Application of finasteride in preparation of medicine for treating triple negative breast cancer

Abstract

The invention relates to the field of biological medicine, in particular to application of finasteride in preparation of a medicine for treating triple negative breast cancer. In-vitro experiments prove that by up-regulating ZBTB20 gene expression, finasteride significantly inhibits polarization of macrophages to M2 type and promotes M1 type differentiation; a mouse triple-negative breast cancer transplantation tumor model further proves that the treatment of finasteride combined with adriamycin has an anti-tumor effect and can significantly inhibit tumor growth, so that the combination of finasteride and adriamycin can significantly enhance the anti-tumor effect and is superior to single-drug treatment. The invention discloses the application of finasteride in treatment of triple negative breast cancer for the first time, proposes the ZBTB20 gene as a main action target of finasteride in inhibition of triple negative breast cancer tumor, and proposes that the ZBTB20 protein or the ZBTB20 gene as a treatment target has great potential in treatment of triple negative breast cancer, drug screening and other aspects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of finasteride in preparing a drug for treating triple-negative breast cancer. Background Art

[0002] Breast Cancer (BC) is the malignant tumor with the highest incidence in women. Among breast cancer patients, triple-negative breast cancer (TNBC) subtype accounts for a high proportion. Triple-negative breast cancer cannot benefit from endocrine or targeted therapy due to the lack of estrogen receptors, progesterone receptors and human epidermal growth factor receptors. Although neoadjuvant chemotherapy has clinical applications in TNBC, its response rate is still not ideal. More than half of the patients relapse within 3-5 years after diagnosis, and the median survival is only 10.2 months. Although TNBC is highly sensitive to taxane and anthracycline chemotherapy, the complete remission rate is less than 30%, and the recurrence and mortality rates are still significantly higher than non-TNBC subtypes.

[0003] Finasteride is a steroid drug used clinically to treat benign prostatic hyperplasia. Finasteride is a synthetic 4-azasteroid compound with a molecular formula of C 23 H 36 N2O2. Finasteride's core mechanism of action lies in its selective antagonism of type II 5α-reductase activity, effectively blocking the bioconversion of testosterone to dihydrotestosterone in tissues such as the prostate, skin, and liver. It can also be used to treat male pattern baldness. Finasteride can reduce dihydrotestosterone concentrations in the scalp to the level of the hair cuticle, reducing serum dihydrotestosterone, increasing hair growth, and slowing hair loss. Currently, there are no reports on the use of finasteride as an adjuvant treatment for TNBC tumors.

[0004] As a member of the BTB / POZ zinc finger transcription factor family, ZBTB20 has previously been studied for its role in regulating programmed cell death and tumor cell survival. Furthermore, ZBTB20 may be involved in hematopoiesis, tumorigenesis, and immune responses. Studies have shown that ZBTB20 can positively regulate oxidative stress and inflammatory responses in macrophages, while knockdown of the ZBTB20 gene can reduce M1 polarization and inhibit inflammatory factors. Currently, the relationship between ZBTB20 and TNBC tumors has not been reported. Summary of the Invention

[0005] The present invention aims to provide the use of finasteride in the preparation of a medicament for treating triple-negative breast cancer, thereby addressing the problems of the prior art described above. The present invention is the first to discover a new use of finasteride for the treatment of breast cancer. Based on this, finasteride can be used to prepare a medicament for treating breast cancer, particularly triple-negative breast cancer.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the use of finasteride in preparing a medicine for preventing and / or treating breast cancer.

[0008] Preferably, the breast cancer comprises triple-negative breast cancer.

[0009] Preferably, the drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

[0010] Further preferably, the drug inhibits M2 macrophage polarization and promotes M1 macrophage polarization by increasing ZBTB20 gene expression in macrophages induced by breast cancer cells in vitro; in vivo, the combination of finasteride and doxorubicin significantly enhances the anti-breast cancer effect, is superior to single-drug treatment, inhibits tumor growth, and achieves the effect of treating breast cancer.

[0011] Further preferably, the breast cancer includes triple-negative breast cancer.

[0012] The present invention provides a medicine for preventing and / or treating breast cancer. The medicine comprises finasteride and pharmaceutically acceptable excipients.

[0013] Further preferably, the drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

[0014] Further preferably, the breast cancer includes triple-negative breast cancer.

[0015] Preferably, the drug further comprises doxorubicin.

[0016] The present invention provides the use of ZBTB20 protein or ZBTB20 gene as a drug target in screening drugs for preventing and / or treating breast cancer.

[0017] Preferably, the breast cancer comprises triple-negative breast cancer.

[0018] Further preferably, the drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

[0019] The present invention provides a method for screening drugs for preventing and / or treating breast cancer, comprising the step of detecting the expression level of ZBTB20 protein or ZBTB20 gene in a subject before and after drug administration.

[0020] Further preferably, the breast cancer includes triple-negative breast cancer.

[0021] The present invention provides use of a small molecule agonist of ZBTB20 protein or ZBTB20 gene expression in the preparation of a medicament for preventing and / or treating breast cancer.

[0022] Further preferably, the drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

[0023] Further preferably, the breast cancer includes triple-negative breast cancer.

[0024] The present invention provides a pharmaceutical composition for preventing and / or treating breast cancer. The pharmaceutical composition comprises a small molecule agonist of ZBTB20 protein or ZBTB20 gene expression.

[0025] Further preferably, the drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

[0026] Further preferably, the breast cancer includes triple-negative breast cancer.

[0027] As an additional solution, the present invention provides the use of a reagent for detecting the expression level of ZBTB20 protein or ZBTB20 gene in the preparation of a kit for determining a personalized treatment plan for breast cancer.

[0028] Further preferably, the breast cancer includes triple-negative breast cancer.

[0029] As an additional solution, the present invention provides a molecular marker for diagnosing the sensitivity of breast cancer to finasteride, wherein the molecular marker comprises ZBTB20 protein or ZBTB20 gene.

[0030] Further preferably, the breast cancer includes triple-negative breast cancer.

[0031] The present invention discloses the following technical effects:

[0032] This invention reveals for the first time the use of finasteride in the treatment of triple-negative breast cancer. Based on this, it can be used to prepare drugs for treating breast cancer, particularly triple-negative breast cancer. Furthermore, the invention proposes that the ZBTB20 gene is the primary target of finasteride in inhibiting triple-negative breast cancer tumors, and suggests that the ZBTB20 gene or ZBTB20 protein as a therapeutic target has significant potential in the treatment of triple-negative breast cancer and drug screening.

[0033] In vitro experiments with finasteride have demonstrated that finasteride can inhibit M2 macrophage polarization and promote M1 macrophage polarization by increasing ZBTB20 gene expression in macrophages induced by TNBC tumor cell supernatant, thereby altering the TNBC-mediated immunosuppressive tumor microenvironment. Specifically, finasteride can significantly inhibit macrophage polarization toward M2 and promote M1 differentiation by upregulating ZBTB20 gene expression. RT-PCR results revealed that compared with the control group, ZBTB20 mRNA expression was significantly increased in the finasteride-treated group. M1 macrophage markers CD80 and TNF-α mRNA expression levels were significantly upregulated, while M2 macrophage markers CD206 and IL-10 mRNA expression levels were significantly downregulated. This suggests that finasteride may effectively reverse the M2 polarization induced by the TNBC tumor microenvironment by regulating ZBTB20 gene expression. Furthermore, in a mouse model of triple-negative breast cancer xenografts, finasteride combined with doxorubicin further demonstrated anti-tumor effects, significantly inhibiting tumor growth. Therefore, the combination significantly enhanced the anti-tumor effect, surpassing monotherapy. This suggests that finasteride has therapeutic effects on TNBC tumors, and the combination of finasteride and doxorubicin exhibits significant synergistic anti-tumor effects in the treatment of TNBC. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0035] Figure 1 The effect of finasteride on macrophage differentiation induced by supernatant of MDA-MB-231 cells (human TNBC tumor cell line) in vitro; A represents macrophage ZBTB20 mRNA expression; B represents M2 macrophage marker gene expression; C represents M1 macrophage marker gene expression; *P<0.1; **P<0.01; ***P<0.001; ****P<0.0001; MK-906 represents finasteride;

[0036] Figure 2 The effect of finasteride combined with doxorubicin in the treatment of TNBC; A is the tumor volume growth curve of 4T1 cells (mouse TNBC cell line) orthotopically transplanted subcutaneously in the mammary glands of BALB / c mice; B is the statistical result of the tumor volume of 4T1 transplanted tumors on day 13; *P<0.1; ***P<0.001; ****P<0.0001; MK-906 is finasteride, and ADR is doxorubicin. DETAILED DESCRIPTION

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0039] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0040] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0041] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0042] Preparation example:

[0043] The test equipment and materials used in the examples are specifically as follows:

[0044] Fetal bovine serum (OPCEL), DMEM medium (Gibco), RPMI-1640 medium (Gibco), trypsin (Solarbio), 10 cm cell culture dishes (BIOFIL), 96-well cell culture plates (servicebio), human triple-negative breast cancer cells (MDA-MB-231 cells, purchased from the China Cell Resource Bank), human THP-1 cells (purchased from the National Laboratory Cell Resource Sharing Service Platform), and mouse triple-negative breast cancer cells (4T1, purchased from the China Cell Resource Bank). Finasteride (MCE, MK-906), DMSO (AMRESCO), phorbol-12-tetradecanoyl-13-acetate (PMA, Sigma), doxorubicin (Hisun Pharmaceutical, purchased from Pu'er People's Hospital), Matrigel (Corning), reverse transcription reagent (Quanshijin Biotechnology Co., Ltd.), RT-PCR kit (Quanshijin Biotechnology Co., Ltd.), Trizol (Invitrogen), chloroform (Xilong Scientific Co., Ltd.), isopropanol (Xilong Scientific Co., Ltd.), Shutai (Vicco, France), centrifuge (Beckman Coulter, USA), real-time fluorescence quantitative PCR instrument (Applied Biosystems), microplate reader (BioTek), BALB / c mice (Henan Spex Biotechnology Co., Ltd.), ZBTB20 primers (Qingke, forward primer: CCTGACAAATGCTAGAACGGAAG, SEQ ID NO. 1; reverse primer: CCACCCGGCTGAGTAATCTC, SEQ ID NO. NO.2), CD206 primers (Qingke, forward primer: CTACAAGGGATCGGGTTTATGGA, SEQ ID NO.3; reverse primer: TTGGCATTGCCTAGTAGCGTA, SEQ ID NO.4), IL-10 primers (Qingke, forward primer: TCAAGGCGCATGTGAACTCC, SEQ ID NO.5; reverse primer: GATGTCAAACTCACTCATGGCT, SEQ ID NO.6), CD80 primers (Qingke, forward primer: AAACTCGCATCTACTGGCAAA, SEQ ID NO.7; reverse primer: GGTTCTTGTACTCGGGCCATA, SEQ ID NO.8), TNF-α primers (Qingke, forward primer: CCTCTCTCTAATCAGCCCTCTG, SEQ ID NO.9; reverse primer: CAGGACCTGGGAGTAGATGAG, SEQ ID NO.10).

[0045] The following experiments were conducted using the aforementioned test equipment to verify the mechanism of action of finasteride in treating TNBC tumors. The specific verification experiments and results are shown below:

[0046] Example 1 Finasteride reverses M2 macrophage polarization induced by supernatant of MDA-MB-231 cells (human TNBC tumor cell line)

[0047] 1. Human THP-1 cell differentiation: Human THP-1 cells were cultured at a rate of 1.5×10 6 Cells were seeded at a density of 100 cells / well in a cell culture plate and 100 ng / mL PMA was added. The cells were cultured in a 37°C, 5% CO2 incubator for 24 hours, and then replaced with fresh complete RPMI-1640 medium for another 24 hours to induce differentiation.

[0048] 2. Preparation of TNBC cell-conditioned medium: Culture MDA-MB-231 cells to 80% confluence and replace with DMEM medium supplemented with 0.1% serum. After 24 hours of culture, collect the medium and filter it through a 0.22 μm filter to obtain TNBC cell-conditioned medium. Store at -80°C to avoid repeated freeze-thaw cycles. The expiration date is 1 month.

[0049] 3. Treatment of human THP-1 cells: Add 1.37 mL of TNBC cell-conditioned medium to the differentiated human THP-1 cells, and supplement with fresh complete RPMI-1640 medium to a total volume of 1.5 mL / well. Supplement with serum to a final serum concentration of 8%.

[0050] 4. Grouping: The cells were then divided into a control treatment group (M0+231 group) and a drug treatment group (MK-906 treatment group, M0+231MK-906 group). At the same time, cells without any treatment served as a blank control group (M0 group). The details are as follows:

[0051] Group M0: cells obtained in step “1. Differentiation of human THP-1 cells”;

[0052] Group M0+231: cells obtained in step “3. Treatment of human THP-1 cells”;

[0053] M0+231MK-906 group: The cells obtained in step “3. Treatment of human THP-1 cells” were treated with drugs, ie, MK-906 (10 μM) was added to the obtained cells.

[0054] 5. RNA extraction: After 24 hours, place the cells on ice and wash three times with pre-cooled phosphate buffered saline (PBS). Add 1 mL of Trizol lysis buffer to each well and incubate on ice for 20 minutes. Collect the lysate, add 200 μL of chloroform, mix vigorously for 15 seconds, and let it stand on ice for 20 minutes. Centrifuge at 4°C, 13,000 rpm for 15 minutes. Aspirate the upper aqueous phase, add an equal volume of pre-cooled isopropanol, mix well, and let it stand on ice for 20 minutes. Centrifuge at 4°C, 13,000 rpm for 15 minutes. Discard the supernatant and wash the precipitate twice with 1 mL of 75% ethanol (centrifuge at 4°C, 13,000 rpm for 15 minutes). Dry the RNA precipitate and dissolve it with an appropriate amount of DEPC water.

[0055] 6. RNA quantification, reverse transcription and real-time quantitative PCR (RT-qPCR): RNA concentration and purity (OD 260 / OD 280 ≥1.8-2.0). RNA was reverse transcribed into cDNA using a reverse transcription kit. The reverse transcription system and PCR procedures are shown in Tables 1 and 2 below. Target gene expression levels were determined using RT-qPCR. Refer to the kit instructions for the specific reaction system and procedures. The cDNA concentration was adjusted to 200 ng / μL for RT-qPCR. The RT-PCR system and procedures are shown in Tables 3 and 4 below.

[0056] Table 1 Configuration of a single reverse transcription system

[0057] Components Dosage Remark Total RNA / mRNA 1-2 μg Adjust according to concentration 5×All-in-oneReactionMixforqPCR 4μL RNase-Free Water Mutable 15 μL with RNA TransScriptUniAll-in-OneEnzymeMix 1 μL Total volume 20 μL

[0058] Table 2 PCR program

[0059] program temperature time Stage 1×1 50℃ 5min Stage 2×1 85℃ 2min save 4℃ ∞

[0060] Table 3 RT-PCR system

[0061] Reagent name content SYBRGreen 5μL Forward primer (10 μM) 0.5μL Reverse primer (10 μM) 0.5μL cDNA (200 ng / μL) 4μL Total volume 10 μL

[0062] Table 4 RT-PCR program

[0063]

[0064]

[0065] 7. Data Analysis: Record RT-qPCR data, calculate relative expression of target genes, and perform statistical analysis. Use GraphPad Prism software for data visualization.

[0066] 8. Result: The result is as follows Figure 1As shown in the results, compared with the M0 group, the expression of ZBTB20 mRNA in the M0+231MK-906 group was significantly increased, the expression levels of M1 macrophage markers CD80 and TNF-α mRNA were significantly upregulated, while the expression levels of M2 macrophage markers CD206 and IL-10 mRNA were significantly downregulated. The results suggest that finasteride can effectively reverse the M2 polarization induced by the TNBC tumor microenvironment by regulating the expression of the ZBTB20 gene.

[0067] Example 2: The combination of finasteride and doxorubicin significantly inhibits TNBC tumor growth

[0068] 1. Tumor cell preparation: Prepare the required number of 4T1 cells (mouse TNBC cell line) at 5×10 per injection site. 5 Resuspend the cells in pre-chilled fetal bovine serum to obtain a cell suspension. Chill the cell suspension on ice for 1-2 minutes. Then, quickly mix the cell suspension with pre-chilled Matrigel at a 1:1 volume ratio and aliquot into pre-chilled 1.5 mL centrifuge tubes for 5-8 injection sites, keeping the mixture cool.

[0069] 2. Mouse Preparation: Use 6-8 week old female BALB / c mice. Allow the mice to acclimate to the environment for 1-2 days. Before injection, remove hair from the lower abdomen using a shaver and depilatory cream.

[0070] 3. Tumor cell inoculation: Intraperitoneally inject the mouse with an anesthetic (e.g., Zota). After the mouse is anesthetized, subcutaneously inject the prepared tumor cell suspension into the mammary fat pad of the mouse, injecting 5×10 5 Each mouse was injected with two cells. After the injection, the mice were ear-tagged and randomly grouped for housing.

[0071] 4. Drug treatment: After the tumor volume is palpable, drug intervention will be started. The mice were randomly divided into a control group (MOCK), a finasteride treatment group (MK-906), an adriamycin treatment group (ADR), and a finasteride and adriamycin combined treatment group (MK-906+ADR). The control group was given an equal volume of normal saline; the finasteride treatment group was given finasteride (0.5 mg / kg, gavage, daily administration) as a single drug; the adriamycin treatment group was given adriamycin (ADR, 4 mg / kg, intraperitoneal injection, once every three days) as a single drug; the finasteride and adriamycin combined treatment group was given finasteride (0.5 mg / kg, gavage, daily administration) and adriamycin (ADR, 4 mg / kg, intraperitoneal injection, once every three days) as a combined drug treatment.

[0072] 5. Tumor Growth Monitoring: Measure the long diameter (L) and short diameter (W) of the tumor every three days using a vernier caliper. Calculate tumor volume (V) using the formula: V = (L × W²) / 2. Terminate the experiment when the tumor volume reaches 1 cubic centimeter or the long diameter reaches 2 centimeters.

[0073] 6. Data analysis: Record and analyze the tumor growth curves of each group of mice to evaluate the anti-tumor efficacy of finasteride and doxorubicin alone and in combination.

[0074] 7. Result: The result is as follows Figure 2 As shown, compared with the control group, finasteride, doxorubicin, and doxorubicin combined with finasteride all inhibited tumor growth. In particular, the tumor growth inhibition effect of finasteride combined with doxorubicin was significantly better than that of the finasteride treatment group, doxorubicin treatment group, and control group. Statistical analysis of tumor volume at day 13 of drug administration showed that the difference in tumor volume between the groups was statistically significant. These results suggest that the combination of finasteride and doxorubicin has a significant synergistic anti-tumor effect in the treatment of TNBC.

[0075] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of finasteride in the preparation of a medicament for preventing and / or treating breast cancer.

2. The use according to claim 1, characterized in that The breast cancer includes triple-negative breast cancer.

3. The use according to claim 1, characterized in that The drug inhibits the polarization of M2 macrophages and promotes the polarization of M1 macrophages by increasing the expression of the ZBTB20 gene in macrophages, thereby achieving the effect of preventing and / or treating breast cancer.

4. A drug for preventing and / or treating breast cancer, characterized in that: The medicine comprises finasteride and pharmaceutically acceptable excipients.

5. The drug according to claim 4, characterized in that The drugs also include doxorubicin.

6. Use of ZBTB20 protein or ZBTB20 gene as a drug target in screening drugs for preventing and / or treating breast cancer.

7. The use according to claim 6, characterized in that The breast cancer includes triple-negative breast cancer.

8. A method for screening drugs for preventing and / or treating breast cancer, characterized in that: The method includes the step of detecting the expression level of the ZBTB20 protein or ZBTB20 gene in the subject before and after administration.

9. Use of ZBTB20 protein or a small molecule agonist of the ZBTB20 gene in the preparation of a drug for preventing and / or treating breast cancer.

10. A pharmaceutical composition for preventing and / or treating breast cancer, characterized in that: The pharmaceutical composition comprises ZBTB20 protein or a small molecule agonist of the ZBTB20 gene.

Images