A set of SNP marker combinations, probe sets and their applications for single-fruit relabeling-assisted selection of apples

By providing SNP marker combinations and probes to assist in the selection of apple single fruit weight markers, the problem of the lack of accurate prediction of apple single fruit weight in existing technologies has been solved, thereby improving the efficiency of apple breeding and creating high-quality disease-resistant varieties.

CN120464781BActive Publication Date: 2026-05-26CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2025-06-19
Publication Date
2026-05-26

Smart Images

  • Figure CN120464781B_ABST
    Figure CN120464781B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of molecular biology technology, specifically relating to a set of SNP marker combinations, probe sets, and their applications for marker-assisted selection of apple single fruit weight. The SNP marker combination consists of 16 SNP markers, including SNP1 to SNP16; the nucleotide sequences of SNP1 to SNP16 are shown in SEQ ID NO.1 to SEQ ID NO.16, respectively. This invention focuses on major variable sites controlling single fruit weight in *Malus* plants, and has developed 16 major SNP markers linked to the apple single fruit weight trait, suitable for marker-assisted selection of apple single fruit weight during the seedling stage of breeding materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a set of SNP marker combinations, probe sets and their applications for single-fruit heavy marker-assisted selection of apples. Background Technology

[0002] apple, Malus domestica Apples are an important economic crop. my country's apple cultivation area is 29.01 million mu (approximately 1.67 million hectares), with a yield of 49.6017 million tons, accounting for 44.12% of the global cultivation area and 49.64% of the global yield. The genus *Malus* is extremely rich, with 35 species worldwide, including 27 wild species. Approximately 10,000 cultivars have been developed through artificial selection, hybridization, and clonal propagation. Apple fruit weight is an important fruit quality trait, and breeding new apple varieties with appropriate fruit weight is a crucial breeding goal and industry demand. For a long time, breeders have focused on a few high-quality parents for new variety selection. However, the limited genetic background restricts the availability of superior variation sites, leading to reduced genetic diversity. Furthermore, cultivars lack resistance genes, and hybridization between mainstream varieties cannot meet the breeding requirements of possessing both resistance and excellent fruit quality. Currently, there is a lack of methods for identifying undesirable variation sites in wild apple germplasm resources, limiting the full utilization of their superior characteristic genes. Apple fruit weight is a complex quantitative trait controlled by multiple genes.

[0003] To date, multiple fruit-size QTLs have been reported in apples, covering almost all chromosomes. Previous researchers developed molecular markers near the peaks of significant QTL intervals and established a comprehensive genome prediction model for single-fruit weight in apples, achieving a prediction accuracy of 0.7568. (Literature reports...) MdARF106 It is a single-fruit weight major-effect QTL located on chromosome 15. miRNA172p Co-localization with a significant fruit size QTL on chromosome 11 explained 13.9% of the phenotypic variation. However, the genetic mechanisms controlling small fruit size remain unclear, severely hindering the creation of superior resistant varieties through hybridization of cultivars and closely related species. Therefore, the prediction of apple fruit weight and the full utilization of apple relatives necessitate marker-assisted selection, but currently, there is a lack of molecular markers that can accurately predict apple fruit weight. Thus, it is urgent to discover new molecular markers capable of accurately predicting apple fruit weight. Summary of the Invention

[0004] To discover new molecular markers capable of accurately predicting apple fruit weight and to achieve marker-assisted selection for this trait, this invention aims to provide a major-effect SNP marker combination suitable for marker-assisted selection of apple fruit weight. This combination can be applied to the seedling stage of hybrid offspring for marker-assisted selection of apple fruit weight, thereby improving breeding efficiency and reducing breeding costs. This invention provides a set of SNP marker combinations, primer-probe sets, and their applications for marker-assisted selection of apple fruit weight. To achieve the above objectives, this invention adopts the following technical solution.

[0005] One of the objectives of this invention is to provide a set of SNP marker combinations for apple single fruit weight marker-assisted selection, the SNP marker combination consisting of 16 SNP markers; the 16 SNP markers include SNP1 to SNP16.

[0006] The SNP1 is Chr02_23876017 C / A, and its nucleotide sequence is shown in SEQ ID NO.1; the SNP1 is a mutation from C to A at position 23876017 bp on the second chromosome of apple.

[0007] The SNP2 is Chr11_281738 C / T, and its nucleotide sequence is shown in SEQ ID NO.5. The SNP2 is a C to T mutation at position 281738 bp on the eleventh chromosome of apple.

[0008] The SNP3 is Chr12_17104265 T / G, and its nucleotide sequence is shown in SEQ ID NO.6. The SNP3 is a mutation from T to G at position 17104265 bp on apple chromosome 12.

[0009] The SNP4 is Chr12_23710003 T / G, and its nucleotide sequence is shown in SEQ ID NO.7. The SNP4 is a mutation from T to G at position 23710003 bp on apple chromosome 12.

[0010] The SNP5 is Chr14_20448307 A / G, and its nucleotide sequence is shown in SEQ ID NO.9. The SNP5 is a mutation from A to G at position 20448307 bp on chromosome 14 of apple.

[0011] The SNP6 is Chr15_10278900 T / G, and its nucleotide sequence is shown in SEQ ID NO.10. The SNP6 is a mutation from T to G at position 10278900 bp on chromosome 15 of apple.

[0012] The SNP7 is Chr15_22313813 A / T, and its nucleotide sequence is shown in SEQ ID NO.12. The SNP7 is an A to T mutation at position 22313813bp on chromosome 15 of apple.

[0013] The SNP8 is Chr15_26425887 G / A, and its nucleotide sequence is shown in SEQ ID NO.13. The SNP8 is a mutation from G to A at position 26425887 bp on chromosome 15 of apple.

[0014] The SNP9 is Chr15_38111629 G / T, and its nucleotide sequence is shown in SEQ ID NO.14. The SNP9 is a G to T mutation at position 38111629 bp on chromosome 15 of apple.

[0015] The SNP10 is Chr03_23985991 A / G, and its nucleotide sequence is shown in SEQ ID NO.2. The SNP10 is a mutation from A to G at position 23985991 bp on the third chromosome of apple.

[0016] The SNP11 is Chr09_7495024 A / G, and its nucleotide sequence is shown in SEQ ID NO.3. The SNP11 is a mutation from A to G at position 7495024 bp on the ninth chromosome of apple.

[0017] The SNP12 is Chr10_39740659 G / T / A:, and its nucleotide sequence is shown in SEQ ID NO.4. The SNP12 is a mutation from G to T / A at position 39740659 bp on the tenth chromosome of apple.

[0018] The SNP13 is Chr13_13933420 C / G, and its nucleotide sequence is shown in SEQ ID NO.8. The SNP13 is a mutation from C to G at position 13933420 bp on the thirteenth chromosome of apple.

[0019] The SNP14 is Chr15_14065871 G / A, and its nucleotide sequence is shown in SEQ ID NO.11. The SNP14 is a mutation from G to A at position 14065871 bp on chromosome 15 of apple.

[0020] The SNP15 is Chr16_6334724 C / T, and its nucleotide sequence is shown in SEQ ID NO.15. The SNP15 is a C to T mutation at position 6334724 bp on chromosome 16 of apple.

[0021] The SNP16 is Chr17_1867893 T / G, and its nucleotide sequence is shown in SEQ ID NO.16. The SNP16 is a mutation from T to G at position 1867893 bp on chromosome 17 of apple.

[0022] This invention provides a set of SNP marker combinations for marker-assisted selection of apple single fruit weight. The SNP marker combinations include 16 major-effect SNP markers related to apple single fruit weight, suitable for molecular-assisted evaluation, screening, and breeding program design of Malus germplasm resources. The SNP marker combinations provided by this invention can accurately predict apple single fruit weight, enabling marker-assisted selection of the apple single fruit weight trait, and addressing the current technical deficiency of lacking relatively accurate molecular markers for predicting apple single fruit weight in existing technologies.

[0023] A second objective of this invention is to provide a probe set for detecting SNP marker combinations for single-fruit remarker-assisted selection in apples, including GenoBaits DNA probes for detecting SNP1 to SNP16.

[0024] The nucleotide sequences of the GenoBaits DNA probes used to detect SNP1 to SNP16 are shown in SEQ ID NO.17 to SEQ ID NO.32, respectively.

[0025] The third objective of this invention is to use this set of major SNP marker combinations related to single fruit weight traits in apples to identify apple germplasm resources, discover high-quality disease-resistant loci while eliminating undesirable allelic variation loci, and create new disease-resistant and superior varieties.

[0026] The fourth objective of this invention is to use this set of apple single-fruit heavy molecular marker combinations in the molecular design of breeding programs, such as parent selection and combination matching, to further improve breeding efficiency.

[0027] The fifth objective of this invention is to provide the application of the SNP marker combination or the probe set in the preparation of a kit for determining the weight trait of a single apple fruit.

[0028] Preferably, the kit includes the SNP marker combination or the probe set.

[0029] The sixth objective of this invention is to provide the application of the SNP marker combination, the probe set, or the kit in determining the single fruit weight trait of apples.

[0030] Preferably, the method includes the following steps:

[0031] Genomic DNA was extracted from the apple species to be tested.

[0032] The probe set was used to perform typing detection on the apple species to be tested.

[0033] Based on the results of the typing test, the single fruit weight trait of the tested Malo species is determined.

[0034] Preferably, the single fruit weight trait includes small fruit type, medium-small fruit type, large fruit type, medium fruit type, and large-medium fruit type.

[0035] The small fruit type is designated as S, with an average single fruit weight of 9.4 g to 9.6 g; the medium-small fruit type is designated as MS, with an average single fruit weight of 68.4 g to 68.6 g; the large fruit type is designated as L, with an average single fruit weight of 163.9 g to 164.1 g; the medium fruit type is designated as M, with an average single fruit weight of 80.64 g to 82.64 g; and the large-medium fruit type is designated as LM, with an average single fruit weight of 131 g to 133 g.

[0036] Preferably, when the genotype at SNP1 is AA, the genotype at SNP10 is TT, the genotype at SNP3 is GG, the genotype at SNP4 is GG, the genotype at SNP5 is GG, the genotype at SNP6 is GG, the genotype at SNP7 is TT, the genotype at SNP8 is AA, or the genotype at SNP9 is TT, the single fruit weight trait of the tested Malus species is determined to be small fruit type.

[0037] When the genotype at SNP1 is CA, the genotype at SNP10 is CT, the genotype at SNP3 is TG, the genotype at SNP4 is TG, the genotype at SNP5 is AG, the genotype at SNP6 is TG, the genotype at SNP7 is AT, the genotype at SNP8 is GA, or the genotype at SNP9 is GT, the single fruit weight trait of the tested Malus species is determined to be of small to medium fruit size.

[0038] When the following conditions are met simultaneously: the genotype at SNP1 is CC, the genotype at SNP10 is CC, the genotype at SNP3 is TT, the genotype at SNP4 is TT, the genotype at SNP5 is AA, the genotype at SNP6 is TT, the genotype at SNP7 is AA, the genotype at SNP8 is GG, and the genotype at SNP9 is GG, and the genotype at SNP10 is GG, the genotype at SNP11 is AG, the genotype at SNP14 is AA, or the genotype at SNP16 is TG, then the single fruit weight trait of the tested *Malus* plant is determined to be of the large fruit type.

[0039] When the following conditions are met simultaneously: the genotype at SNP1 is CC, the genotype at SNP10 is CC, the genotype at SNP3 is TT, the genotype at SNP4 is TT, the genotype at SNP5 is AA, the genotype at SNP6 is TT, the genotype at SNP7 is AA, the genotype at SNP8 is GG, and the genotype at SNP9 is GG, and if any one of the following is true: SNP12 contains a T allele, SNP13 contains a G allele, or SNP15 contains a T allele, then the single fruit weight trait of the tested *Malus* plant is determined to be of medium fruit type.

[0040] If the tested apple species does not meet any of the above conditions, its single fruit weight trait is determined to be large to medium fruit type.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] 1. This invention provides a set of SNP marker combinations for marker-assisted selection of apple single fruit weight. The SNP marker combinations include 16 major-effect SNP markers linked to the apple single fruit weight trait, suitable for molecular-assisted evaluation, screening, and breeding program design of Malus germplasm resources. The SNP marker combinations provided by this invention consist of 16 SNP markers; these 16 SNP markers include SNP1 to SNP16; the nucleotide sequences of SNP1 to SNP16 are shown in SEQ ID NO.1 to SEQ ID NO.16, respectively. The SNP marker combinations can accurately predict apple single fruit weight, thereby achieving marker-assisted selection of the apple single fruit weight trait and overcoming the current technical deficiency of lacking relatively accurate molecular markers for predicting apple single fruit weight in the prior art.

[0043] 2. The SNP marker combination provided by this invention has the function of predicting the weight of a single fruit, specifically as follows:

[0044] When the genotype at SNP1 is AA, or the genotype at SNP2 is TT, or the genotype at SNP3 is GG, or the genotype at SNP4 is AA, or the genotype at SNP5 is GG, or the genotype at SNP6 is GG, or the genotype at SNP7 is TT, or the genotype at SNP8 is AA, or the genotype at SNP9 is TT, then the single fruit weight trait of the tested *Malus* species is small fruit, i.e., S. When the genotype at SNP1 is CA, or the genotype at SNP2 is CT, or the genotype at SNP3 is TG, or the genotype at SNP4 is TG, or the genotype at SNP5 is AG, or the genotype at SNP6 is TG, or the genotype at SNP7 is AT, or the genotype at SNP8 is GA, or the genotype at SNP9 is GT, then the single fruit weight trait of the tested *Malus* species is small to medium fruit, i.e., MS. If, under the premise that the genotypes at SNP1 are CC, SNP2 are CC, SNP3 are TT, SNP4 are TT, SNP5 are AA, SNP6 are TT, SNP7 are AA, SNP8 are GG, and SNP9 are GG, then if the genotypes at SNP10 are GG, SNP11 are AG, SNP14 are AA, or SNP16 are TG, then the single fruit weight trait of the tested Malus species will be large, i.e., L. If, simultaneously, the genotypes at SNP1 and SNP2 are CC, SNP3 and SNP4 are TT, SNP5 is AA, SNP6 is TT, SNP7 is AA, SNP8 is GG, and SNP9 is GG, then if SNP12 contains a T allele, or SNP13 contains a G allele, or SNP15 contains a T allele, then the single fruit weight trait of the tested *Malus* species is medium-sized, i.e., M. If the tested *Malus* species does not meet any of the above conditions, then the single fruit weight trait of the tested *Malus* species is large-medium-sized, i.e., LM.

[0045] As can be seen from the above, the SNP marker combination provided by the present invention can predict the weight of a single apple relatively accurately.

[0046] 3. This invention focuses on the major variation sites controlling the single fruit weight of apple plants and has developed 16 major SNP markers linked to the single fruit weight trait of apple. These 16 major SNP markers include SNP1 to SNP16 and form the SNP marker combination, which is suitable for marker-assisted selection of the single fruit weight trait of apple during the seedling stage of breeding materials.

[0047] 4. This invention developed 16 major-effect SNP markers linked to the single-fruit weight trait of apples, which are low-cost, simple to operate, and highly accurate. Simultaneously, this invention classified 1808 apple genus materials into five grades: small-fruited, small-medium-fruited, medium-fruited, medium-large-medium-large, and large-fruited. The Pearson correlation coefficient between the predicted and measured phenotypic values ​​of single-fruit weight was r=0.8423 (n=1808). Attached Figure Description

[0048] Figure 1 This is the auxiliary selection result of 16 major-effect SNP markers linked to the single fruit weight trait of apple in this invention. Detailed Implementation

[0049] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0050] The experimental materials used in the embodiments of the present invention are as follows:

[0051] The apple materials used in the embodiments of this invention include 'Zise Mingzhu', 'Red Fuji', 'Golden Delicious', 'Red Jade', and 'Tsugaru', as well as the hybrid population constructed using the above-mentioned parent materials, which originated from the apple breeding base in Beidaihe New District, Qinhuangdao City, Hebei Province.

[0052] The 361 germplasm resources used in the examples were sourced from the apple breeding base in Beidaihe New District, Qinhuangdao City, Hebei Province.

[0053] Example 1

[0054] 1. Phenotypic identification of single apple fruit weight

[0055] Using 4,792 hybrid offspring lines from four hybrid populations ('Zise Mingzhu' × 'Hongfushi', 'Zise Mingzhu' × 'Jinguan', 'Hongyu' × 'Jinguan', and 'Hongyu' × 'Tsugaru') and 361 germplasm resources, a phenotypic survey of single apple fruit weight was conducted for 10 consecutive years.

[0056] The specific method involves collecting mature fruits, with a sample size of more than 5 fruits per plant, and using a precision electronic balance (0.01g) to determine the mass.

[0057] 2. Discovery of variation sites for single-fruit weight traits in apples

[0058] BSA-seq and QTL mapping techniques were used on the hybrid offspring population, and the QTL peak maps located by BSA were integrated and compared for phenotypic associations. Segments exceeding the threshold in the peak maps represent regions with significant genotypic differences on the chromosomes. Different parental combinations and traits have different thresholds.

[0059] Based on the modified G' value method, genes with the largest G' values ​​that are expressed and associated with the target trait are preferentially selected as candidate genes. Molecular markers are developed based on the variant sites of these candidate genes. The effect values ​​of the molecular markers are measured across the entire training population. Based on the contribution of the molecular markers, QTLs associated with the single fruit weight trait in apples are identified.

[0060] A total of 90 QTL loci related to single fruit weight were obtained from the above four populations, distributed on chromosomes other than apple chromosome 3, apple chromosome 4 and apple chromosome 8.

[0061] Genome-wide association analysis (GWAS) was performed on 253 Malus germplasm resources. GWAS analysis was conducted using EMMAX software with a linear mixture model. The 99.0% quantile of all sliding window association values ​​was used as the significance threshold for screening, i.e., -log10(P_value) = 0.788. Loci above the threshold were considered significant SNPs highly associated with the target trait, and 37 significant association intervals related to single fruit weight in apples were identified.

[0062] BSA-seq stands for bulked segregant analysis sequencing, which is a method for analyzing groups of segregants.

[0063] QTL stands for Quantitative trait loci mapping.

[0064] Genome-wide association study (GWAS) is an abbreviation for genome-wide association study.

[0065] 3. Development of molecular markers for single-fruit heavy traits in apples

[0066] Based on the mutation type, gene expression level, and functional annotation, candidate genes were selected from each QTL and GWAS interval related to apple single fruit weight. GenoBaits primers were designed based on the existing mutations, and molecular markers were developed. A total of 147 SNP and InDel molecular markers were designed, distributed on the 17 apple chromosomes. The markers adopted the GenoBaits strategy. The characteristic of the GenoBaits primer design method is that 200 bp of sequence before and after the mutation site is extracted, the mutation site is retained, and it is highlighted with square brackets "[ ]". The non-mutated bases (before) and the mutated bases (after) are marked in "[ ]" and separated by " / ".

[0067] The GenoBaits primers were synthesized by Shijiazhuang Borui Biotechnology Co., Ltd. in Hebei Province. The target sequence was captured using DNA probes, and then labeled for genotyping using Illumina next-generation resequencing.

[0068] 4. Estimation of genotype effect values ​​of molecular markers for single-fruit major traits in apples and screening of major markers.

[0069] From the four hybrid combinations and apple germplasm resources mentioned above, 2264 individual plants were selected as the training population. The GenoBaits strategy was used to genotype the 147 SNPs and InDel molecular markers. The genotype effect and marker effect of each marker on the single fruit weight trait in the training population were estimated. The formula for calculating the genotype effect of a specific molecular marker was: the difference between the average single fruit weight phenotype of individuals with the same genotype and the average single fruit weight phenotype of the entire population. Sixteen major SNP markers linked to the single fruit weight trait in apples were screened, including nine SNP markers significantly associated with the small apple phenotype and seven SNP markers significantly associated with the large apple phenotype, which were determined as major markers.

[0070] The GenoBaits strategy is the same as step 3.

[0071] Nine SNP markers significantly associated with the apple minima phenotype were identified as Chr02_23876017 C / A, Chr11_281738 C / T, Chr12_17104265 T / G, Chr12_23710003 T / G, Chr14_20448307 A / G, Chr15_10278900 T / G, Chr15_22313813 A / T, Chr15_26425887 G / A, and Chr15_38111629 G / T / A.

[0072] Chr02_23876017 C / A is SNP1; Chr11_281738 C / T is SNP2; Chr12_17104265 T / G is SNP3; Chr12_23710003 T / G is SNP4; Chr14_20448307 A / G is SNP5; Chr15_10278900 T / G is SNP6; Chr15_22313813 A / T is SNP7; Chr15_26425887 G / A is SNP8; Chr15_38111629 G / T is SNP9.

[0073] Among them, the seven SNP markers that were significantly associated with the large apple phenotype were Chr03_23985991 A / G, Chr09_7495024 A / G, Chr10_39740659 G / T / A, Chr13_13933420 C / G, Chr15_14065871 G / A, Chr16_6334724 C / T, and Chr17_1867893 T / G.

[0074] Chr03_23985991 A / G is SNP10; Chr09_7495024 A / G is SNP11; Chr10_39740659 G / A is SNP12; Chr13_13933420 C / G is SNP13; Chr15_14065871 G / A is SNP14; Chr16_6334724 C / T is SNP15; Chr17_1867893 T / G is SNP16.

[0075] The above SNP1~SNP16 are the 16 major SNP markers linked to the single fruit weight trait of apples, which were screened out. They are simply referred to as the 16 major SNP markers. Their flanking nucleotide sequence information is as follows. In the brackets “[ ]”, the non-variant bases (front) and the variable bases (back) are marked, and the two are separated by “ / ”.

[0076] The nucleotide sequence of Chr02_23876017 C / A is shown in SEQ ID NO.1:

[0077] TGTTGATTTACCATCAAATAAATATTACTCGAACTCAAA[C / A]TTCTACACCTTATAATGCAAAACATGTACAAGGAAAATGATTTTTGCATG; where there is a C to A mutation at position 40bp, which is the C to A mutation at position 23876017bp on the second chromosome of apple.

[0078] The nucleotide sequence of Chr03_23985991 A / G is shown in SEQ ID NO.2:

[0079] ACCTCCACAGGTTCCAAGCAGTCACTCATGGAAGCCGCGACGGCTATTTCTGATGGGAAATTCGAGGCCGCGGTGGAGATCCTCACCCGGATGACTCCGACCCGGGTCACGAATCCTAGACCCAGTTCAGAAGAAAGGCTTTTGGAGTTCATGGGTTTAGCTTTGAAGTCTCGGGTCAACCCGATTGATAACCCGCCACC[A / G]ATAGCGAGAGACTTCTGCAATTCATAAAGTTTCAATTTTTATCGAAGAAGAGAGAGAGGGCGTCTGAGTCATAGACAGTTCTCCTTCTAAGATCTCGAAGCGAATCCGCCTATCAAGCTCTCAGTCGCCATCGCTGGAAAATCCATTGAAATCTGCAACTTTTAAGTGAGTCTCAAATTTCCCAATTCGGAAATTGCTAC; Among them, there is a mutation from A to G at position 201bp, which is a mutation from A to G at position 23985991bp of the third chromosome of apple.

[0080] The nucleotide sequence of Chr09_7495024 A / G is shown in SEQ ID NO.3:

[0081] AACTGAAAAGAAAACATTTTTTGGTATCGATTGGTATTTTTTTTTTTTGTGTTGGGAGATTTTAATATACCGGAAAAGTTGTCGAGTTTCATGTGAATTTGCTCTCCCTCGTAGGTGAAATGATCGAAAGCCCAGGTTGGCTGGAAAAGCTCATCAAATTTTGCTGAGCTGACCAAACCCAGCAATGCAAGACTCAC[A / G]AAAGCACTTAGAGAAAAAGCCATTATTCCAAAAGCTGAACCAGCCATGGAAGCAGAAGAAGAGAGTTGAGTTGAGCAGAAGAAGGGAGTGGAGCAGAAGAAGAAGAGTGCAGAGAAAGTGTGGATCTTCTTCACTGAACTGCTCTGAGTCTGTGGAAGCACAAACCGAAAACACTGGCTTTTATAGCCCAATTTTCATTAGGC; Among them, there is a mutation from A to G at position 198bp, which is a mutation from A to G at position 7495024bp of apple chromosome 9.

[0082] The nucleotide sequence of Chr10_39740659 G / A is shown in SEQ ID NO.4:

[0083] TCTTCCTTCCAAAGTGAGCTCTGGTCATCTTGATTTTATTCCGGAAGATGGTGCTATCAAGGTTGGCCCGCATCAAGGCGATTTATTTCAGGCTTATACTCTGATGAAAGTGAACAATGAGGCTGATGGAGACCAAGTTTAAAGTTGATACTAATTTTTTTCCGCTCTTACACAAAATGATCCGAGAGAAGACAG[G / T / A]TTGGGGTTTTGAGTGTCAAGGTCACAG GTTGTGCTACTTTTCAGGTTGGTGTGCTGGAGTGGACAGAGACTACTTTACGAACTTATGAGAATGTGCTGCGTCAAGCAGATATTTATGGTGCTGTGGCAATGTCCCGTTATCCTTACAAATACTCATCTAATGTATGGAAAGCTTTTTGTGAGCTATGGGGGCCTTTAACCAACA; Among them, there is a G to A mutation at position 198bp, which is a G to T / A mutation at position 39740659bp on the apple chromosome 10.

[0084] The nucleotide sequence of Chr11_281738 C / T is shown in SEQ ID NO.5:

[0085] AAAGGCACAGAGGTAGCTGTTGTTTTATGGCCACTCTTCTAACTTTTTAATTTTTTTAATTTTTATTTTCAATATATTGTTTTTATTTTGATCTTTTGCCTGTTTTCTCTCTCCAAAGGAGCTTCCTTTTTCACCTCACACAGTTCACACAAAGATATCTGTGAGTCAGTAGGGTTTTTTTAATCTTTACTCTTTCTCCC[C / T]CATCCCTCTCTGTGAACCTACAATCTTGACTCGTGAGAGACAAACCCAACACAACACAAAACAAACAAACATAAAGCCAAAATCTTTTTCAACCTAAAACAAACCCTAATTCCCAAATCATAGTCGTCTTCTTCTTCCTTTCTTCCTTTCTGCTATTGTTGACTCAAAAACCTTGGCCTTTCACTCTTGTTCAATTTCTGCCAC; Among them, there is a C to T mutation at position 201bp, which is a C to T mutation at position 281738bp of apple chromosome 11.

[0086] The nucleotide sequence of Chr12_17104265 T / G is shown in SEQ ID NO.6:

[0087] TGGAAGGGGGAAAACACTAATGAAAATGAATACTATTTCAACTAAACCTA[T / G]ACCCTACCAAGCAAACCAAGTGCATACTAACAAGAGGAATGCTAGCTACT; where there is a T to G mutation at position 51bp, which is the T to G mutation at position 17104265bp on apple chromosome 12.

[0088] The nucleotide sequence of Chr12_23710003 T / G is shown in SEQ ID NO.7:

[0089] GGTTGGTTGCATTGTGAACTTTGAGAGAAGATGTATACTTTTGAGCATTG[T / G]AGGAAGTTCCTATAAGTTTATTAGTGTGATTAGTGTTAAACTTGAAGTTC; where there is a T to G mutation at position 51bp, which is the T to G mutation at position 23710003bp on the apple chromosome 12.

[0090] The nucleotide sequence of Chr13_13933420 C / G is shown in SEQ ID NO.8:

[0091] CACGTTTGCAATCTAGTTCATCAAAGGGTACAAGTTTTGCCTTAAAACTT[C / G]TTCCATTCTAAATGTGGACTCAGATTGAAACTGATG; Among them, there is a C to G mutation at position 51bp, which is a C to G mutation at position 13933420bp on the 13th chromosome of apple.

[0092] The nucleotide sequence of Chr14_20448307 A / G is shown in SEQ ID NO.9:

[0093] GGTGGAATTGGTGGAGCTCTGCATACAAGCCGCCTCTGAAAGCAGAGACA[A / G]CGTCGAGAAATGGCGGAGGCAGCGACGGAGTCTCGAGCGCTTGCCTCCTC; Among them, there is a mutation from A to G at position 51bp, which is a mutation from A to G at position 20448307bp on the fourteenth chromosome of apple.

[0094] The nucleotide sequence of Chr15_10278900 T / G is shown in SEQ ID NO.10:

[0095] ACCAGTTTTATTTATTCTTTTTATTTGTCGAATTGTACTAGAATCTGCGGTATCCACATTTATAAACCGCCTTTTCCCTGTGCTGTATTGTTATCTTGTATAATCGAAACCCCTTCAGTCTCCACACACAAAAATACTGTAGTCTCGATTTATCCAGTTGGTGCATGATGGCTAGTCCTCCTCCAAACCCAGTGC[T / G]GATTGCATACCAGGGAGGGGCGGGGGC The sequence is: AGTGCCAGACTGGTTGAACAAGGGGGACAACGCATGGCAAATGATATCTGCCACCCTCGTTGGTCTGCAGAGTGTGCCGGGTCTCGTCATCCTCTACGGCAGTATCGTTAAAAAGAAATGGGCGGTTAACTCAGCCTTCATGGCTCTCTACGCTTTTGCCGCTGTGGTCCTCTGCT; The mutation from T to G is present at position 198bp, which corresponds to the mutation from T to G at position 10278900bp on apple chromosome 15.

[0096] The nucleotide sequence of Chr15_14065871 G / A is shown in SEQ ID NO.11:

[0097] TGGTGATTGGGTCCCTGAACTTGACACGCTCATCGTACGCCGTCCTATCAATTCCCCGATCATCAAAAAGATGAACCAGATCCTCATACAAAAACCCTACCAGCTGTTCCACGTCAAACGTTGATTTTGGCGGGCTTTGGTCCACTAAGCTTAGCCTAACAGCCCACCTGGATTTTTGGGTTAAGTGTTTGTGTTTC[G / A]AAGATTTAGGGCGTGGGCAAGGCGGTA The mutation G to A exists at position 198bp, which corresponds to the G to A mutation at position 14065871bp on chromosome 15 of the apple.

[0098] The nucleotide sequence of Chr15_22313813 A / T is shown in SEQ ID NO.12:

[0099] GATGTTGTTACCATCAATGTTGGTAAGGGATCGATTTTGATGGATTCCAT[A / T]CTCTGTAGCAACCAACTTAAGTAGTCATTGTATTGCTGAATAAATACTAC; where the mutation from A to T exists at position 51bp, which is the mutation from A to T at position 22313813bp on the 15th chromosome of apple.

[0100] The nucleotide sequence of Chr15_26425887 G / A is shown in SEQ ID NO.13:

[0101] TTGCGTGCATTAAAACCAAAGCCTTCCCTGTCCGAAATCGCACAAAGCCC[G / A]TCTGCGCCTTTCTCTCTCCTCTGTTTGAAAGTGGACAAAGAAATGCTGAG; where there is a G to A mutation at position 51bp, which is the G to A mutation at position 26425887bp on chromosome 15 of apple.

[0102] The nucleotide sequence of Chr15_38111629 G / T is shown in SEQ ID NO.14:

[0103] CAGCCTCTACCGTAAAACTACATAAAAATAAATGAATGAATTCAACACAA[G / T]CCTAACTCAATATGCAGGTACCATATAAATCAGGGGTTAGTAACAGTAAA; Among them, there is a G to T mutation at position 51bp, which is a G to T mutation at position 38111629bp on the 15th chromosome of apple.

[0104] The nucleotide sequence of Chr16_6334724 C / T is shown in SEQ ID NO.15:

[0105] CATTGCGCCACTTTGTTGGCTAGACAACTTAACAAACTCCGGCCCCTCGA[C / T]GGSGTCCACGCTCGAGGGATTGCTCCGAGCACACGACGTCACTGTTCCGG; where a C to T mutation exists at position 51bp, which is a C to T mutation at position 6334724bp on the sixteenth chromosome of apple.

[0106] The nucleotide sequence of Chr17_1867893 T / G is shown in SEQ ID NO.16:

[0107] GGGAGTTGGAGATAAGAGCGTGCACAAATTTGAAGGTCCCAAGTGGGTTGAGGCACTTGAAGAATCTCACTCAGCTGAAATTAACTAATATGCCGGAAGAATTTGTTGCAACCATTGCGACAACTAAGGTGCAAATTTGGGATGACATAACTCACTCGCCAACAGTCATTACCGATAGCTGGTAGTCTATGCGGAAT[T / G]AGTCACAGGCTTCTCCTCCAGTAATC The mutation GGGTATGTTTTGGTTTTTTTGTACTGTGTTTATGTGTACAAGTACTGCGTAATGATGCTTGTTTTCTACATGGAAATCATGTTCTAGATCGAGTGACGCTCTTACTGGTTTATTGCTTTCAGGTAACATCGCCCAATGCATTTGACGCATAGGGAACCTGACAGCCTAGTCCATGTT; Specifically, a T-to-G mutation exists at position 198bp, which corresponds to a T-to-G mutation at position 1867893bp on apple chromosome 17.

[0108] The GenoBaits DNA probe sequence information corresponding to the 16 major SNP markers linked to the single fruit weight trait in apple is as follows:

[0109] The GenoBaits DNA probe used to detect SNP1 is Chr02_23876017, and its nucleotide sequence is shown in SEQ ID NO. 17.

[0110] TGTTGATTTACCATCAAATAAATATTACTCGAACTCAAACTTCTACACCTTATAATGCAAAACATGTACAAGGAAAATGATTTTTGCATG.

[0111] The GenoBaits DNA probe used to detect SNP2 is Chr11_281738, and its nucleotide sequence is shown in SEQ ID NO. 18:

[0112] AAAGGCACAGAGGTAGCTGTTGTTTTATGGCCACTCTTCTAACTTTTTAATTTTTTTAATTTTTATTTTCAATATATTGTTTTTATTTTGATCTTTTGCCTGTTTTCTCTCCAAAGGAGCTTCCTTTTTCACCTCACACAGTTCACACAAAGATATCTGTGAGTCAGTAGGGTTTTTTTAATCTTTACTCTTTCTCCCC CATCCCTCTCTGTGAACCTACAATCTTGACTCGTGAGAGACAAACCCAACACAACACAAAACAAACAAACATAAAGCCAAAATCTTTTTCAACCTAAAACAAACCCTAATTCCCAAATCATAGTCGTCTTCTTCTTCCTTTCTTCCTGCTATTGTTGACTCAAAAACCTTGGCCTTTCACTCTTGTTCAATTTCTGCCAC.

[0113] The GenoBaits DNA probe used to detect SNP3 is Chr12_17104265, and its nucleotide sequence is shown in SEQ ID NO. 19:

[0114] TGGAAGGGGGAAAACACTAATGAAAATGAATACTATTTCAACTAAACCTATACCCTACCAAGCAAACCAAGTGCATACTAACAAGAGGAATGCTAGCTACT.

[0115] The GenoBaits DNA probe used to detect SNP4 is Chr12_23710003, and its nucleotide sequence is shown in SEQ ID NO. 20:

[0116] GGTTGGTTGCATTGTGAACTTTGAGAGAAGATGTATACTTTTGAGCATTGTAGGAAGTTCCTATAAGTTTATTAGTGTGATTAGTGTTAAACTTGAAGTTC.

[0117] The GenoBaits DNA probe used to detect SNP5 is Chr14_20448307, and its nucleotide sequence is shown in SEQ ID NO. 21:

[0118] GGTGGAATTGGTGGAGCTCTGCATACAAGCCGCCTCTGAAAGCAGAGACAACGTCGAGAAATGGCGGAGGCAGCGACGGAGTCTCGAGCGCTTGCCTCCTC.

[0119] The GenoBaits DNA probe used to detect SNP6 is Chr15_10278900, and its nucleotide sequence is shown in SEQ ID NO. 22:

[0120] ACCAGTTTTATTTATTCTTTTTATTTGTCGAATTGTACTAGAATCTGCGGTATCCACATTTATAAACCGCCTTTTCCCTGTGCTGTATTGTTATCTTGTATAATCGAAACCCCTTCAGTCTCCACACACAAAAATACTGTAGTCTCGATTTATCCAGTTGGTGCATGATGGCTAGTCCTCCTCCAAACCCAGTGCTGAT TGCATACCAGGGAGGGGCGGGGGCAGTGCCAGACTGGTTGAACAAGGGGGACAACGCATGGCAAATGATATCTGCCACCCTCGTTGGTCTGCAGAGTGTGCCGGGTCTCGTCATCCTCTACGGCAGTATCGTTAAAAAGAAATGGGCGGTTAACTCAGCCTTCATGGCTCTCTACGCTTTTGCCGCTGTGGTCCTCTGCT.

[0121] The GenoBaits DNA probe used to detect SNP7 is Chr15_22313813, and its nucleotide sequence is shown in SEQ ID NO. 23:

[0122] GATGTTGTTACCATCAATGTTGGTAAGGGATCGATTTTGATGGATTCCATACTCTGTAGCAACCAACTTAAGTAGTCATTGTATTGCTGAATAAATACTAC.

[0123] The GenoBaits DNA probe used to detect SNP8 is Chr15_26425887, and its nucleotide sequence is shown in SEQ ID NO. 24:

[0124] TTGCGTGCATTAAAACCAAAGCCTTCCCTGTCCGAAATCGCACAAAGCCCGTCTGCGCCTTTCTCTCTCCTCTGTTTGAAAGTGGACAAAGAAATGCTGAG.

[0125] The GenoBaits DNA probe used to detect SNP9 is Chr15_38111629, and its nucleotide sequence is shown in SEQ ID NO.25:

[0126] CAGCCTCTACCGTAAAACTACATAAAAATAAATGAATGAATTCAACACAAGCCTAACTCAATATGCAGGTACCATATAAATCAGGGGTTAGTAACAGTAAA.

[0127] The GenoBaits DNA probe used to detect SNP10 is Chr03_23985991, and its nucleotide sequence is shown in SEQ ID NO.26:

[0128] ACCTCCACAGGTTCCAAGCAGTCACTCATGGAAGCCGCGACGGCTATTTCTGATGGGAAATTCGAGGCCGCGGTGGAGATCCTCACCCGGATGACTCCGACCCGGGTCACGAATCCTAGACCCAGTTCAGAAGAAAGGCTTTTGGAGTTCATGGGTTTAGCTTTGAAGTCTCGGGTCAACCCGATTGATAACCCGCCACCA ATAGCGAGAGACTTCTGCAATTCATAAAGTTTCAATTTTTATCGAAGAAGAGAGAGAGGGCGTCTGAGTCATAGACAGTTCTCCTTCTAAGATCTCGAAGCGAATCCGCCTATCAAGCTCTCAGTCGCCATCGCTGGAAAATCCATTGAAATCTGCAACTTTTAAGTGAGTCTCAAATTTCCCAATTCGGAAATTGCTAC.

[0129] The GenoBaits DNA probe used to detect SNP11 is Chr09_7495024, and its nucleotide sequence is shown in SEQ ID NO.27:

[0130] AACTGAAAAGAAAACATTTTTTGGTATCGATTGGTATTTTTTTTTTTTGTGTTGGGAGATTTTAATATACCGGAAAAGTTGTCGAGTTTCATGTGAATTTGCTCTCCCTCGTAGGTGAAATGATCGAAAGCCCAGGTTGGCTGGAAAAGCTCATCAAATTTTGCTGAGCTGACCAAACCCAGCAATGCAAGACTCACAAAAGCACTTAGAGAAAAAGCCATTATTCCAAAAGCTGAACCAGCCATGGAAGCAGAAGAAGAGAGTTGAGTTGAGCAGAAGAAGGGAGTGGAGCAGAAGAAGAAGAGTGCAGAGAAAGTGTGGATCTTCTTCACTGAACTGCTCTGAGTCTGTGGAAGCACAAACCGAAAACACTGGCTTTTATAGCCCAATTTTCATTAGGC。

[0131] The GenoBaits DNA probe for detecting SNP12 is Chr10_39740659, and its nucleotide sequence is shown in SEQ ID NO.28:

[0132] TCTTCCTTCCAAAGTGAGCTCTGGTCATCTTGATTTTATTCCGGAAGATGGTGCTATCAAGGTTGGCCCGCATCAAGGCGATTTATTTCAGGCTTATACTCTGATGAAAGTGAACAATGAGGCTGATGGAGACACCAAGTTTAAAGTTGATACTAATTTTTTTCCGCTCTTACACAAAATGATCCGAGAGAAGACAGGTTGGGGTTTGAGTGTCAAGGTCACAGGTTGTGCTACTTTTCAGGTTGGTGTGCTGGAGTGGACAGAGACTACTTTACGAACTTATGAGAATGTGCTGCGTCAAGCAGATATTTATGGTGCTGTGGCAATGTCCCGTTATCCTTACAAATACTCATCTAATGTATGGAAAGCTTTTTGTGAGCTATGGGGGCCTTTAACCAACA。

[0133] The GenoBaits DNA probe used to detect SNP13 is Chr13_13933420, and its nucleotide sequence is shown in SEQ ID NO. 29:

[0134] CACGTTTGCAATCTAGTTCATCAAAGGGTACAAGTTTTGCCTTAAAACTTCTTCCATTCTAAATGTGGACTCAGATTGAAACTGATG.

[0135] The GenoBaits DNA probe used to detect SNP14 is Chr15_14065871, and its nucleotide sequence is shown in SEQ ID NO.30:

[0136] TGGTGATTGGGTCCCTGAACTTGACACGCTCATCGTACGCCGTCCTATCAATTCCCCGATCATCAAAAAGATGAACCAGATCCTCATACAAAAACCCTACCAGCTGTTCCACGTCAAACGTTGATTTTGGCGGGCTTTGGTCCACTAAGCTTAGCCTAACAGCCCACCTGGATTTTTGGGTTAAGTGTTTGTGTTTCGAAG ATTTAGGGCGTGGGCAAGGCGGTAGTTTGGGCTTAGTGGTGCTCAGCTGCCGGAAACTGACACACGCTGCGGGGATTAATGGCCGGAAGATTTGGTCTGAAAGTTGTGTGCTGCTCATTTTGTGGCTGAGCTGCTAAGGTTGTAGTGGTTGTGTTAGTTTTGGTTTTGGCATATGAAATCTTAACTAAAAATTGATTGGT.

[0137] The GenoBaits DNA probe used to detect SNP15 is Chr16_6334724, and its nucleotide sequence is shown in SEQ ID NO.31:

[0138] CATTGCGCCACTTTGTTGGCTAGACAACTTAACAAACTCCGGCCCCTCGACGGSGTCCACGCTCGAGGGATTGCTCCGAGCACACGACGTCACTGTTCCGG.

[0139] The GenoBaits DNA probe used to detect SNP16 is Chr17_1867893, and its nucleotide sequence is shown in SEQ ID NO.32:

[0140] GGGAGTTGGAGATAAGAGCGTGCACAAATTTGAAGGTCCCAAGTGGGTTGAGGCACTTGAAGAATCTCACTCAGCTGAAATTAACTAATATGCCGGAAGAATTTGTTGCAACCATTGCGACAACTAAGGTGCAAATTTGGGATGACATAACTCACTCGCCAACAGTCATTACCGATAGCTGGTAGTCTATGCGGAATTAGT CACAGGCTTCTCTCCAATCGGGTATGTTTTGGTTTTTTGTACTGTGTTTATGTGTACAAGTACTGCGTAATGATGCTTGTTTTCTACATGGAAATCATGTTCTAGATCGAGTGACGCTCTTACTGGTTTTATTGCTTTCAGGTAACATCGCCCAATGCATTTGACGCATAGGGAACCTGACAGCCTAGTCCATGTT.

[0141] 5. Marker-assisted selection method for single-fruit weight traits in apples

[0142] (1) DNA extraction, library construction and target site capture sequencing

[0143] Leaves of the material to be tested were collected, and genomic DNA was extracted. The genome was precisely quantified using the Qubit® dsDNAHSAssayKit. Enzyme digestion and DNA library construction were performed using the GenoBaits® DNA Library Prep Kit for ILM. Adapters were added using the GenoBaits® Barcode for ILM Kits. Finally, molecular hybridization and target site capture were performed using the GenoBaits® DNAHybridization kit for ILM.

[0144] (2) Sequencing of target sites and marker genotyping

[0145] The captured target library was sequenced using an Illumina sequencer with the PE150 strategy at a sequencing depth of 1000×~1200×. The obtained reads were analyzed and genotyped using the GDDH13.1 reference genome.

[0146] (3) Marker-assisted prediction of single apple weight

[0147] In the training population of this embodiment, the genotypic distribution and phenotypic allelic variation of the 16 major SNP markers linked to the single fruit weight trait of apple are as follows:

[0148] SNP1, or Chr02_23876017, contains three genotypes: CC, CA, and AA. Individuals with the CA heterozygous genotype exhibit small to medium-sized fruits, while individuals with the homozygous mutant AA genotype exhibit small fruits.

[0149] SNP5, or Chr14_20448307, contains three genotypes: AA, AG, and GG. Individuals with the heterozygous AG genotype exhibit small to medium-sized fruits, while individuals with the homozygous GG mutant genotype exhibit small fruits.

[0150] SNP6, or Chr15_10278900, contains three genotypes: TT, TG, and GG. Individuals with the heterozygous TG genotype exhibit small to medium-sized fruits, while individuals with the homozygous GG mutant genotype exhibit small fruits.

[0151] SNP7, or Chr15_22313813, contains three genotypes: AA, AT, and TT. Individuals with the heterozygous AT genotype exhibit small to medium-sized fruits, while individuals with the homozygous mutant TT genotype exhibit small fruits.

[0152] SNP9, or Chr15_38111629, contains three genotypes: GG, GT, and TT. Individuals with the heterozygous GT genotype exhibit small to medium-sized fruits, while individuals with the homozygous mutant TT genotype exhibit small fruits.

[0153] SNP10, or Chr03_23985991, contains three genotypes: AA, AG, and GG. Individuals with the GG genotype exhibit large fruit size.

[0154] SNP12, or Chr10_39740659, contains six genotypes: GG, GA, AT, GT, TT, and AA. Individuals carrying the T allele exhibit a mesocarpic phenotype.

[0155] SNP13, or Chr13_13933420, contains three genotypes: CC, CG, and GG. Individuals carrying the G allele exhibit the mesocarpic type.

[0156] SNP14, or Chr15_14065871, contains three genotypes: GG, GA, and AA. Individuals with the AA genotype exhibit large fruit size.

[0157] SNP2, or Chr11_281738, contains three genotypes: CC, CT, and TT. Individuals with the heterozygous CT genotype exhibit small to medium fruit size, while individuals with the homozygous mutant TT genotype exhibit small fruit size.

[0158] SNP3, or Chr12_17104265, contains three genotypes: TT, TG, and GG. Individuals with the heterozygous TG genotype exhibit small to medium-sized fruits, while individuals with the homozygous GG mutant genotype exhibit small fruits.

[0159] SNP4, or Chr12_23710003, contains three genotypes: TT, TG, and GG. Individuals with the heterozygous TG genotype exhibit small to medium-sized fruits, while individuals with the homozygous GG mutant genotype exhibit small fruits.

[0160] SNP8, or Chr15_26425887, contains three genotypes: GG, GA, and AA. Individuals with the heterozygous GA genotype exhibit small to medium-sized fruits, while individuals with the homozygous mutant AA genotype exhibit small fruits.

[0161] SNP11, or Chr09_7495024, contains two genotypes: AA and AG. Individuals with the AG genotype exhibit large fruit size.

[0162] SNP15, or Chr16_6334724, contains genotypes such as CC and CT. Individuals with the CT genotype exhibit a mesocarpic pattern.

[0163] SNP16, or Chr17_1867893, contains three genotypes: TT, TG, and GG. Individuals with the TG genotype exhibit large fruit size.

[0164] Among them, small fruit type is denoted as S, with an average single fruit weight of 9.5 grams; medium-small fruit type is denoted as MS, with an average single fruit weight of 68.5 grams; large fruit type is denoted as L, with an average single fruit weight of 164.0 grams; medium fruit type is denoted as M, with an average single fruit weight of 81.64 grams; and large-medium fruit type is denoted as LM, with an average single fruit weight of 132 grams.

[0165] The 16 major SNP markers linked to the apple single fruit weight trait exhibit complementary epistatic effects. Based on their non-allelic interaction effects, the following criteria were used to determine and select apple single fruit weight from apple germplasm resources or hybrid progeny:

[0166] ① Germplasm resources or hybrid offspring with the following genotypes or hybridizations all exhibit small fruit type, i.e., S: Chr02_23876017 genotype AA, Chr11_281738 genotype TT, Chr12_17104265 genotype GG, Chr12_23710003 genotype GG, Chr14_20448307 genotype GG, Chr15_10278900 genotype GG, Chr15_22313813 genotype TT, Chr15_26425887 genotype AA, or Chr15_3811162 genotype TT.

[0167] ② Germplasm resources or hybrid offspring with the following genotypes or hybrids are all of the following type: CA at Chr02_23876017, CT at Chr11_281738, TG at Chr12_17104265, TG at Chr12_23710003, AG at Chr14_20448307, TG at Chr15_10278900, AT at Chr15_22313813, GA at Chr15_26425887, or GT at Chr15_3811162.

[0168] ③ When the following conditions are met simultaneously: Genotype CC at Chr02_23876017, genotype CC at Chr11_281738, genotype TT at Chr12_17104265, genotype TT at Chr12_23710003, genotype AA at Chr14_20448307, genotype TT at Chr15_10278900, and genotype AA at Chr15_22313813. Under the condition that the genotype at Chr15_26425887 is GG and the genotype at Chr15_38111629 is GG, the germplasm resources or hybrid offspring with the genotype at Chr03_23985991 being GG, or the genotype at Chr09_7495024 being AG, or the genotype at Chr15_14065871 being AA, or the genotype at Chr17_1867893 being TG will exhibit the large-fruit phenotype, i.e., L.

[0169] ④ When the following conditions are met simultaneously: Chr02_23876017 is CC, Chr11_281738 is CC, Chr12_17104265 is TT, Chr12_23710003 is TT, Chr14_20448307 is AA, Chr15_10278900 is TT, and Chr15_2231 is AA... Under the condition that the genotype at position 3813 is AA, the genotype at Chr15_26425887 is GG, and the genotype at Chr15_38111629 is GG, germplasm resources or hybrid offspring containing T allele variation at Chr10_39740659, or G allele variation at Chr13_13933420, or T allele variation at Chr16_6334724 exhibit the mesocarpic type, i.e., M.

[0170] ⑤ After excluding the large, medium, medium-small and small fruit types mentioned in ①~④ above, the remaining individuals are large to medium fruit, i.e., LM.

[0171] Among them, small fruit type is denoted as S, with an average single fruit weight of 9.5 grams; medium-small fruit type is denoted as MS, with an average single fruit weight of 68.5 grams; large fruit type is denoted as L, with an average single fruit weight of 164.0 grams; medium fruit type is denoted as M, with an average single fruit weight of 81.64 grams; and large-medium fruit type is denoted as LM, with an average single fruit weight of 132 grams.

[0172] As can be seen from the above, this invention focuses on the major variation sites that control the single fruit weight of apple plants, and has developed 16 major SNP markers linked to the single fruit weight trait of apple. These 16 major SNP markers include SNP1 to SNP16, which form the SNP marker combination, and are suitable for marker-assisted selection of the single fruit weight trait of apple during the seedling stage of breeding materials.

[0173] Example 2

[0174] To verify the feasibility of the 16 major SNP markers linked to the single fruit weight trait of apple and their primer-probe sets, the present invention conducted the following research:

[0175] Based on the genotyping data of 16 major markers from 1808 apple materials, the complementary epistatic effect among the 16 major SNP markers linked to apple single fruit weight, and the criteria for judging and selecting apple single fruit weight, were used to screen and judge apple germplasm resources or hybrid progeny:

[0176] like Figure 1As shown, the 1808 apple materials were divided into 5 grades: 55 trees with small fruit weight, 1003 trees with small to medium fruit weight, 45 trees with medium fruit weight, 639 trees with large to medium fruit weight, and 66 trees with large fruit weight.

[0177] The experimental results above show that the SNP marker combination provided by the present invention can accurately predict the weight of a single apple, thereby achieving marker-assisted selection of the single apple weight trait and solving the technical deficiency in the prior art of lacking a relatively accurate molecular marker for predicting the weight of a single apple.

[0178] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0179] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A probe set for detecting SNP marker combinations for single-fruit weight-assisted selection in apples, characterized in that, Including GenoBaits DNA probes for detecting SNP1 to SNP16; The SNP1 is Chr02_23876017 C / A, and its nucleotide sequence is shown in SEQ ID NO.1, where there is a C to A mutation at position 40bp; The SNP2 is Chr11_281738 C / T, and its nucleotide sequence is shown in SEQ ID NO.5, where there is a C to T mutation at position 201bp; The SNP3 is Chr12_17104265 T / G, and its nucleotide sequence is shown in SEQ ID NO.6, where there is a T to G mutation at position 51 bp; The SNP4 is Chr12_23710003 T / G, and its nucleotide sequence is shown in SEQ ID NO.7, where there is a T to G mutation at position 51 bp; The SNP5 is Chr14_20448307 A / G, and its nucleotide sequence is shown in SEQ ID NO.9, where there is a mutation from A to G at position 51 bp; The SNP6 is Chr15_10278900 T / G, and its nucleotide sequence is shown in SEQ ID NO.10, where there is a T to G mutation at position 198bp; The SNP7 is Chr15_22313813 A / T, and its nucleotide sequence is shown in SEQ ID NO.12, where there is a mutation from A to T at position 51 bp; The SNP8 is Chr15_26425887 G / A, and its nucleotide sequence is shown in SEQ ID NO.13, where there is a G to A mutation at position 51 bp; The SNP9 is Chr15_38111629 G / T, and its nucleotide sequence is shown in SEQ ID NO.14, where there is a G to T mutation at position 51 bp; The SNP10 is Chr03_23985991 A / G, and its nucleotide sequence is shown in SEQ ID NO.2, where there is a mutation from A to G at position 201bp; The SNP11 is Chr09_7495024 A / G, and its nucleotide sequence is shown in SEQ ID NO.3, where there is a mutation from A to G at position 198bp; The SNP12 is Chr10_39740659 G / T / A:, and its nucleotide sequence is shown in SEQ ID NO.4, where there is a G to T / A mutation at position 198bp; The SNP13 is Chr13_13933420 C / G, and its nucleotide sequence is shown in SEQ ID NO.8, where there is a C to G mutation at position 51 bp; The SNP14 is Chr15_14065871 G / A, and its nucleotide sequence is shown in SEQ ID NO.11, where there is a G to A mutation at position 198bp; The SNP15 is Chr16_6334724 C / T, and its nucleotide sequence is shown in SEQ ID NO.15, where there is a C to T mutation at position 51 bp; The SNP16 is Chr17_1867893 T / G, and its nucleotide sequence is shown in SEQ ID NO.16, where there is a T to G mutation at position 198bp; The nucleotide sequences of the GenoBaits DNA probes used to detect SNP1 to SNP16 are shown in SEQ ID NO.17 to SEQ ID NO.32, respectively.

2. The application of the probe set according to claim 1 in the preparation of a kit for determining the weight trait of a single apple fruit.

3. The application of the probe set according to claim 1 in determining the single fruit weight trait of apples, characterized in that, The single fruit weight trait is categorized into small fruit type, medium-small fruit type, large fruit type, medium fruit type, and large-medium fruit type; The small fruit type is denoted as S, with an average single fruit weight of 9.4 g to 9.6 g; the medium-small fruit type is denoted as MS, with an average single fruit weight of 68.4 g to 68.6 g; the large fruit type is denoted as L, with an average single fruit weight of 163.9 g to 164.1 g; the medium fruit type is denoted as M, with an average single fruit weight of 80.64 g to 82.64 g; and the large-medium fruit type is denoted as LM, with an average single fruit weight of 131 g to 133 g. When the genotype at SNP1 is AA, the genotype at SNP2 is TT, the genotype at SNP3 is GG, the genotype at SNP4 is GG, the genotype at SNP5 is GG, the genotype at SNP6 is GG, the genotype at SNP7 is TT, the genotype at SNP8 is AA, or the genotype at SNP9 is TT, then the single fruit weight trait of the tested Malus species is determined to be small fruit type; When the genotype at SNP1 is CA, the genotype at SNP2 is CT, the genotype at SNP3 is TG, the genotype at SNP4 is TG, the genotype at SNP5 is AG, the genotype at SNP6 is TG, the genotype at SNP7 is AT, the genotype at SNP8 is GA, or the genotype at SNP9 is GT, the single fruit weight trait of the tested Malus species is determined to be of small to medium fruit type. When the following conditions are met simultaneously: the genotype at SNP1 is CC, the genotype at SNP2 is CC, the genotype at SNP3 is TT, the genotype at SNP4 is TT, the genotype at SNP5 is AA, the genotype at SNP6 is TT, the genotype at SNP7 is AA, the genotype at SNP8 is GG, and the genotype at SNP9 is GG, and the genotype at SNP10 is GG, the genotype at SNP11 is AG, the genotype at SNP14 is AA, or the genotype at SNP16 is TG, then the single fruit weight trait of the tested Malus species is determined to be of the large fruit type. When the following conditions are met simultaneously: the genotype at SNP1 is CC, the genotype at SNP2 is CC, the genotype at SNP3 is TT, the genotype at SNP4 is TT, the genotype at SNP5 is AA, the genotype at SNP6 is TT, the genotype at SNP7 is AA, the genotype at SNP8 is GG, and the genotype at SNP9 is GG, and if any one of the following is true: SNP12 contains a T allele, SNP13 contains a G allele, or SNP15 contains a T allele, then the single fruit weight trait of the tested Malus species is determined to be of medium fruit type. If the tested apple species does not meet any of the above conditions, its single fruit weight trait is determined to be large to medium fruit type.

4. The application according to claim 3, characterized in that, Includes the following steps: Genomic DNA was extracted from the Malus species to be tested; The probe set was used to perform typing detection on the target Malus species. Based on the results of the typing test, the single fruit weight trait of the tested Malo species is determined.

Citation Information

Patent Citations

  • Auxiliary prediction method for apple high-quality disease-resistant genome and application thereof

    CN113462812A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to procyanidine content character of apple and application thereof

    CN119287061A