilled water containing 500 mg / L cephalosporin, and shake at 160 rpm for 20 minutes. Remove the callus and air-dry it on sterile filter paper.

[0128] 2) Callus tissue was transferred to selective medium and cultured in the dark at 30°C, with fresh selective medium replaced every two weeks;

[0129] 3) After the callus on the selective medium develops into bright yellow granular resistant callus, it is transferred to the selective differentiation medium and cultured at 30°C under light. The differentiation medium is replaced every two weeks.

[0130] 4) After the callus tissue grows into resistant green shoots, it is transferred to rooting medium and cultured at 30°C with 16 hours / day light intensity;

[0131] 5) After 3-4 weeks, when the resistant seedlings have taken root, select the plants with well-developed root systems, open the top cover and add distilled water to harden the seedlings;

[0132] 6) PCR identification of transgenic plants, PCR primer sequences are as follows:

[0133] OsP5CR-F: 5'-GATTTTTCTCTACAAGCGAAatcggcccgggtaacctc-3';

[0134] OsP5CR-R: 5'-tcttcatatctcgagcccgggGATCTGATAATTTATTTGAAA-3'.

[0135] OsP5CDH-F: 5'-GATTTTTCTCTACAAGCGAAgcctcatccttTCCCGG-3';

[0136] OsP5CDH-R: 5'-tcttcatatctcgagcccgggGATCTGATAATTTATTTGAAA-3'.

[0137] OsP5CR / OsP5CDH-F: 5'-GATTTTTCTCTACAAGCGAAgcctcatccttTCCCGG-3';

[0138] OsP5CR / OsP5CDH-R: 5'-tcttcatatctcgagcccgggGATCTGATAATTTATTTGAAA-3'.

[0139] Finally, we successfully obtained the transgenic lines OsP5CR-KD, OsP5CDH-KD and OsP5CR / OsP5CDH-KD with single knockdown of OsP5CR, single knockdown of OsP5CDH and simultaneous knockdown of OsP5CR and OsP5CDH genes.

[0140] 2. Test materials and sample collection

[0141] The transgenic plants were grown in a transgenic experimental field at South China Agricultural University and cultivated using conventional water and fertilizer management methods. At harvest, seeds were collected from individual plants, and the grains were naturally air-dried.

[0142] 3. Determination of proline content in aromatic brown rice

[0143] The proline content in aromatic brown rice was determined according to the method of Bates et al. (1973). The specific steps are as follows: First, weigh 0.3 g of hulled aromatic brown rice, grind it into a powder using liquid nitrogen, and add 4 mL of 3% sulfosalicylic acid solution. Transfer the rice to a glass test tube and heat it in a 100°C water bath for 30 minutes. Then remove the rice and allow it to cool naturally to room temperature. Aspirate 2 mL of the supernatant, then add 2 mL of glacial acetic acid and 2 mL of 3% ninhydrin solution, respectively. Heat the test tube in a 100°C water bath for 30 minutes. After cooling naturally, add 4 mL of toluene, shake thoroughly, and let it stand for 10 minutes to allow for liquid phase separation. Pipette the colored upper layer into a centrifuge tube and centrifuge it at 10,000 rpm for 5 minutes at room temperature. Measure the absorbance at 520 nm, and calculate the proline content using a standard curve in μg / g fresh weight (FW).

[0144] 4. Determination of Pyrroline-5-carboxylic Acid (P5C) Content in Fragrant Brown Rice

[0145] The pyrroline-5-carboxylic acid (P5C) content in aromatic brown rice was determined according to the method of Wu et al. (2009). The specific steps were as follows: First, 0.3 g of dehulled aromatic brown rice was weighed and ground into a powder using liquid nitrogen. Next, the ground powder was transferred to a 15 mL centrifuge tube and 8 mL of 50 mM Tris-HCl buffer (pH 7.6) was added. The tube was centrifuged at 8000 rpm for 20 minutes at 4°C. Subsequently, 375 μL of the supernatant was aspirated, and 500 μL of 10% trichloroacetic acid solution and 125 μL of 0.25% 2-aminobenzaldehyde solution were added in that order. After standing at room temperature for 30 minutes, the tube was centrifuged at 8000 rpm for 10 minutes at room temperature, and the supernatant was aspirated. Finally, the absorbance was measured at 440 nm, and the P5C content was calculated using a standard curve and expressed in μmol / gFW.

[0146] 5. Determination of 2-AP Content in Fragrant Brown Rice

[0147] The 2-AP content of aromatic brown rice was determined according to the method of Huang Zhonglin et al. (2012) with slight modifications. The specific steps are as follows: First, weigh approximately 0.5 g of hulled aromatic brown rice and grind it into a powder using liquid nitrogen. Place the powder in a glass bottle, add 10 mL of chromatographic-grade dichloromethane, seal the bottle, tighten the cap, and shake briefly to mix well before labeling. Place the sample bottle in a water-filled ultrasonic cleaner and sonicate at 40 kHz and 45°C for 40 minutes. After treatment, remove the sample bottle and allow it to cool to room temperature. Add the sample to an appropriate amount of anhydrous sodium sulfite solution, and immediately remove the supernatant using a 1 mL sterile syringe. The supernatant is then filtered through a 0.22 μm organic needle filter (13 mm diameter) into a headspace sample vial. Simultaneously, add 2 μL of 0.0917 g / L 2,4,6-trimethylpyrimidine (TMP) as an internal standard. Gas chromatography-mass spectrometry analysis is then performed immediately. The GC-MS method for determining 2-AP utilizes a Shimadzu GC-MS QP2010 Plus gas chromatography-mass spectrometer, using 2,4,6-trimethylpyrimidine (TMP) as the internal standard. Detailed measurement conditions are as follows: Chromatographic conditions: SH-Rxi-5Sil MS column, 30 m long, 0.25 mm inner diameter, 0.25 μm film thickness. The column temperature program was: 40°C for 1 min, then ramped to 65°C at 2°C / min and held for 1 min; then ramped to 220°C at 10°C / min and held for 5 min. High-purity helium (≥99.999%) was used as the carrier gas. Constant pressure, splitless injection was used, and the injection volume was 2 μL. Mass spectrometry conditions: electron impact (EI) ion source, ion source temperature of 200°C; ionization energy of 70 eV; interface temperature of 250°C; quadrupole temperature of 150°C; full scan mode, scanning mass range of m / z 30-350.

[0148] 6. Data acquisition of particle shape

[0149] The seeds of the knockdown lines and control plants were harvested individually and dried under the same conditions. 50 full seeds were taken from each individual plant, and the grain length and width were scanned and measured using a multifunctional scanner. For the measurement of grain weight, the thousand-grain weight was also measured, that is, the total weight of 1,000 seeds was measured. The above measurements were repeated 3 times, and the obtained data were statistically analyzed using SAS (Statistical Analysis System) software.

[0150] 7. Experimental Results

[0151] 7.1 Analysis of Proline Content in Aromatic Brown Rice

[0152] Since the regulated genes are closely related to proline synthesis, we tested the proline content of three knockdown strains, OsP5CR-KD, OsP5CDH-KD, and OsP5CR / OsP5CDH-KD. Figure 1 As shown, the proline content in brown rice from the OsP5CR-KD strain was significantly higher than that of wild-type brown rice, a result that contradicted our expectations. Because OsP5CR catalyzes the conversion of P5C to proline, inhibiting its expression should reduce proline content. We hypothesized that this may be due to the existence of a P5C-independent metabolic pathway that converts glutamate to proline. This hypothesis was confirmed in the OsP5CR / OsP5CDH-KD strain, where proline content decreased only when the metabolism of P5C to glutamate was reduced and its conversion to proline was inhibited. In the OsP5CDH-KD strain, reduced P5C reflux to glutamate increased its conversion to proline, leading to a significant increase in proline content in the tested seeds. We will further explore and verify the existence of a P5C-independent pathway for proline synthesis from glutamate and its underlying mechanism.

[0153] 7.2 Analysis of Pyrroline-5-carboxylic Acid (P5C) Content in Brown Rice

[0154] By regulating P5C and its related metabolites, we explored its effects on the quality of rice. Therefore, we tested the P5C content in brown rice of different transgenic lines. Figure 2 As shown in the figure, compared with the control brown rice, the brown rice of the three materials contained higher levels of P5C.

[0155] 7.3 Analysis of 2-acetyl-1-pyrroline (2-AP) Content in Aromatic Brown Rice

[0156] The aroma of rice is a characteristic of the taste quality of silk rice and an important factor in determining its price. Among them, 2-acetyl-1-pyrroline (2-AP) is considered to be the main aroma component of fragrant rice. Therefore, we tested the 2AP content in the brown rice of three materials. The results are as follows Figure 3 As shown in the figure, compared with the control brown rice, the brown rice of the three materials contained higher levels of 2AP.

[0157] 7.4 Seed trait determination

[0158] In order to determine whether these transgenic materials have an impact on the main agronomic traits of rice seeds, we conducted a systematic investigation of the main agronomic traits of seeds of different transgenic lines. The key agronomic traits investigated included grain length, grain width, and 1000-grain weight. Figure 4As shown, compared with the wild-type, transgenic lines showed no significant negative effects on seed length, width, or 1000-grain weight. In contrast, we found that some lines exhibited larger seeds and increased 1000-grain weight, particularly in the OsP5CR-KD line. This comprehensive analysis of these results suggests that transgenic rice has no adverse effects on agronomic traits.

[0159] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the described embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Application of P5CR and / or P5CDH genes in improving the aroma quality of rice, characterized by: The nucleotide sequence of the P5CR gene is shown in SEQ ID NO.1, and the nucleotide sequence of the P5CDH gene is shown in SEQ ID NO.

2.

2. The use of the P5CR and / or P5CDH gene in improving the aroma quality of rice according to claim 1, characterized in that: The application is to knock down the expression of P5CR and / or P5CDH genes in rice grains to improve the aroma quality of rice.

3. Use of the P5CR and / or P5CDH gene according to claim 1 or 2 in improving the aroma quality of rice, characterized in that: The method of improving the aroma quality of rice includes increasing the content of aroma substances in rice grains.

4. The use of the P5CR and / or P5CDH gene in improving the aroma quality of rice according to claim 3, characterized in that: The rice grain aromatic substance includes 2-acetyl-1-pyrroline.

5. Use of the P5CR and / or P5CDH gene according to claim 1 or 2 in improving the aroma quality of rice, characterized in that: The rice is aromatic rice; further, the aromatic rice is japonica aromatic rice; further, the japonica aromatic rice is Yunjingyou 14.

6. Use of the P5CR and / or P5CDH gene in improving the aroma quality of rice according to claim 2, characterized in that: The knockdown of the expression of the P5CR and / or P5CDH genes in rice grains is achieved by miRNA-induced gene silencing or RNA interference.

7. Use of the P5CR and / or P5CDH gene in improving the aroma quality of rice according to claim 6, characterized in that: The MiRNA-induced gene silencing method comprises the following steps: S1. Insert the gene fragments of P5CR and / or P5CDH genes into the pZHY932 vector, and replace the ubi promoter in the pZHY932 vector with the endosperm-specific promoter LOC_Os03g31360 to obtain recombinant vectors for knocking down the P5CR and / or P5CDH genes, respectively; S2. Transforming callus with the recombinant vector through Agrobacterium-mediated transformation, screening resistant callus and regenerating plants to obtain rice with knockdown of the P5CR and / or P5CDH genes; When the knockdown gene is P5CR, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.4; When the knockdown gene is P5CDH, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.5; When the knockdown genes are P5CR and P5CDH, the nucleotide sequence of the gene fragment is shown in SEQ ID NO.6; The nucleotide sequence of the endosperm-specific promoter LOC_Os03g31360 is shown in SEQ ID NO.

3.

8. Use of the P5CR and / or P5CDH gene in improving the aroma quality of rice according to claim 7, characterized in that: The specific operations of step S1 are: (1) Using rice DNA as a template, primers LOC_Os03g31360F and LOC_Os03g31360R were used for PCR amplification to obtain the endosperm-specific promoter LOC_Os03g31360 gene fragment; (2) Using rice DNA as a template, PCR amplification was performed using primers OsP5CR-2F and OsP5CR-2R to obtain an OsP5CR gene fragment; PCR amplification was performed using primers OsP5CDH-2F and OsP5CDH-2R to obtain an OsP5CDH gene fragment; PCR amplification was performed using primers OsP5CR-2F and OsP5CDH-2R to obtain an OsP5CR-OsP5CDH gene fragment; (3) selecting vector pZHY932 as a backbone vector for vector construction, Sbf I and Sma I as restriction enzyme sites for vector construction, and connecting the OsP5CR, OsP5CDH or OsP5CR-OsP5CDH gene fragment obtained in step (1), and the endosperm-specific promoter LOC_Os03g31360 gene fragment with the backbone vector by homologous recombination to obtain recombinant vectors for knocking down the P5CR and / or P5CDH genes, respectively; Among them, the sequence of the primer pair for PCR amplification is: LOC_Os03g31360F: 5'-ccgaatcggggggatcctgcaggGTTCTACAAACCGAACTAGCTGTGA AAC-3'; LOC_Os03g31360R: 5'-TTCGCTTGTAGAGAAAAATCACGTTTTTGTGGGACTGAACT CA-3'; OsP5CR-2F: 5'-GATTTTTCTCTACAAGCGAAatcggcccgggtaacctc-3'; OsP5CR-2R: 5'-CAACATGGGAGTCCAAGATTACAGCAAGGGTTTTAGCTC-3'; OsP5CDH-2F: 5'-GATTTTTCTCTACAAGCGAAgcctcatccttTCCCGG-3'; OsP5CDH-2R: 5'-CAACATGGGAGTCCAAGATTTAAACTCTCTACAAATGGC-3'.

9. Use of the MiRNA-induced gene silencing method according to any one of claims 6 to 8 in preparing transgenic plants.

10. The use according to claim 9, characterized in that: The application comprises the following steps: cultivating the obtained rice with knocked-down P5CR and / or P5CDH gene expression into plants.

Images