Efficient silence system for verifying cucumber gene function in short term by down-regulated expression of endogenous target gene induced by ALSV virus

Abstract

The invention discloses an RNA (Ribonucleic Acid) virus-mediated cucumber simple, rapid and efficient gene silencing technical system, the operation process of RNA virus inoculation is simplified, only an agrobacterium VIGS mixed infection solution containing ALSV1 and ALSV2 target gene silencing vectors needs to be prepared, seeds germinated by the inoculated cucumber are directly infected by utilizing a vacuumizing method, and the seeds are directly infected by utilizing an agrobacterium tumefaciens VIGS mixed infection solution containing ALSV1 and ALSV2 target gene silencing vectors. The cucumber seedling characterization verification gene function can be observed in 16-18 days, the cucumber gene silencing efficiency can reach 100% through the method, and a new path is developed for verification and evaluation of the cucumber gene function.

Description

Technical Field

[0001] The invention belongs to the technical field of plant RNA virus-induced gene silencing, and particularly relates to a method for silencing endogenous genes of cucumber induced by ALSV virus mediated by Agrobacterium. Background Art

[0002] Virus-induced gene silencing (VIGS) is an important method for studying gene function. Plants are inoculated with a recombinant viral vector containing a plant cDNA fragment. The double-stranded RNA (dsRNA) produced by the virus is recognized by RNA silencing elements in the plant, cleaving and producing a large number of small interfering RNAs (siRNAs) targeting the plant's endogenous target gene mRNA. Reduced target gene expression can be used to identify gene function by observing changes in plant phenotypes or physiological parameters. VIGS offers advantages such as simplicity, rapid turnaround time, simultaneous silencing of multiple target genes, and independence from plant genetic transformation systems. It is widely used to study gene function in various plant species. Currently, VIGS is widely used in diverse fields, such as fruit and vegetable genome research, gene expression and editing, and viral vaccines. Silencing systems based on viral plasmids offer a highly effective method for studying gene function in crops.

[0003] Apple latent spherical virus (ALSV) vectors have been reported for gene silencing in cucumbers. ALSV, a member of the genus Cheravirus, produces isometric viral particles approximately 25 nm in diameter, containing two single-stranded genomic RNAs (RNA1 and RNA2). Compared to other reported viral vectors, ALSV has several advantages as a VIGS vector: First, as a latent virus, ALSV does not produce severe symptoms in most hosts. Second, ALSV vectors are highly stable and can persist throughout the growth cycle of the inoculated plant. Previous reports have shown that ALSV can stably persist in apple progeny. Third, ALSV has a broad host range. In addition to model plants such as tobacco and quinoa, previous studies have shown that it can also achieve gene silencing in plants from diverse families, including grapes, citrus fruits, and peppers.

[0004] Cucumber (Cucumis sativus L.), an annual herbaceous plant of the Cucurbitaceae family, is an important greenhouse-cultivated vegetable in my country. Cucumber genetic transformation systems are complex, time-consuming, and difficult, a major obstacle to studying cucumber gene function. Currently, ALSV-mediated VIGS systems primarily utilize a gene gun method. The ALSV vector is inoculated with Agrobacterium, the virus is propagated on Nicotiana benthamiana or quinoa, and high concentrations of viral particles are isolated before inoculation using a gene gun. This method is inherently complex and requires high equipment costs. Summary of the Invention

[0005] The technical problem solved by the present invention is to provide a high-efficiency gene silencing technology system for cucumbers mediated by RNA viruses, and simplify the operational process of RNA virus inoculation. By downregulating the expression of endogenous target genes, a new path is created to verify and evaluate the gene function of cucumbers in a short time.

[0006] The present invention adopts the following technical solution to solve the above technical problems, which is characterized by the following specific steps:

[0007] Step S1: constructing an ALSV2 virus silencing fragment plasmid containing the endogenous target gene, and at the same time transferring the ALSV1 plasmid into Agrobacterium tumefaciens GV3101 to screen for Agrobacterium containing the transformed plasmid;

[0008] Step S2: preparing VIGS infection solution using Agrobacterium containing ALSV viral plasmid;

[0009] Step S3: inoculating the VIGS infection solution prepared in step S2 using the vacuum method into the germinating cucumber seeds;

[0010] Step S4: culturing the germinated cucumber seeds processed in step S3 in the dark at 25° C. for 3 days;

[0011] Step S5: transplanting the cucumber seeds dark-cultured in step S4 into a 21-hole plug tray substrate, keeping it moist, and continuing to culture under conditions of 25° C., 16 h light / 8 h dark, and observing the characteristics of the cucumber seedlings after 16-18 days;

[0012] Furthermore, in step S2, the VIGS infection solution OD 600 =1.0;

[0013] Furthermore, the period of inoculating the germinated cucumber seeds in step S3 is the cucumber seeds that are one day old;

[0014] Furthermore, the germinated cucumber seeds inoculated in step S3 need to be wounded longitudinally at 2 / 3 of their cotyledons;

[0015] Furthermore, in step S3, the vacuum treatment is performed by placing the germinated cucumber seeds into a 20 ml medical syringe and extracting 10 ml of the recombinant plasmid-positive Agrobacterium VIGS infection solution. The number of cucumber seeds is limited to 10, and the vacuum treatment time is 1 min 30 s, which is repeated twice.

[0016] Furthermore, the specific process of step S1 is as follows:

[0017] Step S101: extracting total RNA from cucumber leaves and performing reverse transcription to obtain cDNA;

[0018] Step S102: Use the VIGS online website https: / / vigs.solgenomics.net / to select the Cucumissativus 9930 V3 genome database, set the n-mer size to 21 by default, the fragment length to 300 by default, and the mismatches to 0 by default, copy the CDS sequence of the endogenous target gene CsPDS (CsaV3_4G002690) into the sequence frame, perform VIGS analysis, and use the best target region sequence output from the website as the silencing fragment for constructing the ALSV-CsPDS vector for subsequent cloning;

[0019] Step S103: Design amplification primers based on the sequence shown in step S101. The amplification primer sequences are as follows:

[0020] ALSV-CsPDS-F:ttcacaCTCGAGCCCATGTCACTATGTGGGTCTCTCTCT

[0021] ALSV-CsPDS-R: tagcagGGATCCCCCACGTGCAGAAGCACGAAAACT

[0022] Using the cDNA in step S101 as a template, PCR amplification is performed and gel excision and recovery are performed to obtain CsPDS fragments;

[0023] Step S104: digesting the ALSV2 vector with SmaI enzyme, and recovering the ALSV2 fragment from the gel after digestion;

[0024] Step S105: homologously recombining the obtained CsPDS clone fragment and the enzyme-digested ALSV2 plasmid fragment;

[0025] Step S106: The ligation product from step S105 was transformed into competent E. coli, and a single clone was selected and sent to the company for sequencing. After the sequencing results were aligned correctly, the recombinant plasmid ALSV-CsPDS was extracted and transformed into Agrobacterium tumefaciens GV3101 (psoup-p19) and stored at -80°C. The sequencing primers are as follows:

[0026] ALSV2-empty-F:TCCAAGAAGTGCTTCCACTC

[0027] ALSV2-empty-R:TCTGTCAAATTGGGAGCACT

[0028] Furthermore, the reaction conditions for PCR amplification in step S103 are: 94°C for 1 min 30 s, 94°C for 20 s, 60°C for 20 s, 72°C for 50 s, 72°C for 5 min, and storage at 16°C for 35 cycles;

[0029] Furthermore, the specific process of step S2 is as follows:

[0030] Step S201: streak inoculation of the stored ALSV1 and ALSV-CsPDS positive Agrobacterium tumefaciens glycerol culture onto a YEP solid culture medium containing both kanamycin and rifampicin antibiotics, and incubate inverted in the dark at 28°C for 48 hours;

[0031] Step S202: soaking the cucumber seeds in warm water at 50°C for 20 minutes, peeling off the seed shells of the cucumber seeds that have fully absorbed water and swelled with tweezers, sowing the peeled cucumber seeds into a culture dish soaked in sterile water and padded with three layers of filter paper, and culturing them in the dark at 25°C for 36-48 hours;

[0032] Step S203: Pick one bacterial spot of ALSV1 and ALSV-CsPDS from the YEP culture medium obtained in step S201 with a sterile pipette tip, inoculate the spot into the YEP culture medium containing kanamycin and rifampicin, and culture at 28°C and 200 rpm for 24 hours;

[0033] Step S204: Use a balance to weigh 30g sucrose, 4.43g MS powder and 1000ml pure water, adjust the pH to 5.8, prepare an infection solution, sterilize it in an autoclave, cool it and set aside, measure the OD of the bacterial solution obtained in step S203 600 Calculate the required volume of bacterial solution based on the desired infection bacterial solution concentration and volume, centrifuge at 6000 rpm for 5 min, discard the supernatant, add the required volume of infection solution to the 50 ml centrifuge tube containing ALSV1 and ALSV-CsPDS precipitates, and resuspend the bacteria;

[0034] Step S205: mixing the infection solutions of ALSV1 and ALSV-CsPDS at equal concentrations and volumes in a ratio of 1:1 to prepare a VIGS infection solution;

[0035] Furthermore, the specific process of step S3 is as follows:

[0036] Step S301: let the mixed VIGS infection solution in step S205 stand at 28°C for 3 hours;

[0037] Step S302: treating the wound of the cucumber seeds germinated in step S202, placing them in a syringe cavity, drawing in the VIGS infection solution from step S301, plugging the syringe with a rubber stopper, and pulling the piston to perform vacuum treatment;

[0038] Step S303: Observe whether the radicle of the cucumber seeds germinated after vacuum treatment obtained in step S302 is white and transparent, and place the successfully vacuum-treated cucumber seeds germinated in a culture dish soaked in sterile water and padded with three layers of filter paper. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the detailed process of the ALSV-mediated efficient silencing system.

[0040] Figure 2 Photobleaching phenomenon of ALSV-CsPDS silenced plants.

[0041] Figure 3 The relative expression level detection results of CsPDS gene in ALSV-CsPDS silenced plants. DETAILED DESCRIPTION

[0042] The above contents of the present invention are further described in detail below through examples, but this should not be understood as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above contents of the present invention fall within the scope of the present invention.

[0043] The present invention provides a high-efficiency gene silencing technology system for cucumbers mediated by RNA viruses, simplifies the operational process of RNA virus inoculation, and provides a new path for verifying and evaluating cucumber gene function in a short period of time by downregulating the expression of endogenous target genes. The specific process is as follows:

[0044] 1. Construction of Silencing Vector

[0045] 1. Use the VIGS online website https: / / vigs.solgenomics.net / , select the Cucumis sativus 9930 V3 genome database, set the n-mer size to 21 by default, the fragment length to 300 by default, and the mismatches to 0 by default. Copy the CDS sequence of the endogenous target gene CsPDS (CsaV3_4G002690) into the sequence frame for VIGS analysis. Use the best target region sequence output from the website as the silencing fragment for constructing the ALSV-CsPDS vector for subsequent cloning. The CsPDS (CsaV3_4G002690) sequence is shown below:

[0046]

[0047]

[0048] Primers were designed using SnapGene software, using the CsPDS silencing fragment as the target fragment for PCR cloning. Primer sequences were designed based on the blunt ends generated by SmaI digestion of the ALSV2 vector.

[0049] ALSV-CsPDS-F:ttcacaCTCGAGCCCATGTCACTATGTGGGTCTCTCTCT

[0050] ALSV-CsPDS-R: tagcagGGATCCCCCACGTGCAGAAGCACGAAAACT

[0051] 2. PCR amplification of the CsPDS gene-specific fragment was performed using cucumber leaf cDNA as a template. The PCR reaction program was 94°C for 1 min 30 s, 94°C for 20 s, 60°C for 20 s, 72°C for 50 s, and 72°C for 5 min, for 35 cycles. The PCR reaction system is shown in Table 1:

[0052]

[0053]

[0054] 3. Detect PCR products by agarose gel electrophoresis. Weigh 0.25g of agarose and place it in a conical flask. Add 25mL of 1× TAE solution and microwave until the agarose is completely melted. Place the inner tank horizontally and place a comb. Add 2.5µl of nucleic acid dye to the agarose gel solution cooled to approximately 65°C. Shake thoroughly to mix, and then pour onto the glass plate in the inner tank. Let it stand at room temperature until the gel is completely solidified. Gently remove the comb vertically to prepare a 1% agarose gel. Place the gel and inner tank in an electrophoresis tank. Use a 10µL micropipette to add DL 2000 DNA Marker (as a control) and the PCR amplification product into the small groove of the gel plate. After adding the samples, apply the power and perform electrophoresis at a voltage of 100V. After electrophoresis, remove the gel and visualize it with a gel imager using UV light. A bright band at 330bp should be observed, indicating successful amplification of the target fragment.

[0055] 4. Cut the PCR product from the agarose gel and purify it using the Qingke Biotechnology Company gel purification kit.

[0056] The final sequence of the silence segment is as follows:

[0057]

[0058] 5. Use SmaI enzyme to digest the ALSV2 empty plasmid. The enzyme digestion reaction program is: 37℃ for 30min, stored at 4℃. The enzyme digestion reaction system is shown in Table 2:

[0059]

[0060] 6. Detect the digested product by agarose gel electrophoresis, use the undigested ALSV2 empty plasmid as a control, and determine whether it is cut based on the bands.

[0061] 7. Cut the PCR product from the agarose gel and purify it using the purification kit from Qingke Biotechnology.

[0062] 8. Use the One-Step Seamless Cloning Mix of the Kangwei Century Homologous Recombination Kit to homologously recombine the cloned fragment and the enzyme-digested plasmid fragment. The recombination reaction PCR program is: 50℃ for 10 minutes, stored at 16℃. The recombination reaction system is shown in Table 3:

[0063]

[0064] The calculation formulas for X and Y in the table are: optimal cloning vector usage = (0.02 × cloning vector base number) ng, usage of each insert = (0.04 × insert base pair number) ng.

[0065] 9. Transfer 10 μl of the ligation product obtained above into competent E. coli cells and perform plasmid transformation of E. coli according to the heat shock method. Add 700 μl of LB liquid and place it on a shaker at 37°C, 200 rpm, for 1 hour. Centrifuge the resulting product at 6000 rpm, 4 minutes. Spread the centrifuged product on LB solid medium containing kanamycin and culture it upside down at 37°C for 12-16 hours.

[0066] 10. From the above LB solid medium, select a single E. coli colony and perform colony PCR to screen for positive strains.

[0067] 11. Inoculate the positive strain into a 40 ml conical flask containing LB liquid medium containing kanamycin (50 mg / L) and culture it in a shaking incubator at 37°C overnight.

[0068] 12. Use the Qingke Plasmid Extraction Kit to extract plasmids from the overnight E. coli culture. Sequence the plasmids, and confirm the correct plasmids for Agrobacterium transformation. Add the extracted plasmids to the competent Agrobacterium culture, gently pipette, and incubate on ice for 5 minutes. Then, place in liquid nitrogen for 5 minutes, then incubate in a 37°C water bath for 5 minutes, and finally incubate on ice for 5 minutes. Add 700 μL of YEP liquid to the culture and shake at 28°C at 200 rpm for 2 hours.

[0069] 13. Pipette 50ul of the above-treated Agrobacterium and add it to the YEP culture plate containing kanamycin and rifampicin. Use a coating rod to evenly spread the entire plate surface and culture it at 28℃ overnight.

[0070] 14. Mix the overnight cultured Agrobacterium with 50% glycerol at a ratio of 1:1 and place in a 2 ml centrifuge tube. Quickly freeze in liquid nitrogen and store at -80°C.

[0071] 15. Weigh 4.125g of YEP broth powder and 3.75g of agar into a 250ml conical flask, and finally add 250ml of pure water. Seal the flask with parafilm and place it in an autoclave for sterilization. Add kanamycin and rifampicin to the sterilized YEP solution, and pour the hormone-mixed YEP liquid into a bacterial culture dish to prepare a YEP + secondary antibody culture medium.

[0072] 2. Preparation of VIGS infection solution

[0073] 16. Inoculate the preserved positive Agrobacterium ALSV1 and ALSV-CsPDS transformed with the recombinant plasmid into YEP medium containing kanamycin and rifampicin respectively, and culture inverted in the dark at 28℃ for 48h.

[0074] 17. Soak the cucumber seeds in warm water at 50°C for 20 minutes. Use tweezers to peel off the seed shells of the cucumber seeds that have fully absorbed water and expanded. Place the peeled cucumber seeds in a culture dish lined with 3 layers of filter paper soaked in sterile water. Culture in the dark at 25°C for 24 hours and observe whether the cotyledons turn white.

[0075] 18. From the YEP medium inoculated with positive Agrobacterium, pick a single ALSV1 and ALSV-CsPDS bacterial spot with a pipette tip and inoculate into 50 ml of YEP culture medium containing kanamycin and rifampicin. Incubate at 28°C with shaking for 24 hours.

[0076] 19. Measure the OD of the bacterial solution using a spectrophotometer 600 The value of (OD 600 = 1), calculate the required bacterial concentration, transfer ALSV1 and ALSV-CsPDS bacterial suspensions into separate 50-ml centrifuge tubes, centrifuge at 25°C, 6000 rpm for 5 minutes, discard the supernatant, and add 20 ml of infection solution to each of the 50-ml centrifuge tubes containing the ALSV1 and ALSV-CsPDS precipitates. The infection solution consists of 1.11 g of MS powder and 7.5 g of sucrose in 250 ml of purified water, adjusted to pH 5.8, and sterilized before use.

[0077] 20. Mix the infection solutions of ALSV1 and ALSV-CsPDS in a ratio of 1:1 to prepare the VIGS infection solution.

[0078] 3. Agrobacterium infection of cucumber

[0079] 21. For cucumber seeds that have turned white for one day, make longitudinal cuts at two-thirds of their cotyledons to create wounds.

[0080] 22. Place the treated cucumber seeds in the VIGS infection solution and use a 20ml syringe to vacuum the solution. The vacuuming time is 1min 30s and repeated twice. The operation process is as follows: Figure 1 shown.

[0081] 23. Place the vacuum-treated cucumber seeds in a culture dish lined with three layers of filter paper soaked in sterile water and culture in the dark at 25°C for 3 days.

[0082] 4. Transplanting cucumber seedlings

[0083] 24. Transplant the cucumber seeds that have been dark-cultured into a 21-hole tray substrate, keep it moist, and culture it in an environment with 16 hours of light and 8 hours of darkness. Observe after 16-18 days.

[0084] 5. Observation of Cucumber Plant Morphology by Photobleaching

[0085] 25. Observe the leaves of the transformed plants. If there are white leaves, it is a silent strain. Figure 2 The expression level of the target gene in the phenotype plants was detected by real-time quantitative PCR. Figure 3 As shown in the figure, the expression level of CsPDS gene in the experimental group decreased significantly. The results showed that the gene silencing system was successfully constructed.

[0086] The above embodiments describe the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for illustrating the principles of the present invention. Without departing from the scope of the principles of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of protection of the present invention.

Claims

1. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of endogenous target gene expression by ALSV virus, characterized in that The specific steps are: Step S1: constructing an ALSV2 viral silencing fragment plasmid containing the endogenous target gene, and at the same time transferring the ALSV1 plasmid into Agrobacterium tumefaciens GV3101 for screening to obtain Agrobacterium containing the transformed plasmid; Step S2: preparing VIGS infection solution using Agrobacterium containing ALSV viral plasmid; Step S3: inoculating the VIGS infection solution prepared in step S2 into the germinating cucumber seeds using a vacuum method; Step S4: culturing the germinated cucumber seeds processed in step S3 in the dark at 25° C. for 3 days; Step S5: Transplant the cucumber seeds treated with dark culture in step S4 into a 21-hole tray substrate, keep it moist, and continue to culture at 25° C., 16 h light / 8 h dark conditions, and observe the characteristics of the cucumber seedlings after 16-18 days.

2. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of expression of an endogenous target gene by ALSV virus according to claim 1, characterized in that: OD of the VIGS infection solution prepared in step S2 600 =1.

0.

3. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of expression of an endogenous target gene by ALSV virus according to claim 1, characterized in that: The period of inoculating the germinated cucumber seeds in step S3 is the cucumber seeds that are one day old.

4. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of endogenous target gene expression using ALSV virus according to claim 1, characterized in that: The germinated cucumber seeds inoculated in step S3 need to be wounded at 2 / 3 of their cotyledons.

5. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of expression of an endogenous target gene by ALSV virus according to claim 1, characterized in that: In step S3, the vacuum treatment is performed by placing the germinated cucumber seeds into a 20 ml medical syringe and extracting 10 ml of the recombinant plasmid-positive Agrobacterium VIGS infection solution. The number of cucumber seeds is limited to 10, and the vacuum treatment time is 1 min 30 s, which is repeated twice.

6. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of expression of an endogenous target gene by ALSV virus according to claim 1, characterized in that The specific process of step S1: Step S101: extracting total RNA from cucumber leaves and performing reverse transcription to obtain cDNA; Step S102: Using the VIGS online website https: / / vigs.solgenomics.net / , select the Cucumissativus 9930 V3 genome database, set the n-mer size to 21 by default, the fragment length to 300 by default, and the mismatches to 0 by default, copy the CDS sequence of the endogenous target gene CsPDS (CsaV3_4G002690) into the sequence frame, perform VIGS analysis, and use the optimal target region sequence output from the website as the silencing fragment for constructing the ALSV-CsPDS vector for subsequent cloning; Step S103: Design amplification primers based on the sequence shown in step S101. The amplification primer sequences are as follows: ALSV-CsPDS-F:ttcacaCTCGAGCCCATGTCACTATGTGGGTCTCTCTCT ALSV-CsPDS-R: tagcagGGATCCCCCACGTGCAGAAGCACGAAAACT Using the cDNA in step S101 as a template, PCR amplification is performed and gel excision and recovery are performed to obtain CsPDS fragments; Step S104: digesting the ALSV2 vector with SmaI enzyme, and recovering the ALSV fragments on gel after digestion; Step S105: homologously recombining the obtained CsPDS clone fragment and the enzyme-digested ALSV2 plasmid fragment; Step S106: The ligation product in step S105 was transferred into the competent Escherichia coli, and a single clone was selected and sent to the company for sequencing. After the sequencing results were correctly aligned, the recombinant plasmid ALSV-CsPDS was extracted and transferred into Agrobacterium tumefaciens GV3101 (psoup-p19) and stored at -80°C; the sequencing primers were as follows: ALSV2-empty-F: TCCAAGAAGTGCTTCCACTC, ALSV2-empty-R: TCTGTCAAATTGGGAGCACT.

7. The ALSV virus-induced downregulation of endogenous target genes according to claim 4 achieves efficient silencing system for verifying cucumber gene function in a short period of time, characterized by: The reaction conditions for PCR amplification in step S103 are: 94°C for 1 min 30 s, 94°C for 20 s, 60°C for 20 s, 72°C for 50 s, 72°C for 5 min, and storage at 16°C for 35 cycles.

8. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of endogenous target gene expression by ALSV virus according to claim 1, characterized in that The specific process of step S2: Step S201: streak inoculation of the stored ALSV1 and ALSV-CsPDS positive Agrobacterium tumefaciens glycerol culture onto a YEP solid culture medium containing both kanamycin and rifampicin antibiotics, and incubate inverted in the dark at 28°C for 48 hours; Step S202: soaking the cucumber seeds in warm water at 50°C for 20 minutes, peeling off the seed shells of the cucumber seeds that have fully absorbed water and swelled with tweezers, sowing the peeled cucumber seeds into a petri dish soaked in sterile water and padded with three layers of filter paper, and culturing at 25°C in the dark for 36-48 hours; Step S203: Pick one bacterial spot of ALSV1 and ALSV-CsPDS from the YEP culture medium obtained in step S201 with a sterile pipette tip, inoculate the spot into the YEP culture medium containing kanamycin and rifampicin, and culture at 28°C and 200 rpm for 24 hours; Step S204: Use a balance to weigh 30 g of sucrose, 4.43 g of MS powder, and 1000 ml of pure water, adjust the pH to 5.8, and prepare an infection solution. Sterilize the solution in an autoclave and cool it for later use. Measure the OD600 value of the bacterial solution obtained in step S203, calculate the required volume of the bacterial solution based on the required infection concentration and volume, centrifuge at 6000 rpm for 5 min, discard the supernatant, add the required volume of infection solution to the 50 ml centrifuge tube containing the ALSV1 and ALSV-CsPDS precipitates, and resuspend the bacteria. Step S205: The infection solution of ALSV1 and ALSV-CsPDS is mixed at equal concentrations and volumes in a ratio of 1:1 to prepare the VIGS infection solution.

9. An efficient silencing system for verifying cucumber gene function in a short period of time by inducing down-regulation of expression of an endogenous target gene by ALSV virus according to claim 1, characterized in that The specific process of step S3: Step S301: let the mixed VIGS infection solution in step S205 stand at 28°C for 3 hours; Step S302: treating the wound of the cucumber seeds germinated in step S202, placing them in a syringe cavity, drawing in the VIGS infection solution from step S301, plugging the syringe with a rubber stopper, and pulling the piston to perform vacuum treatment; Step S303: Observe whether the radicle of the cucumber seeds germinated after vacuum treatment obtained in step S302 is white and transparent, and place the successfully vacuum-treated cucumber seeds germinated in a culture dish soaked in sterile water and padded with three layers of filter paper.

Images