Triple complex acid composition with skin lightening and acne-fighting efficacy, products and uses thereof

Abstract

The application belongs to the technical field of daily chemicals, and provides a triple composite acid composition with skin lightening, skin rejuvenation and acne-removing effects, a product and application thereof, which comprises almond acid, salicylic acid and succinic acid, and the mass ratio of the almond acid, the salicylic acid and the succinic acid is 3-6:1-2:1-2. The application also provides a product containing the above composition and application thereof. The composition provided by the application is synergistically used, has a synergistic effect in terms of exfoliation, especially in terms of improving the activity of kallikrein 5 (KLK5), has not only the effects of biological skin rejuvenation and exfoliation, but also can efficiently down-regulate the expression of I-type 5alpha-reductase gene, thereby inhibiting the synthesis of sebum and playing an oil control role. In addition, the composition provided by the application has the effects of lightening, bacteriostasis and anti-inflammation, has low sensitization, can be used for acne removal, has rapid effect and is not repeated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of daily chemical technology, and in particular to a triple composite acid composition with skin lightening, skin rejuvenation and acne-removing effects, a product and application thereof. BACKGROUND

[0002] The stratum corneum is the outermost layer of the skin. Under normal circumstances, the upper keratin will be automatically renewed and shed once every 28 days, and the newly born keratin cells in the lower layer will move upwards to keep the skin tender and smooth. However, due to the interaction of physiological age, external pressure and environmental factors, the skin's own metabolism function gradually slows down, the old keratin is difficult to shed, and the newly born keratin cannot migrate, resulting in rough skin, skin texture disorder, dull and lusterless skin, and indirectly affecting the penetration and absorption of subsequent care products. Therefore, people need to exfoliate regularly to achieve better skin care effects.

[0003] In addition, proper exfoliation can help metabolize accumulated keratinocytes, reduce the formation of acne and acne, and thus achieve the effect of acne removal. SUMMARY

[0004] Therefore, the present application aims to solve the technical problem of providing a triple composite acid composition with skin lightening, skin rejuvenation and acne-removing effects, a product and application thereof. The composition provided in the present application has a synergistic effect in terms of exfoliation, especially in terms of improving the activity of kallikrein 5 (KLK5), which is beneficial to exfoliation and acne removal, and can quickly remove acne.

[0005] The present application provides a triple composite acid composition with skin lightening, skin rejuvenation and acne-removing effects, which comprises mandelic acid, salicylic acid and succinic acid.

[0006] The composition provided in the present application comprises mandelic acid, which is also known as mandelic acid. Its English name is mandelic. Mandelic acid has a large molecular weight and is fat-soluble. When compounded with salicylic acid and succinic acid, it has a synergistic effect in terms of exfoliation, especially in terms of improving the activity of kallikrein 5 (KLK5).

[0007] The composition provided in the present application comprises salicylic acid, whose English name is Salicylic Acid. It can down-regulate the key target of SREBP1 (Experimental Dermatology. 2019; 28: 786-794.) to regulate the synthesis and metabolism of sebum, thereby playing an oil-controlling role. In the present application, salicylic acid has a moderate molecular weight, and when compounded with mandelic acid and succinic acid, it has a synergistic effect in terms of exfoliation, especially in terms of improving the activity of kallikrein 5 (KLK5).

[0008] The composition provided in the present application comprises succinic acid, also known as butanedioic acid, with the English name of Succinic Acid. The molecular weight of succinic acid is relatively low. After being compounded with mandelic acid and succinic acid with a relatively high molecular weight, the composition has a synergistic effect on exfoliation, especially on the promotion of kallikrein 5 (KLK5) activity. KLK5 can specifically hydrolyze desmoglein to promote the decomposition of desmosomes between keratinocytes, so that the cohesion of epidermal cells is lost.

[0009] The composition provided in the present application is synergistically used, has a synergistic effect on exfoliation, especially on the promotion of kallikrein 5 (KLK5) activity. The composition not only has the effects of biological skin rejuvenation and exfoliation, but also can efficiently down-regulate the expression of I-type 5α-reductase (SARD5A1) gene, thereby inhibiting the synthesis of sebum and playing an oil control role. In addition, the composition provided in the present application has the effects of lightening, antibacterial and anti-inflammatory, has low allergenicity, can be used for acne removal, has rapid effect and does not recur.

[0010] In some specific implementations, the mass ratio of the mandelic acid, the salicylic acid and the succinic acid is 3-6:1-2:1-2. In some specific implementations, the mass ratio of the mandelic acid, the salicylic acid and the succinic acid is 3-5.5:1-1.8:1-1.5. In some specific implementations, the mass ratio of the mandelic acid, the salicylic acid and the succinic acid is 5.5:1:1.5, 5:1.8:1.2, 5:1:2 or 3:1:1.5.

[0011] The present application also provides the use of the above-mentioned composition in the preparation of an exfoliating product, a lightening product, a skin rejuvenation product or an acne removal product. The composition described in the present application can be used for exfoliation, lightening, skin rejuvenation or acne removal, has rapid effect and does not recur.

[0012] The present application also provides the use of the above-mentioned composition in the preparation of a product for promoting the expression of kallikrein 5 gene. Specifically, compared with a mandelic acid single agent, a salicylic acid and a succinic acid composition, the composition provided in the present application produces a synergistic effect in promoting the expression of kallikrein 5 (KLK5) gene, and has a more excellent exfoliation effect.

[0013] The present application also provides the use of the above-mentioned composition in the preparation of an anti-inflammatory and / or antibacterial product. The composition provided in the present application can significantly reduce the expression level of inflammatory factors, such as TNF-α, and can also significantly inhibit the growth of acne-causing bacteria, such as Propionibacterium acnes, thereby playing an anti-inflammatory and antibacterial role.

[0014] The present application also provides the use of the above-mentioned composition in the preparation of a product for inhibiting I-type 5α-reductase (SARD5A1). The composition provided in the present application can significantly inhibit the overexpression of SARD5A1, thereby inhibiting sebum production and playing a high-efficiency oil control role.

[0015] The application also provides a product comprising the composition described in the above technical solution.

[0016] In some embodiments of the application, the product comprises, but is not limited to, personal care products, pharmaceutical products, and the like. Those skilled in the art can understand that, in addition to the composition described in the above technical solution, other excipients, such as pharmaceutical excipients or personal care product excipients, are also included.

[0017] In some embodiments of the application, the personal care product comprises a basic care product and / or a make-up product.

[0018] In some embodiments of the application, the make-up product comprises, but is not limited to:

[0019] (1) Foundation:

[0020] Liquid / foundation cream: used for uniform skin color and covering blemishes;

[0021] BB cream / CC cream: light and thin foundation product, with skin care and modification functions;

[0022] Concealer: used for covering local parts such as acne and dark circles;

[0023] Powder / face powder: setting makeup and reducing facial shine.

[0024] (2) Eye make-up:

[0025] Eye shadow: adding color and level to eyes;

[0026] Eyeliner pen / liquid / gel: outlining eye lines to make eyes look more spiritual;

[0027] Mascara: growing and encrypting eyelashes to increase the depth of eyes;

[0028] Eyebrow pencil / powder / gel: filling gaps in eyebrows and shaping ideal eyebrow shapes.

[0029] (3) Cheek make-up:

[0030] Blush: adding natural blood color to cheeks and improving complexion;

[0031] Contour cake / stick: using shadow techniques to make facial contours more three-dimensional;

[0032] (4) Lip make-up:

[0033] Lipstick / lip gloss / lipstick: changing or emphasizing the color of lips;

[0034] Lip liner: drawing clear lip shape boundaries to prevent lipstick from spilling.

[0035] (5) Multi-functional color cosmetics:

[0036] Highlighter / stick / liquid / powder: to highlight the high points of the face (e.g. nose bridge, cheekbones), creating a glossy effect.

[0037] In addition, there are also products designed for special occasions, such as waterproof and sweat-resistant eye liners, long-lasting non-fading lipsticks, etc.

[0038] In some embodiments of the present application, the basic care products include, but are not limited to:

[0039] Face wash / cleanser: gently removes facial dirt, oil and makeup residues;

[0040] Makeup remover oil / water / cream: specially used to thoroughly remove color cosmetics, especially waterproof cosmetics;

[0041] Toner: used after cleansing, it can further clean the skin surface residues, replenish moisture to the skin, restore the skin pH balance, and lay a good foundation for the absorption of subsequent skincare products;

[0042] Serum: contains high concentrations of active ingredients, providing deep nourishment and repair for specific skin problems (e.g. anti-aging, moisturizing, whitening, etc.);

[0043] Eye cream: specially designed for the sensitive area around the eyes, with the effect of lightening fine lines, dark circles and tightening the skin around the eyes, usually with light and easy-to-absorb texture;

[0044] Day / night emulsion or cream: with the functions of protection, repair and nourishment, promotion of cell regeneration, etc., it can provide the necessary moisture to the skin and lock in the supplemented moisture;

[0045] Sunscreen: used for UV protection, preventing photoaging, etc.

[0046] Face mask: provides additional nourishment and care to the skin, such as hydration, pore cleaning or skin lightening, etc.

[0047] In some specific implementations, the personal care product is a serum, and the serum comprises 0.1wt%-10wt% of the composition described in the above technical solution, preferably comprises 0.5wt%-9.5wt% of the composition described in the above technical solution, and more preferably comprises 1wt%-9wt% of the composition described in the above technical solution.

[0048] The serum provided in the present application can have a significant exfoliation effect after 7 days of use, and the exfoliation effect gradually increases as the use time increases; the acne redness area can be significantly reduced after 3 days of use of the serum provided in the present application, which has a rapid acne-removing effect, and the degree of acne redness gradually decreases as the use time increases.

[0049] The composition provided by the present application comprises almond acid, salicylic acid and succinic acid, and the mass ratio of the almond acid, salicylic acid and succinic acid is 3-6:1-2:1-2. The composition provided by the present application is synergistically used, has a synergistic effect on exfoliation, especially on promoting the activity of kallikrein 5 (KLK5), has the effects of biological skin rejuvenation and exfoliation, can efficiently down-regulate the expression of I-type 5 alpha-reductase (SARD5A1) gene, and then inhibit the synthesis of sebum, and has the effect of oil control. In addition, the composition provided by the present application has the effects of skin lightening, bacteriostasis and anti-inflammation, has low sensitization, can be used for acne removal, has rapid effect and is not repeated. BRIEF DESCRIPTION OF DRAWINGS

[0050] Figure 1 A columnar graph of cell survival rate test results of the composition provided by the present application;

[0051] Figure 2 A columnar graph of test results of the composition provided by the present application on the activation of inflammatory factors;

[0052] Figure 3 A columnar graph of the influence of the composition provided by the present application on the expression of kallikrein 5 (KLK5);

[0053] Figure 4 A columnar graph of the inhibition results of the composition provided by the present application on I-type 5 alpha-reductase (SARD5A1). DETAILED DESCRIPTION

[0054] The present application provides a triple composite acid composition with the effects of skin lightening, skin rejuvenation and acne removal, a product and application thereof, and those skilled in the art can refer to the content herein, appropriately improve process parameters to realize. The method and application of the present application have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0055] The terms "comprising", "having", or "including", or their grammatical variants, are generally used in an open-ended and non-limiting sense, for example, not excluding additional unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0056] It should be understood that the order of steps or the order of performing certain actions is not important, as long as the present application is still operable. In addition, two or more steps or actions can be performed simultaneously.

[0057] The use of any and all examples, or exemplary language (e.g., "such as" or "including") provided herein, is intended merely to better illuminate the application and does not pose a limitation on the scope of the application unless otherwise claimed. No language is such that it will be construed as indicating any non-claimed element as essential to the practice of the application.

[0058] Further, the numerical ranges and parameters setting forth the broadest scope of the application are approximations, and are merely intended to convey general information as to the scope of the application. Consistent with the statement above, the numerical values in this specification are not to be understood as limitations, but rather as approximations, unless otherwise indicated. Although the numerical ranges and parameters setting forth the broadest scope of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0059] The present application provides a triple composite acid composition with skin lightening, skin rejuvenation and acne-removing effects, comprising almond acid, salicylic acid and succinic acid, and the mass ratio of the almond acid, salicylic acid and succinic acid is 3-6:1-2:1-2.

[0060] The composition provided by the present application is used synergistically, has a synergistic effect in terms of exfoliation, especially in terms of improving kallikrein 5 (KLK5) activity, has not only a biological skin rejuvenation and exfoliation effect, but also can efficiently down-regulate the expression of I-type 5α-reductase (SARD5A1) gene, thereby inhibiting the synthesis of sebum and playing an oil control role; in addition, the composition provided by the present application has skin lightening, bacteriostatic and anti-inflammatory effects, has low sensitization, can be used for acne removal, has rapid effect and does not recur.

[0061] The present application also provides a product containing the above-mentioned composition, such as a serum. The serum provided by the present application can have an obvious exfoliation effect after 7 days of use, and the exfoliation effect gradually increases with the extension of the use time; the acne redness area can be significantly reduced after 3 days of use of the serum provided by the present application, which has a rapid acne-removing effect, and the degree of acne redness gradually decreases with the extension of the use time.

[0062] The present application is further illustrated below in conjunction with examples.

[0063] In the following examples, the raw materials are purchased from the market.

[0064] Examples 1-4 and Comparative Examples 1-5

[0065] According to the formula composition shown in Table 1, the raw materials are mixed to obtain the composition.

[0066] Table 1 Formula composition provided by the examples and comparative examples of the present application

[0067]

[0068] Test Example 1: Study on cell safety of different acid combinations

[0069] Test method: cell proliferation experiment (HaCat cells, combined acid treatment for 24 h);

[0070] 1) Cell inoculation: after recovering HaCat cells, when the plating rate reached about 60%, the cells were inoculated into a 96-well plate, and incubated in a CO2 incubator (37°C, 5% CO2) overnight.

[0071] 2) Test grouping: the test was set up with a zero setting group (BC (blank control group)), a solvent control group (ETOH (ethanol control group)) and a sample group, with 3 repeated holes;

[0072] 4) Dosing: when the plating rate of the cells in the 96-well plate reached 50%~60%, dosing was performed. The solvent control group was added with 200 μL of culture solution containing 2% ethanol per hole; the sample group was added with 200 μL of culture solution containing a combined final concentration of 0.08 mg / mL per hole; the zero setting group was not inoculated with cells, and only 200 μL of cell culture solution was added. After dosing was completed, the 96-well plate was placed in a CO2 incubator (37°C, 5% CO2) for incubation for 24 h.

[0073] 5) Detection: after the cells were incubated and cultured for 24 h, the supernatant was discarded, MTT working solution (0.5 mg / mL) was added, and incubation was performed at 37°C in the dark for 4 h. After incubation, the supernatant was discarded, 150 µL of DMSO was added to each hole, and the OD value was read at 490 nm.

[0074] 6) Calculation of cell relative viability:

[0075] The cell relative viability was calculated according to the following formula:

[0076] ;

[0077] The experimental results are shown in Table 2 and Figure 1 Table 2 is the cell survival rate test results of the compositions provided in the examples and comparative examples of the present application, Figure 1 and Table 2 is the cell survival rate test results of the compositions provided in the examples and comparative examples of the present application.

[0078] Table 2 Cell survival rate test results of the compositions provided in the present application

[0079]

[0080] Table 2 and Figure 1It can be seen that the cell survival rate of the composition provided in Example 3 is significantly higher than that of other treatment groups, indicating that it has lower cell killing power and the lowest stimulation; and the cell survival rate of the compositions provided in Example 1 and Example 2 is also higher than that of the ethanol control group and the comparative example 1 group, indicating that the composition provided in the application has lower stimulation.

[0081] Test Example 2: Investigation of the activation of inflammatory stimulators by different compositions

[0082] Test method:

[0083] I. Total RNA extraction

[0084] HaCaT cells were seeded in a 12-well plate at a density of 1.5 x 10 5 cells / well, and cultured for 12 h; test compositions (total concentration 0.8 mg / mL) were added for pre-treatment for 12 h, and then 1 mL of RNzol lysis solution was added for lysis at room temperature for 5 min; 0.2 mL of chloroform was added and mixed well, and then centrifuged at 12,000 rpm for 15 min (4°C); the water phase was taken and an equal volume of isopropanol was added to precipitate the RNA, and then centrifuged at 12,000 rpm for 10 min (4°C); the precipitate was washed with 75% ethanol and centrifuged at 10,000 rpm for 5 min (4°C); after drying, it was dissolved in 30-100 μL of RNase-free water, and the purity (A260 / A280≥1.8) and concentration were determined.

[0085] II. cDNA synthesis

[0086] 1 μg of total RNA was taken, 2 μL of 5x reverse transcription premix (containing reverse transcriptase, primers and dNTPs) was added, and nuclease-free water was added to 10 μL; 37°C for 15 min, 98°C for 5 min to inactivate, and the obtained cDNA was stored at -20°C.

[0087] III. Real-time fluorescent quantitative PCR

[0088] Reaction system (20 μL): 10 μL of 2x SYBR Green premix, 0.4 μL of TNF-α primers (F: CCTCTCTCTAATCAGCCCTCTG; R: GAGGACCTGGGAGTAGATGAG) and GAPDH primers (F: GGAGCGAGATCCCTCCAAAAT; R: GGCTGTTGTCATACTTCTCATGG) (10 μM), 2 μL of cDNA template, and water to 20 μL. Program: 95°C pre-denaturation for 30 sec; 95°C denaturation for 5 sec→60°C annealing / extension for 30 sec (40 cycles); melting curve analysis (65°C→95°C). Taking GAPDH as the internal reference, the relative expression amount of TNF-α was calculated by the 2^(-ΔΔCt) method. See Table 3 and Figure 2Table 3 is the test result of the composition provided by the present application on the activation of inflammatory factors, Figure 2 Figure 2 is a histogram of the test result of the composition provided by the present application on the activation of inflammatory factors.

[0089] Table 3 is the test result of the composition provided by the present application on the activation of inflammatory factors

[0090]

[0091] In Table 3, T-TSET statistical analysis is used for comparison between groups, and all statistical analyses are two-tailed. P<0.05 is considered to have significant difference, and the smaller the P value, the more significant the difference.

[0092] From Table 3 and Figure 2 It can be seen that the composition provided by the embodiments of the present application significantly reduces the expression amount of TNF-α inflammatory factor, especially the example 3 group, which has the most optimal anti-inflammatory effect in reducing the expression amount of TNF-α inflammatory factor compared with other groups.

[0093] Test Example 3: Explore the effect of different acids and their combinations on the expression of kallikrein (5KLK5) in HaCaT cells

[0094] I. Cell treatment and stimulation

[0095] HaCaT cells were seeded in a 12-well plate at a density of 1.5×10 5 cells / well, and cultured for 12 h; group treatment: BC group, using the base culture medium (without adding testosterone and composition) throughout the whole process, and cultured for 48 h; NT group, continuing to use the culture medium for 12 h, and then adding testosterone (10 ug / mL) for stimulation for 24 h; test group, adding the test composition (total concentration 1.5 mg / mL) for pre-treatment for 12 h, and then adding testosterone (10 ug / mL) for stimulation for 24 h. Discard the culture medium, and wash once with PBS.

[0096] II. Total RNA extraction

[0097] Add 1 mL of TRNzol lysis solution to each well, and lyse at room temperature for 5 min; follow the standard TRNzol method (chloroform fractionation, isopropanol precipitation, ethanol washing) for subsequent steps, and finally dissolve the RNA in 30 μL of RNase-free water. Determine the purity (A 260 / A 280 =1.8~2.0).

[0098] III. cDNA synthesis

[0099] Take 1 μg of RNA, add 2 μL of 5× reverse transcription premix, and add water to 10 μL; react at 37℃ for 15 min, and inactivate at 98℃ for 5 min.

[0100] IV. Real-time PCR

[0101] Primer sequences:

[0102] KLK5:

[0103] F: 5'-AGAGCATGTTCTCGCCAACAA-3'

[0104] R: 5'-TGGGTGTGCATATCGCAGTC-3' (product: 147 bp)

[0105] GAPDH:

[0106] F: 5'-GGAGCGAGATCCCTCCAAAAT-3'

[0107] R: 5'-GGCTGTTGTCATACTTCTCATGG-3'

[0108] System (20 μL):

[0109] 2x SYBR Green Premix 10 μL + KLK5 / GAPDH primer (10 μM) 0.4 μL each + cDNA 2 μL + water to 20 μL.

[0110] Procedure:

[0111] 95°C 30 sec; 40 cycles (95°C 5 sec → 60°C 30 sec); melting curve (65°C → 95°C).

[0112] Quantification: GAPDH was used as an internal reference to calculate the relative expression of KLK5 (2 Method).

[0113] Results refer to Table 4 and Figure 3 Table 4 is the effect of the composition provided in the present application on the expression of KLK5, Figure 3 and Table 4 is a bar graph of the effect of the composition provided in the present application on the expression of KLK5.

[0114] Table 4 Effect of the composition provided in the present application on the expression of KLK5

[0115]

[0116] In Table 4, a-nova statistical analysis was used for comparison between groups, P<0.05 was considered to have significant difference, and the smaller the P value, the more significant the difference.

[0117] From Table 4 and Figure 3It can be seen that the composition provided by the embodiment of the present application can significantly promote the expression of the KLK5 gene, that is, it can promote the decomposition of the desmosome between the keratinocytes by up-regulating the expression of the KLK5 gene, so that the cohesion of the epidermal cells is lost, and the epidermal cells are naturally exfoliated, so as to achieve the effect of promoting the exfoliation of the keratin, thereby solving the problems of skin dullness, roughness, pore blockage and acne.

[0118] In particular, the composition provided in Example 3 has synergistic effect compared with Comparative Example 2 and Comparative Example 3, which is calculated according to the calculated synergistic method of King:

[0119] q = E A+B / (E A +E B -E A × E B )

[0120] The q value is much greater than 1.15, so the composition provided in Example 3 has a synergistic effect compared with a single agent.

[0121] Test Example 4: Explore the effect of different acids and their combinations on the expression of SARD5A1 in Hacat

[0122] I. Cell treatment and stimulation

[0123] HaCaT cells were seeded in a 12-well plate at a density of 1.5×10 5 cells / well, and cultured for 12 h; group treatment: the BC group was treated with the base culture medium (without adding testosterone and the composition) throughout the whole process, and cultured for 48 h; the NT group was treated with the culture medium for 12 h, and then stimulated with testosterone (10 ug / mL) for 24 h; the test group was pretreated with the test composition (total concentration 1.5 mg / mL) for 12 h, and then stimulated with testosterone (10 ug / mL) for 24 h. The culture medium was discarded, and the cells were washed once with PBS.

[0124] II. Total RNA extraction

[0125] 1 mL of TRNzol lysis solution was added to each well, and lysed at room temperature for 5 min; the subsequent steps were operated according to the standard TRNzol method (chloroform fractionation, isopropanol precipitation, ethanol washing), and finally the RNA was dissolved in 30 uL of RNase-free water. The purity (A 260 / A 280 =1.8~2.0) was determined.

[0126] III. cDNA synthesis

[0127] 1 ug of RNA was taken, 2 uL of 5× reverse transcription premix was added, and water was added to 10 uL; 37℃ reaction for 15 min, 98℃ inactivation for 5 min.

[0128] IV. Real-time PCR

[0129] Primer sequences:

[0130] SRD5A1:

[0131] F: TCAGACGAACTCAGTGTACGG

[0132] R: CGTAGTGGACGAGGAACATGG

[0133] GAPDH:

[0134] F: 5'-GGAGCGAGATCCCTCCAAAAT

[0135] R: 5'-GGCTGTTGTCATACTTCTCATGG

[0136] System (20 μL):

[0137] 2 x SYBR Green Premix 10 μL + SRD5A1 / GAPDH primer (10 μM) 0.4 μL each + cDNA 2 μL + water to 20 μL.

[0138] Program:

[0139] 95°C for 30 sec; 40 cycles (95°C for 5 sec → 60°C for 30 sec); melting curve (65°C → 95°C).

[0140] Quantification: take GAPDH as the internal reference to calculate the relative expression of SRD5A1 Method)

[0141] The results are shown in Table 5 and Figure 4 Table 5 is the SARD5A1 inhibition results of the compositions provided in the present application, Figure 4 and Table 6 is a histogram of the SARD5A1 inhibition results of the compositions provided in the present application.

[0142] Table 5 SARD5A1 inhibition results of the compositions provided in the present application

[0143]

[0144] As can be seen from Table 5 and Figure 4 Table 6, the compositions provided in the present application can significantly inhibit the overexpression of SARD5A1 (type I 5α-reductase gene), i.e., they can exert a high-efficiency oil control effect by efficiently inhibiting the key enzyme activity of sebum production.

[0145] Test Example 5 Investigation of the inhibition of different group acids on the bacterium causing acne, Propionibacterium acnes

[0146] Dilute the test bacteria suspension with PBS solution (pH 7.40) to the required concentration: take 0.1 mL and drop into 5.0 mL of the control sample (PBS), and the number of bacteria recovered is 1x10 4 CFU / mL~9x10 4 CFU / mL. Take 5.0 mL of the test sample stock solution and place it in a sterile test tube at 20°C for 5 min. Take 0.1 mL of the test bacteria solution and add it to the test tube containing 5.0 mL of the sample, mix quickly, and immediately start timing. After the set time (10 min, 30 min), take 0.5 mL of the test bacteria and sample mixture and add it to a test tube containing 4.5 mL of sterilized PBS, mix thoroughly. Take 1 mL of the sample (or dilute it as appropriate, and take 2-3 dilutions of the dilution) and place it in a sterile petri dish, inoculate two sterile petri dishes for each sample or dilution. Pour 15-20 mL of nutrient agar medium (P. acnes) cooled to 40-45°C into the petri dish, rotate the dish to ensure uniform distribution, and invert the dish after the agar has solidified. Incubate at (36±1) °C for (48+2) h, and then count the viable bacterial colonies. If no colonies grow on the plate inoculated with the low dilution sample, but colonies grow on the plate inoculated with the high dilution sample, count the colonies as zero. Replace the test sample with PBS and follow the above steps as a control sample. Repeat the experiment three times and take the average value.

[0147] The bacteriostatic rate is calculated according to the following formula:

[0148] Y=(I-II) / Ix100%;

[0149] where Y is the bacteriostatic rate, I is the average number of colonies of the control sample, and II is the average number of colonies of the experimental sample.

[0150] The results are shown in Table 6, which shows the bacteriostatic results of the composition provided in the examples.

[0151] Table 6 Bacteriostatic results of the composition provided in the examples

[0152]

[0153] As shown in Table 6, the composition provided in the present application has a strong bacteriostatic effect on P. acnes, i.e., the composition can achieve a rapid acne-removing effect by rapidly inhibiting bacteria.

[0154] Test Example 6 Efficacy test of human clinical exfoliation

[0155] Prepare the serum according to the simple formula shown in Table 7, and carry out human arm exfoliation efficacy tests.

[0156] Table 7. Serum formulations

[0157]

[0158] 1. Test plan:

[0159] 32 subjects were screened into the study and tested on the inner arm for 7 consecutive days with the test samples. Skin color L*a*b* values were measured at different time points by high-definition skin microscopy and non-invasive instruments to evaluate the exfoliation efficacy of the test product.

[0160] 2. Test indicators and instruments:

[0161] Instruments: Courage + Khazaka, Skin-Colorimeter CL400;

[0162] Parameters: Skin color (light-white), L* value (red-green), a* value (yellow-blue), b* value;

[0163] Test site: arm, according to the random table;

[0164] Test method: measure 3 times respectively, take the average;

[0165] Test time points: before product use (D-2), 2 days after dyeing modeling (D0), 3 days after sample use (D3), 7 days after sample use (D7).

[0166] 3. Data statistics:

[0167] 1) Descriptive statistics

[0168] Calculate the mean, standard deviation, minimum value, maximum value, median of each parameter at each time point for the test product group, and calculate the difference before product use (D-2) and 2 days after modeling (D0), after sample application (D3), and after sample application (D7) for the test product group, respectively.

[0169] 2) Normal distribution test

[0170] Apply the Shapiro-Wilk Test method of SPSS software to the above difference for normal distribution test, and the normality test gradual statistical significance (two-sided) value p>0.05, then the series of data obeys normal distribution.

[0171] 3) Evaluation criteria

[0172] If the statistical method significance level p<0.05, it indicates that there is a significant difference in statistics before and after the use of the test product; if the statistical method significance level p≥0.05, it indicates that there is no significant difference in statistics before and after the use of the test product.

[0173] 4、Test results are shown in Table 8, which is the arm exfoliation test results of the serum provided in the present application.

[0174] Table 8 Test results of the serum provided in the present application

[0175]

[0176] As can be seen from Table 8, the serum provided in the present application has high exfoliation and brightening effects, and the exfoliation and brightening effects gradually increase with the increase of use time; therefore, the serum provided in the present application has the effect of high skin whitening, which can help to play the effects of high skin whitening and acne removal.

[0177] Test Example 7 Human clinical acne removal efficacy test:

[0178] 1、Test scheme

[0179] 30 subjects (35.6±7.26 years old), the subjects considered to be oily or mixed oily skin, rough and dull and lusterless face, obvious acne skin, red and obvious acne on both sides of the face; half-face control, using the serum with the formula shown in Table 7 every day, to evaluate the acne removal efficacy of the serum;

[0180] 2、Test indicators and instruments

[0181] Instruments: Antera 3D, multifunctional 3D skin imaging analyzer;

[0182] Parameters: skin average roughness Ra, acne redness difference value;

[0183] Test site: acne area and non-acne area on both cheeks (according to random table);

[0184] Test method: take pictures once;

[0185] Test time points: before use (D0), 3 days after use (D3), 7 days after use (D7);

[0186] 3、Statistical method same as test example 6;

[0187] 4、Test results

[0188] See Table 9, which is the acne removal efficacy results of the serum provided in the present application.

[0189] Table 9 Acne removal efficacy results of the serum provided in the present application

[0190]

[0191] As shown in Table 9, the serum provided by the present application has a rapid acne-removing effect, and the red acne area can be significantly reduced after 3 days of use, and the red acne degree gradually decreases with the increase of the use time, so the composition provided by the present application has a rapid acne-removing effect.

[0192] The above merely illustrates the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A triple-compound acid composition with skin brightening, skin rejuvenation and acne removal effects, comprising mandelic acid, salicylic acid and succinic acid, wherein the mass ratio of mandelic acid, salicylic acid and succinic acid is 3~6:1~2:1~2.

2. The triple-compound acid composition according to claim 1, characterized in that, The mass ratio of mandelic acid, salicylic acid and succinic acid is 3~5.5:1~1.8:1~1.

5.

3. The triple-compound acid composition according to claim 1, characterized in that, The mass ratio of mandelic acid, salicylic acid and succinic acid is 5.5:1:1.5, 5:1.8:1.2, 5:1:2 or 3:1:1.

5.

4. The use of the triple-compound acid composition according to any one of claims 1 to 3 in the preparation of exfoliating products.

5. The use of the triple complex acid composition according to any one of claims 1 to 3 in the preparation of anti-inflammatory and / or antibacterial products, wherein the bacterium is Propionibacterium acnes.

6. The use of the triple complex acid composition according to any one of claims 1 to 3 in the preparation of skin brightening products.

7. The use of the triple complex acid composition according to any one of claims 1 to 3 in the preparation of skin-renewing products.

8. The use of the triple complex acid composition according to any one of claims 1 to 3 in the preparation of acne treatment products.

9. A product with skin-brightening, skin-renewing, and acne-removing effects, characterized in that, include: The triple-compound acid composition according to any one of claims 1 to 3.

10. The product according to claim 9, characterized in that, Including personal care products.

11. The product according to claim 10, characterized in that, The product in question is an essence.

Images