Salt-tolerant growth-promoting and disease-preventing bacteria B32 and its application in cucumber cultivation

Abstract

The application provides a salt-tolerant growth-promoting and disease-preventing bacterium B32 and application thereof in cucumber cultivation, and belongs to the technical field of agricultural microorganisms. Bacillus subtilis The salt-tolerant growth-promoting and disease-preventing bacterium B32 is named Bacillus subtilis (B32), is preserved in the China Center for Type Culture Collection, is preserved on January 4, 2023, has a preservation number of CCTCC NO: M2023019, has high salt tolerance and good growth-promoting characteristics, and has inhibiting effects on various crop diseases; the strain can significantly improve the salt-tolerance and growth-promoting capacity of cucumber under salt stress, can be effectively used for cucumber planting in saline-alkali land, and improves the yield and quality of cucumber.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a salt-tolerant, growth-promoting, and disease-preventing bacterium B32 and its application in cucumber cultivation. Background Technology

[0002] Cucumbers are a common vegetable and fruit, suitable for planting in neutral to slightly acidic soils. Currently, salt stress is one of the main environmental stresses facing cucumber production. When the soil is high in salt and low in nutrients, excessive salt reduces the activity of PEP carboxylase and RuBP carboxylase in plants, destroys chlorophyll, hinders its biosynthesis, closes stomata, and reduces the photosynthetic rate, affecting crop yield. At the same time, excessive salt reduces net photosynthetic productivity, which is not conducive to plant growth. Furthermore, salt stress forces the accumulation of toxic metabolites in plants, such as free amino acids, amines, and ammonia produced by protein decomposition, resulting in poor leaf growth and inhibiting root growth. Therefore, cucumbers do not grow well in saline-alkali soils, and both yield and quality fail to meet expectations.

[0003] Biological measures are widely considered the most effective way to mitigate agricultural salt damage due to their green and environmentally friendly nature. Among them, utilizing microorganisms to alleviate the pressure on saline-alkali soil agriculture is of great significance for promoting the healthy development of sustainable agriculture. For example, Chinese invention patent CN201910429322.0 discloses a salt-tolerant growth-promoting bacterium strain B9 and its application. This strain is classified as Pseudomonas punonensis and can promote tomato growth under salt stress. Chinese invention patent CN201910429804.6 discloses a salt-tolerant growth-promoting bacterium strain Y4 and its application. This strain is classified as Halomonas olivaria and can promote tomato growth under salt stress.

[0004] However, there is still a lack of highly efficient salt-tolerant growth-promoting microorganisms specifically for cucumber cultivation. Therefore, screening for highly efficient salt-tolerant growth-promoting microorganisms suitable for cucumber cultivation in saline-alkali soil is of great significance for improving cucumber yield and quality. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a salt-tolerant, growth-promoting, and disease-preventing bacterium B32, which has high salt tolerance and good growth-promoting properties, and also has an inhibitory effect on a variety of crop diseases.

[0006] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 in cucumber cultivation to effectively promote cucumber growth and improve yield and quality.

[0007] The technical solution adopted in this invention is as follows:

[0008] This invention provides a salt-tolerant, growth-promoting, and disease-preventing bacterium, B32, classified and named Bacillus subtilis B32, which is deposited at the China Center for Type Culture Collection on January 4, 2023, with accession number CCTCC NO:M2023019.

[0009] This invention involves collecting soil samples from saline-alkali land in Baofeng Town, Shizuishan City, Ningxia, and isolating a strain with salt tolerance, growth-promoting, and disease-preventing capabilities. After physicochemical property identification and 16S rDNA sequence analysis, the strain was identified as Bacillus subtilis and named Bacillus subtilis B32. Its maximum salt tolerance concentration is 14%, and its growth-promoting characteristics include: potassium solubilization, phosphorus solubilization, nitrogen fixation, siderophore production, ACC deaminase production, and synthesis of auxin IAA.

[0010] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 in promoting cucumber seed germination under salt stress.

[0011] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 in promoting cucumber growth under salt stress.

[0012] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 in improving soil nutrients under salt stress.

[0013] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 in the prevention and control of crop diseases, wherein the crop disease is one of cucumber wilt, cucumber root rot, tomato wilt, watermelon wilt, melon damping-off, and melon wilt.

[0014] The present invention also provides the application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 as a microbial liquid fertilizer for promoting cucumber growth, wherein the microbial liquid fertilizer contains the salt-tolerant growth-promoting and disease-preventing bacterium B32 as an active ingredient.

[0015] Preferably, the viable count of the salt-tolerant growth-promoting and disease-preventing bacterium B32 is 10. 5 -10 8 cfu / mL.

[0016] Beneficial Effects: This invention provides a salt-tolerant, growth-promoting, and disease-preventing bacterium, B32. This strain has a maximum salt tolerance of 14% and possesses the abilities to solubilize potassium, dissolve phosphorus, fix nitrogen, produce siderophores, produce ACC deaminase, and synthesize the auxin IAA. Under salt stress, this strain can significantly improve the salt tolerance and growth-promoting ability of cucumbers, promote cucumber seed germination, and significantly promote the development of cucumber seed radicles and lateral roots. It promotes cucumber growth, significantly increasing the plant height, stem diameter, chlorophyll content, dry weight, and fresh weight of cucumber seedlings. It significantly reduces soil electrical conductivity under salt stress, increases the content of available potassium and available nitrogen in the soil, mitigates salt damage, and improves soil nutrients, thereby helping to improve the salt tolerance of cucumbers. In addition, this strain also has a broad-spectrum antibacterial effect and can control cucumber wilt, cucumber root rot, tomato wilt, watermelon wilt, melon damping-off, and melon wilt, showing good application prospects. Attached Figure Description

[0017] Figure 1 This is a colony morphology diagram of Bacillus subtilis B32.

[0018] Figure 2 Phylogenetic tree of Bacillus subtilis B32.

[0019] Figure 3 The results of potassium solubilization assay for Bacillus subtilis B32.

[0020] Figure 4 The results are for the phosphorus solubilization test of Bacillus subtilis B32.

[0021] Figure 5 The results are for nitrogen fixation detection of Bacillus subtilis B32.

[0022] Figure 6 The results are for the detection of siderophores produced by Bacillus subtilis B32.

[0023] Figure 7 The results of the detection of auxin IAA synthesized by Bacillus subtilis B32.

[0024] Figure 8 The results of ACC deaminase detection for Bacillus subtilis B32.

[0025] Figure 9 This image shows the germination of cucumber seeds after inoculation with Bacillus subtilis B32 under salt stress.

[0026] Figure 10 This is a schematic diagram illustrating the growth-promoting effect of Bacillus subtilis B32 in potted plants.

[0027] Figure 11 This is a schematic diagram illustrating the growth-promoting effect of Bacillus subtilis B32 in potted plants under salt stress.

[0028] Figure 12The inhibitory effect of Bacillus subtilis B32 on various plant diseases. Detailed Implementation

[0029] The technical solutions and effects of the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0030] This invention provides a salt-tolerant, growth-promoting, and disease-preventing bacterium, B32, classified and named Bacillus subtilis B32, which is deposited at the China Center for Type Culture Collection on January 4, 2023, with accession number CCTCC NO:M2023019.

[0031] This invention involves collecting soil samples from saline-alkali land in Baofeng Town, Shizuishan City, Ningxia. The samples were placed in clean sampling bags, labeled, and stored at 4°C for later use. 10g of the collected soil sample was weighed and placed in a 250mL Erlenmeyer flask containing 90mL of sterile water. The flask was shaken at 180rpm for 30min, then placed in an 80°C water bath and allowed to stand for 30min. Using a 1mL pipette, 1mL of the sample was added to a test tube containing 9mL of sterile water and mixed thoroughly. Then, 1mL of the sample was added to another test tube containing 9mL of sterile water and mixed thoroughly. This process was repeated to prepare 10... -1 10 -2 10 -3 10 -4 10 -5 After preparing solutions of different dilutions, 0.1 mL of each solution was spread evenly on NA medium plates containing 10% sodium chloride. The plates were then inverted and incubated in a 30°C incubator for 2-3 days. Single colonies were picked and inoculated onto NA medium. Once bacterial growth was observed, the plates were stored at 4°C for later use.

[0032] Preparation of B32 bacterial culture: Dispense 10 mL of LB liquid medium into a 50 mL Erlenmeyer flask, seal the flask, and sterilize at 120 °C for 15 min. Inoculate a loopful of pure bacteria into cooled culture medium and incubate at 30 °C and 200 rpm for 24 h. The optimal culture medium and fermentation conditions for strain B32 are determined using the bacterial OD600 value as an indicator.

[0033] The culture media used in the experiment were: NA medium, LB medium, PDA medium, ADF liquid medium, NBRIP phosphate solubilization medium, Assumption medium, methyl red test medium, glucose oxidation fermentation test medium, starch hydrolysis test medium, cellulose hydrolysis test medium, gelatin liquefaction test medium, chromate azurite (CAS) medium, and silicate bacteria medium. All of the above culture media were prepared using conventional methods.

[0034] Example 1: Identification of strain B32

[0035] (1) Cell morphology and colony characteristics

[0036] See Figure 1 The colonies of strain B32 are small, white, with neat edges, smooth and moist surface, and opaque. Young cells are irregular rod-shaped with rounded ends.

[0037] (2) Physiological and biochemical characteristics

[0038] Table 1: Physiological and Biochemical Results

[0039]

[0040] As shown in Table 1, the physiological and biochemical test results indicate that strain B32 has oxidase and catalase activities, and can synthesize amylase. It is positive for gelatin liquefaction, acetylmethyl methanol and glucose oxidation fermentation, while the rest are negative.

[0041] (3) 16S rDNA sequence analysis of strain B32

[0042] Furthermore, the isolated and purified B32 strain was analyzed by 16S rDNA sequence analysis. The 16S rDNA sequence of strain B32 is as follows:

[0043] GGGCCGTCGCGTGCTATACATGCAAGTCGAGCGGACAGATGGGAGCT

[0044] TGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGC

[0045] CTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGCTTGT

[0046] TTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGA

[0047] TGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCA

[0048] ACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGAC

[0049] ACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGA

[0050] CGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCG

[0051] TAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTAC

[0052] CTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCG

[0053] CGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGC

[0054] TCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGG

[0055] AGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAAT

[0056] TCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCG

[0057] AAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGG

[0058] AGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCT

[0059] AAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCAC

[0060] TCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGG

[0061] GGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAG

[0062] AACCTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGTCCC

[0063] CTTCGGGGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCG

[0064] TGAGATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGC

[0065] CAGCATTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGA

[0066] AGGTGGGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACAC

[0067] GTGCTACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCA

[0068] ATCCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGT

[0069] GAAGCTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTT

[0070] CCCGGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCC

[0071] GAAGTCGGTGAGGTAACCTTTTAGGAGCCAGCCGCCGAAGGTGACAGAG. Sequencing results were compared with those in the NCBI database for phylogenetic analysis. See [link / reference]. Figure 2 Based on the homology comparison analysis results, the strain was identified as Bacillus subtilis and named Bacillus subtilis B32.

[0072] Example 2: Salt tolerance test of Bacillus subtilis B32

[0073] The bacterial suspension of strain B32 was inoculated at a rate of 1.0% into LB medium with a pH of 7 and containing different sodium chloride concentrations (10, 11, 12, 13, 14, 15, 16, 17%). The culture was then incubated at 30°C with shaking at 150 rpm for 24 h. The results showed that the maximum salt tolerance of this strain reached 14%.

[0074] Example 3: Detection of the growth-promoting characteristics of Bacillus subtilis B32

[0075] (1) Qualitative determination of potassium solubilization capacity

[0076] The B32 strain was cultured in LB liquid medium for 24 hours, centrifuged at 10,000 rpm for 5 minutes, and 10 μL of bacterial suspension was evenly spread on silicate bacteria medium plates. The culture was carried out at 30°C for several days, and the presence of oil droplet-like bacterial growth was observed. The experiment was repeated three times.

[0077] Qualitative determination of phosphorus solubility

[0078] (2) Qualitative determination of phosphorus solubility

[0079] The B32 strain was cultured in LB liquid medium for 24 hours, centrifuged at 10,000 rpm for 5 minutes, and 10 μL of bacterial suspension was transferred to a 6 mm sterile filter paper disc on the medium. The disc was then incubated at 30°C for several days, and the presence of sterile cells around the disc was observed. This was repeated three times.

[0080] (3) Qualitative determination of nitrogen fixation capacity

[0081] The B32 strain was cultured in LB liquid medium for 24 hours, centrifuged at 10,000 rpm for 5 minutes, and 10 μL of bacterial suspension was transferred to a 6 mm sterile filter paper disc of Assoube medium. The disc was then incubated at 30°C for several days, and the presence of sterile cells around it was observed. The experiment was repeated three times.

[0082] (4) Determination of iron-producing capacity

[0083] The B32 strain was cultured in LB liquid medium for 24 hours, centrifuged at 10,000 rpm for 5 minutes, and 10 μL of bacterial suspension was transferred to a 6 mm sterile filter paper plate of the chroma blue CAS detection plate. The plate was incubated at 30°C for several days, and the presence of a yellow-green halo was observed. The experiment was repeated three times.

[0084] (5) Assay on the ability to synthesize auxin IAA

[0085] A single colony was picked using an inoculation loop and inoculated into LB broth containing L-tryptophan (100 mg / L), with three replicates per strain, and incubated at 30°C for 1 day. 100 μL of the bacterial suspension was added dropwise to a white ceramic plate, along with an equal volume of Salkowski colorimetric reagent, and mixed thoroughly. Simultaneously, 100 μL of blank LB broth was mixed with an equal volume of Salkowski colorimetric reagent as a blank treatment. The color change was observed after 30 minutes of incubation at room temperature in the dark. A red reaction indicates the production of IAA, and the deeper the red, the higher the IAA yield.

[0086] (6) Assay for ACC deaminase production capacity

[0087] The B32 strain was cultured in LB liquid medium for 24 hours, centrifuged at 10,000 rpm for 5 minutes, and 1 mL of the bacterial suspension was transferred to ADF liquid medium and incubated at 180 rpm for 24 hours in the dark with shaking (this process was repeated once more). Then, 200 μL of the final bacterial suspension was spread onto ADF solid plates, with each plate replicated three times. The plates were incubated at 30°C for several days. If colonies grew on the ADF plates, the plates possessed ACC deaminase activity; otherwise, they did not.

[0088] See final results Figures 3 to 8 Bacillus subtilis B32 has the ability to solubilize potassium, solubilize phosphorus, fix nitrogen, produce siderophores, synthesize auxin IAA, and produce ACC deaminase.

[0089] Example 4: Salt tolerance test of Bacillus subtilis B32 on cucumber.

[0090] (1) The effect of Bacillus subtilis B32 on cucumber seed germination under salt stress

[0091] Cucumber seeds (Del 100) were purchased from Tianjin Deruit Seed Industry Co., Ltd. After disinfection and soaking, seed germination tests were conducted to evaluate the effect of B32 on the growth of cucumber seed radicles and hypocotyls under salt stress. Cucumber seeds were treated with 5 mL of 50 mmol / L salt solution, and then inoculated with different concentrations of bacterial suspension. Five seeds were used for each treatment, replicated three times. Growth promotion was assessed four days after inoculation, and the length of the radicle and hypocotyl, as well as their dry and fresh weight, were recorded.

[0092] Treatment 1: Irrigate with only 5 mL of 50 mmol / L saline solution.

[0093] Treatment 2: 5 mL of 50 mmol / L saline solution + 3 mL of 10 5 cfu / mLB32 strain resuspension

[0094] Treatment 3: 5 mL of 50 mmol / L saline solution + 3 mL of 10 6 cfu / mLB32 strain resuspension

[0095] Treatment 4: 5 mL of 50 mmol / L saline solution + 3 mL of 10 7 cfu / mLB32 strain resuspension

[0096] Treatment 5: 5 mL of 50 mmol / L saline solution + 3 mL of 10 8 cfu / mLB32 strain resuspension

[0097] Table 2: Growth-promoting effect of strain B32 on cucumber seed germination under salt stress

[0098]

[0099] Table 3: Growth-promoting effects of strain B32 on cucumber seed radicles, hypocotyls, and lateral roots under salt stress

[0100]

[0101] See Figure 9 Seed germination experiments showed that, under salt stress, strain B32 significantly promoted cucumber seed growth 4 days after inoculation with the bacterial suspension. Specifically, 10... 6 The CFU / mL B32 strain resuspension showed the best growth-promoting effect on cucumber seeds. Table 2 shows that, compared with the salt stress control, cucumber seeds treated with the B32 strain suspension exhibited improved germination potential, germination index, and vigor index. Table 3 shows that, compared with the salt stress control, the B32 strain suspension significantly promoted radicle growth in cucumber seeds, increasing it by 130.96%, 54.33%, 112.06%, and 46.99%, respectively. Furthermore, B32 strain also significantly promoted lateral root growth in cucumber seeds under salt stress, with lateral root promotion rates reaching 50.00%, 100.00%, 150.00%, and 133.33%, respectively.

[0102] (2) Growth-promoting effect of Bacillus subtilis B32 on cucumber seedlings under salt stress

[0103] The B32 strain was cultured (200 rpm, 28℃) until OD... 600 =Approximately 0.5, centrifuge the bacterial suspension at 10000m for 10min. Sterilize the surface of healthy cucumber seeds. After germination, plant the seeds in seedling trays. Once the cucumber seedlings have developed one bud and one leaf, transplant them into small pots containing vermiculite for further cultivation. When the seedlings have developed three leaves and one bud, treat the roots with a bacterial suspension of strain B32, 50mL per plant, at a concentration of 10. 6 The control group was irrigated with either clean water or saline solution, with each plant receiving 50 mL of the solution. Three days after irrigating with B32 bacteria, all treatments were treated with a 150 mmol / L NaCl solution, with each treatment replicated three times, and each replicate containing 30 plants. Plant height, stem diameter, chlorophyll content, and dry and fresh weight were measured after salt damage occurred.

[0104] Treatment 1: 50mL of water

[0105] Treatment 2: 50 mL 10 6 cfu / mLB32 strain resuspension

[0106] Treatment 3: 50 mL of 150 mmol / L salt solution

[0107] Treatment 4: 50 mL 150 mmol / L saline solution + 50 mL 10 6 cfu / mLB32 strain resuspension

[0108] Table 4: Growth-promoting effect of strain B32 on cucumber seedlings

[0109]

[0110] See results Figure 10 , Figure 11 According to Table 4, under non-salt stress (treatment 1), the addition of strain B32 had a significant growth-promoting effect on cucumber seedlings, with plant height, stem diameter, chlorophyll content, and dry and fresh weight increasing by 6.76%, 5.89%, 17.87%, 14.49%, and 13.17%, respectively. Under salt stress (treatment 3), the addition of strain B32 alleviated the inhibitory effect of salt damage on cucumber seedling growth, with plant height, stem diameter, chlorophyll content, and dry and fresh weight increasing by 1.79%, 1.62%, 3.78%, 11.67%, and 8.41%, respectively, compared to the control group.

[0111] Table 5: Effects of strain B32 on soil physicochemical properties

[0112]

[0113] As shown in Table 5, under non-salt stress (treatment 1), the addition of strain B21 reduced soil pH and electrical conductivity (EC) by 0.35% and 38.05%, respectively, and increased the content of available potassium, available nitrogen, and total phosphorus in the soil by 15.90%, 64.78%, and 8.07%, respectively. Under salt stress (treatment 3), the addition of strain B32 significantly reduced soil electrical conductivity (EC) by 28.81%, thereby alleviating salt damage and enhancing the plant's ability to fix and adsorb nutrients. At the same time, compared with the salt stress control group, the addition of strain B32 increased the content of available potassium and available nitrogen in the soil by 4.51% and 132.09%, respectively, indicating that strain B32 can improve soil nutrient status.

[0114] Example 5: Disease resistance test of Bacillus subtilis B32

[0115] The inhibitory effects of strain B32 on the pathogens of cucumber wilt, cucumber root rot, tomato wilt, watermelon wilt, melon damping-off, and melon wilt were determined by plate confrontation test after five days of incubation in an incubator.

[0116] Table 6: Disease resistance effect of strain B32 against crop diseases

[0117]

[0118]

[0119] Test results as follows Figure 12 As shown in Table 6. Figure 12 In the table, A represents cucumber wilt, B represents cucumber root rot, C represents tomato wilt, D represents watermelon wilt, E represents melon damping-off, and F represents melon wilt. The results showed that strain B32 had inhibitory effects on cucumber wilt, cucumber root rot, tomato wilt, watermelon wilt, melon damping-off, and melon wilt, with inhibition rates of 32.19%, 43.75%, 36.92%, 34.78%, 41.18%, and 32.84%, respectively.

Claims

1. A salt-tolerant, growth-promoting, and disease-resistant bacterium B32, characterized in that: The salt-tolerant, growth-promoting, and disease-preventing bacterium B32 is classified as Bacillus subtilis (B. subtilis). Bacillus subtilis B32, deposited at the China Center for Type Culture Collection, date of deposit: January 4, 2023, accession number: CCTCC NO:M2023019.

2. The application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 as described in claim 1 in promoting cucumber seed germination under salt stress.

3. The application of the salt-tolerant growth-promoting and disease-preventing bacterium B32 as described in claim 1 in promoting cucumber growth under salt stress.

4. The application of the salt-tolerant growth-promoting and disease-preventing bacterium B21 as described in claim 1 in improving soil nutrients under salt stress.

5. The application of salt-tolerant, growth-promoting, and disease-resistant bacterium B32 as described in claim 1 in the control of crop diseases, characterized in that: The crop disease mentioned is one of the following: cucumber wilt, cucumber root rot, tomato wilt, watermelon wilt, melon damping-off, and melon wilt.

6. The application of the salt-tolerant growth-promoting and disease-preventing bacteria B32 as described in claim 1 as a microbial liquid fertilizer for promoting cucumber growth, characterized in that: The microbial liquid fertilizer contains the salt-tolerant, growth-promoting, and disease-preventing bacterium B32 as an active ingredient.

7. The application as described in claim 6, characterized in that: The viable count of the salt-tolerant, growth-promoting, and disease-preventing bacterium B32 was 10. 5 -10 8 cfu / mL.

Images