Composition for treating alpha-thalassemia and application thereof
The precise editing of Hb-CS mutations in patients with α-thalassemia through the gene editing system solves the safety and effectiveness issues in the prior art, and the balance of Hb-CS mutation repair and α/β globin expression is achieved, which improves the safety and effectiveness of the treatment.
Patent Information
- Application Number
- CN202510619884.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-19
AI Technical Summary
The prior art has safety problems with gene therapy methods when treating α-thalassemia, and it has failed to effectively repair HBA2 gene mutations, resulting in low hemoglobin and low survival rate in patients.
The HBA gene mutated by Hb-CS is accurately edited using a gene editing system, including converting cytosine at the Hb-CS mutation site into thymine or inserting a stop codon upstream or downstream of it, using gene editors such as CRISPR/Cas system, ZFN, TALE, etc. to identify and cleave target nucleic acids, and combining guide RNA for targeted editing.
Repair editing of Hb-CS mutations is achieved, balanced α/β globin expression, and improved the safety and effectiveness of the treatment.
Smart Images

Figure SMS_1 
Figure SMS_9 
Figure SMS_10
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, and in particular to a composition for treating α-thalassemia and applications thereof. Background Art
[0002] Thalassemia (thalassemia) is a hereditary hemolytic anemia. Based on genetic typing, the main clinical manifestations are α-thalassemia and β-thalassemia. The mutations that cause α-thalassemia are divided into deletion type and non-deletion type. Non-deletion type α-thalassemia is caused by "point mutations" in the α gene nucleotides. There are three more common non-deletion types of α-thalassemia: Hb-CS (CD142), Hb-QS (CD125), and Hb-WS (CD122). Among them, patients with Hb-CS type have relatively severe conditions, low hemoglobin levels, and poor survival rates.
[0003] Hemoglobin CS (Hb-CS, Haemoglobin-Constant Spring, α142, Term→Gln, TAA>CAA(α2), αcsα / ) is a non-deletion form of α-thalassemia (α-Thal) with a nucleotide substitution (UAA>CAA) at the stop codon CD142 of the α2-globin gene (HBA2). SEA , α MED , α THAI ), when only one normal α1-globin gene (HBA1) remains, the genotype is α CS α / --, with clinical manifestations and blood picture similar to those of hemoglobin H disease (HbH), is termed CS-type HbH disease (HbH-CS). Furthermore, individuals affected by HbH-CS often have more severe anemia and are prone to significant hepatosplenomegaly. In particular, patients with HbH-CS require greater blood transfusions than individuals with a triple deletion involving the α-globin gene (-- / -α).
[0004] Several existing gene therapy approaches for α-thalassemia exist, such as overexpression of genes like α-globin and ζ-globin. However, these approaches present significant safety concerns, including the potential for random integration of overexpressed globin gene copies into thousands of different genomic sites, leading to insertional mutagenesis and malignant tumors. Furthermore, none of these technologies have been proven effective or safe in patient cell or animal studies or clinical trials.
[0005] Therefore, those skilled in the art urgently need to develop a method that can effectively repair HBA2 gene mutations. Summary of the Invention
[0006] Based on this, it is necessary to provide a composition for treating α-thalassemia and its application, by which the pathogenic mutation site can be precisely edited, the expression of α / β globin can be balanced, and safety can be ensured.
[0007] The present invention solves the above technical problems through the following technical solutions.
[0008] A first aspect of the present invention provides a composition for treating α-thalassemia, the composition comprising a gene editing system;
[0009] The gene editing system is used to edit the HBA gene or its transcript containing the Hb-CS mutation, and to reverse the Hb-CS mutation.
[0010] In some embodiments, the HBA gene is the HBA1 gene or the HBA2 gene.
[0011] In some embodiments, the editing comprises:
[0012] (1) converting the cytosine at the Hb-CS mutation site in the Hb-CS mutation into thymine; and / or,
[0013] (2) inserting a stop codon upstream or downstream of the Hb-CS mutation site in the Hb-CS mutation.
[0014] In some preferred embodiments, the step of inserting a stop codon upstream or downstream of the Hb-CS mutation site comprises:
[0015] A stop codon is inserted at a position adjacent to the codon where the Hb-CS mutation site is located (eg, CD142 of the HBA2 gene).
[0016] In some embodiments, the stop codon is selected from at least one of TAA, TAG, and TGA.
[0017] In some embodiments, the gene editing system includes: a gene editor that recognizes a target nucleic acid and cleaves a double-stranded target nucleic acid strand, cleaves a single-stranded target nucleic acid strand, or does not cleave the target nucleic acid strand;
[0018] Optionally, the gene editor comprises one or more of the following:
[0019] (1) Endonucleases; for example, RNA-guided nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEs), meganucleases, or homing endonucleases;
[0020] (2) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a deaminase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; the deaminase domain is selected from adenine deaminase domain or cytosine deaminase domain;
[0021] (3) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a reverse transcriptase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; the reverse transcriptase is selected from M-MLV reverse transcriptase, AMV-RT, MarathonRT, or RTX;
[0022] (4) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a polymerase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; and the polymerase domain is selected from DNA polymerase.
[0023] In some embodiments, the gene editor is selected from Cas proteins, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEs), Argonate, ARCUS, HYER, IscB, IsrB, TnpB, Fanzor, and variants thereof;
[0024] The variant has an editing activity that is at least equivalent to that of the gene editor before the alteration.
[0025] In some embodiments, the target nucleic acid of the gene editing system is DNA or RNA, the DNA is, for example, coding DNA or cDNA, and the RNA is, for example, transcripts, including pre-mRNA and mature mRNA.
[0026] Optionally, the locus location of the target nucleic acid is selected from Chr16:173548-173648, Chr16:173558-173638 and Chr16:173568-173628.
[0027] In some embodiments, the sequence of the target nucleic acid is shown in any one of SEQ ID NOs: 84, 143-146.
[0028] In some embodiments, the gene editing system is selected from a CRISPR / Cas gene editing system, a pilot gene editing system, a transposon-encoded nuclease-based gene editing system, a single-base gene editing system, a zinc finger ribonuclease gene editing system, a transcription activator-like effector gene editing system, and an RNA editing system.
[0029] In some preferred embodiments, the gene editing system is selected from the group consisting of a CRISPR system, a PE system, a tBE system, a LigoRNA system, an OMEGA system, a Fenzor system, a ZFN, a TALE, a LEAPER, a REPAIR, a RESTORE, a CUSPER, a RESCUE, and a PASTE system.
[0030] In some embodiments, the gene editing system is a PE system, and the guide RNA of the gene editing system comprises a guide sequence, a backbone sequence, an RT sequence, and a PBS sequence from the 5' to the 3' end.
[0031] In some preferred embodiments, the guide sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any one of SEQ ID NOs: 3-17; the RT sequence is selected from the sequence shown in any one of SEQ ID NOs: 18-32, 54-83; and the PBS sequence is selected from the sequence shown in any one of SEQ ID NOs: 33-47.
[0032] In some specific embodiments, the guide sequence, RT sequence, and PBS sequence are shown in any combination shown in Tables 2 to 4.
[0033] In some embodiments, the gene editing system is a tBE system, the sgRNA guide sequence of the tBE system has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity to any one of SEQ ID NOs: 87-88, 100-106, and the hsgRNA guide sequence of the tBE system is selected from the sequence shown in any one of SEQ ID NOs: 89-97, 107-111.
[0034] In some specific embodiments, the sgRNA and hsgRNA sequences are shown in any combination of Tables 5 and 6.
[0035] In some embodiments, the gene editing system is a transcription activator-like effector gene editing system, which comprises a first polypeptide and a second polypeptide; wherein the first polypeptide comprises a nuclear localization signal sequence, a TALE recognition module, and a nicking enzyme from the N-terminus to the C-terminus; and the second polypeptide comprises a nuclear localization signal sequence, a TALE recognition module, a deaminase, and a uracil glycosylase inhibitor from the N-terminus to the C-terminus.
[0036] In some preferred embodiments, the editing window of the TALE recognition module in the first polypeptide and the second polypeptide has a sequence as shown in any one of SEQ ID NOs: 122-134 and CCGTcAAGC.
[0037] In some preferred embodiments, the sequence recognized by the TALE recognition module in the first polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any one of SEQ ID NOs: 113-121.
[0038] In some preferred embodiments, the sequence recognized by the TALE recognition module in the second polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with the sequence shown in any one of SEQ ID NOs: 4, 7, 14, 17, 135-140.
[0039] In some specific embodiments, the recognition sequences corresponding to the TALE recognition modules in the first polypeptide and the second polypeptide are as shown in any combination of Table 7.
[0040] In some embodiments, the recognition sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity to the target nucleic acid;
[0041] Optionally, the recognition sequence binds to the sense strand or antisense strand of the target nucleic acid, and the binding comprises 0-5, for example, 0, 1, 2, 3, 4 or 5 mismatches.
[0042] The second aspect of the present invention provides a guide polynucleotide comprising a guide sequence, wherein the guide sequence is the guide sequence as described in the first aspect.
[0043] In some embodiments, the guide polynucleotide comprises modified nucleotides.
[0044] In some preferred embodiments, the modification is preferably selected from one or more of 3'-phosphorothioate, 2'-O-methyl, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-phosphorothioate, deoxy and 5' phosphate modifications.
[0045] In some embodiments, the three ribonucleotides at the 5' and 3' ends of the guide polynucleotide are 2'-O-methyl modified, and the four ribonucleotides at the 5' and 3' ends are phosphorothioate bond modified.
[0046] The third aspect of the present invention provides a polynucleotide encoding the composition according to the first aspect or the guiding polynucleotide according to the second aspect.
[0047] The fourth aspect of the present invention provides a recombinant expression vector comprising the polynucleotide as described in the third aspect.
[0048] The fifth aspect of the present invention provides a cell, wherein the cell comprises the composition according to the first aspect; and / or
[0049] The cells are obtained by editing with the composition described in the first aspect.
[0050] The sixth aspect of the present invention provides a pharmaceutical composition, which comprises the composition as described in the first aspect, the guiding polynucleotide as described in the second aspect, the polynucleotide as described in the third aspect, the recombinant expression vector as described in the fourth aspect and / or the cell as described in the fifth aspect.
[0051] In some embodiments, the pharmaceutical composition may further comprise: (1) a pharmaceutically acceptable carrier or excipient; and (2) a delivery vehicle.
[0052] The seventh aspect of the present invention provides a composition as described in the first aspect, the guiding polynucleotide as described in the second aspect, the polynucleotide as described in the third aspect, the recombinant expression vector as described in the fourth aspect, the cell as described in the fifth aspect and / or the pharmaceutical composition as described in the sixth aspect for the preparation of a drug for treating α-thalassemia.
[0053] In some embodiments, the α-thalassemia is Hb-CS thalassemia.
[0054] The eighth aspect of the present invention provides a method for treating α-thalassemia, comprising administering to a subject in need thereof an effective amount of the composition as described in the first aspect, the guiding polynucleotide as described in the second aspect, the polynucleotide as described in the third aspect, the recombinant expression vector as described in the fourth aspect, the cell as described in the fifth aspect and / or the pharmaceutical composition as described in the sixth aspect.
[0055] The ninth aspect of the present invention provides a composition as described in the first aspect, the guiding polynucleotide as described in the second aspect, the polynucleotide as described in the third aspect, the recombinant expression vector as described in the fourth aspect, the cell as described in the fifth aspect and / or the pharmaceutical composition as described in the sixth aspect for treating α-thalassemia.
[0056] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0057] The reagents and raw materials used in the present invention are commercially available.
[0058] The positive progress effect of the present invention is:
[0059] By using the composition of the present invention, repair editing of Hb-CS mutations can be achieved, balancing the expression of α / β globin, and ensuring safety. BRIEF DESCRIPTION OF THE DRAWINGS
[0060] Figure 1 Schematic diagram of the pLenti6-Hb-CS vector structure in Example 1 of the present invention;
[0061] Figure 2 This is a schematic diagram of the TALE base editor in Example 4 of the present invention;
[0062] Figure 3 This is a graph showing the editing efficiency of repairing Hb-CS mutations in hematopoietic stem / progenitor cells derived from CS carrier cells using the tBE system according to Example 7 of the present invention;
[0063] Figure 4 This is a graph showing the editing efficiency of repairing Hb-CS mutations in hematopoietic stem / progenitor cells derived from CS patient cells using the tBE system in Example 8 of the present invention;
[0064] Figure 5 This is a diagram of the editing strategy pattern and sequencing results of Example 9 of the present invention using PE to insert a stop codon. DETAILED DESCRIPTION
[0065] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the accompanying drawings. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the present disclosure.
[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items. The sequences listed herein are from the 5' to 3' end. Locus mapping is based on the GRch38 genome version.
[0067] Definition of terms
[0068] As used herein, "guide RNA," "guiding RNA," "guide RNA," "guide RNA," and "gRNA" are used interchangeably. The term guide RNA is used to refer to a molecule in a gene editing system that forms a complex with an RNA-guided gene editor and guides the sequence-specific binding of the complex to a target sequence in a target nucleic acid. The gRNA used herein may be selected from the forms of bi-molecular guide RNA (dgRNA, i.e., crRNA and trRNA), single-molecule guide RNA (sgRNA), or multi-molecule guide RNA, and is not specifically limited thereto.
[0069] As used herein, the term "guide sequence" is used interchangeably with "targeting domain", "guide sequence", "guide sequence", "guide sequence", "spacer sequence", "interval body sequence", "spacer", "protospacer", etc., and refers to a continuous nucleotide sequence in the gRNA that has partial or full complementarity with the target sequence in the target RNA and can hybridize with the target sequence in the target nucleic acid by base pairing promoted by the RNA-guided gene editor. The full complementarity of the guide sequence and the target sequence described herein is not required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a gene editing complex. The length of the guide sequence is at least 15nt, for example, it can be about 16nt, about 17nt, about 18nt, about 19nt, about 20nt, about 21nt, about 22nt, about 23nt, about 24nt, about 25nt, about 26nt, about 27nt, about 28nt, about 29nt, about 30nt, about 31nt, about 32nt, about 33nt, about 34nt or about 35nt.
[0070] The term "back mutation" has a well-known meaning in the art, that is, the mutated base sequence (for example, the base sequence after forward mutation) becomes the original base sequence after a second mutation.
[0071] The term "transcript" refers to RNA transcribed from DNA according to the central dogma, and includes transcripts pre-mRNA and mature mRNA.
[0072] Cas proteins as used herein include, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12, Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12f / CasZ, Cas12g, Cas12h, Cas12i, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Cs m6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx 1. Csx1S, Csx11, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa 4. Csa5, Cas13, Cas13a, Cas13b, Cas13c, Cas13d, Cas13e, Cas13f, Cas13j, TnpB, IscB, IsrB, Fanzor, cas12b2, C2c2, C2c4, C2c5, C2c6, C2c7, c2c8, c2c9, c2c10, cas14a, cas14b, cas14c, or variants thereof.
[0073] The term "variant" refers to a group of highly similar protein members that are homologous to a single protein or protein family and have the same or similar biological effects. A variant of a CRISPR / Cas enzyme of the present invention refers to a CRISPR / Cas homologous protein that is a nucleic acid binding protein that is programmed to target any desired nucleotide sequence within the genome. A deaminase variant, as used herein, refers to a deaminase homologous protein that has a base deamination function. For example, a protein comprising a CRISPR / Cas enzyme or a fragment thereof may be referred to as a "CRISPR / Cas enzyme variant," such as a Cas9 variant. A CRISPR / Cas enzyme variant shares homology with a CRISPR / Cas enzyme or a fragment thereof. For example, the sequence of a CRISPR / Cas enzyme variant is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the sequence of a wild-type CRISPR / Cas enzyme.
[0074] The PAM (Protospacer Adjacent Motif) used in this article is a short nucleic acid fragment located on the non-target chain, usually 3-5 nucleotides in length. PAM is considered to be a key marker for Cas proteins such as Cas9 and Cas12 to bind and cut target DNA. Its existence is crucial for the editing function of target DNA. The PAM sequence determines the cutting position of the nuclease on the target DNA by being recognized by the Cas protein. In the Cas9 derived from the common Streptococcus pyogenes (S.pyogenes), its typical PAM sequence is NGG (N is any nucleotide and G is guanine), which means that the Cas9 protein mainly recognizes target DNA sequences ending with NGG. Other types of Cas proteins may have different PAM sequence preferences, so the PAM sequence in the target DNA sequence needs to be considered according to the type of Cas protein selected.
[0075] The TAM (target-adjacent motif) used in this article is similar to the PAM of Cas9. It determines the binding position of the gene editor on the target DNA by being recognized by transposon-encoded proteins such as IscB, IsrB, TnpB, and Fanzor. It is considered to be the key marker for the gene editor to bind and cut the target DNA.
[0076] As used herein, when referring to targeting a target nucleic acid, the term "targeting" is defined to include one or more of the following:
[0077] Cleavage of a target nucleic acid, visualization or detection of a target nucleic acid, labeling of a target nucleic acid, transport of a target nucleic acid, masking of a target nucleic acid, increasing the level of transcription and / or translation of a target nucleic acid, decreasing the level of translation of a target nucleic acid, altering splicing of pre-mRNA.
[0078] As used herein, when referring to modifying a target nucleic acid, the term "modification" is defined to include one or more of the following:
[0079] Base substitutions, base deletions, base insertions, methylation, demethylation, and deamination.
[0080] As used herein, the term "sequence identity" (identity, sequence identity, or percent identity) refers to the matching of sequences between two polypeptides or between two nucleic acids. When a position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent sequence identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions being compared × 100%. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% sequence identity. Typically, comparisons are made when two sequences are aligned to produce maximum sequence identity. Such alignments can be performed using published and commercially available alignment algorithms and programs, such as, but not limited to, ClustalΩ, MAFFT, Probcons, T-Coffee, Probalign, BLAST, which can be reasonably selected by one of ordinary skill in the art. Those skilled in the art can determine appropriate parameters for aligning sequences, including, for example, any algorithms needed to achieve better alignment or optimal comparison over the entire length of the sequences being compared, as well as any algorithms needed to achieve better alignment or optimal comparison over a portion of the sequences being compared.
[0081] When referring to an RNA sequence, the "t" in the sequence is used interchangeably with the "u". When referring to a "guide sequence", the "t" in the sequence is used interchangeably with the "u". When referring to a "direct repeat sequence", the "t" in the sequence is used interchangeably with the "u".
[0082] Target nucleic acid
[0083] In some embodiments of the present disclosure, the target nucleic acid is an HBA2 gene with a c.427T>C mutation, wherein the uracil nucleotide at the stop codon CD142 of HBA2 is mutated to a cytosine nucleotide (UAA>CAA).
[0084] The gene editing systems and compositions disclosed herein can be used to target one or more target DNA molecules, such as target DNA molecules present in a biological sample. The gene editing systems and compositions disclosed herein can also be used to target one or more target RNA molecules, wherein the target RNA can be pre-mRNA or mature mRNA. In some embodiments, the target nucleic acid is HBA2 DNA or a fragment thereof with a c.427T>C mutation. In some embodiments, the target nucleic acid is HBA2 mRNA or a fragment thereof with a c.427T>C mutation. In some embodiments, the target nucleic acid is HBA2 pre-mRNA or a fragment thereof with a c.427T>C mutation.
[0085] The gene editing systems and compositions disclosed herein can be used to target human nucleotide sequences, mouse nucleotide sequences, and mammalian nucleotide sequences other than human or mouse nucleotide sequences. In some embodiments, the target nucleic acid is a human nucleotide sequence of HBA2 with the c.427T>C mutation.
[0086] In some embodiments of the present disclosure, the target nucleic acid is: a polynucleotide sequence with NCBI number NC_000016.10 and / or NM_000517.6 or a fragment thereof, and the uracil nucleotide at its stop codon CD142 is mutated to a cytosine nucleotide (UAA>CAA).
[0087] In some embodiments of the present disclosure, the target nucleic acid is:
[0088] Among them, uppercase bold underline C Indicates Hb-CS, Hb ConstantSpring mutation, i.e. HBA2:c.427T>C.
[0089] In some embodiments of the present disclosure, the HBA2 gene sequence to be edited and repaired is exon 3 of the mutated HBA2 gene and its transcript.
[0090] In some embodiments of the present disclosure, the target nucleic acid is:
[0091] Among them, uppercase bold underline C Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0092] In some embodiments of the present disclosure, the HBA2 gene sequence to be edited and repaired is near the cytosine of the CD142 codon of the mutated HBA2 gene. As a non-limiting example, the target nucleic acid is a nucleic acid fragment of 30-50 bp before and after the mutated nucleotide.
[0093] In some embodiments of the present disclosure, the target nucleic acid is:
[0094] Among them, uppercase bold underline C Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0095] In some embodiments of the present disclosure, the target nucleic acid is:
[0096] Among them, uppercase bold underline C Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0097] In some embodiments of the present disclosure, the target nucleic acid is:
[0098] Among them, uppercase bold underline C Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0099] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0100] Example 1 Construction of Hb-CS mutant gene vector and cells.
[0101] 1. Design and construction of Hb-CS vector
[0102] Select the HBA2 gene fragment containing the Hb-CS mutation (SEQ ID NO: 1):
[0103]
[0104]
[0105] In the above sequence fragment, the uppercase bold underline Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0106] The following gene fragments were designed: CMV promoter + HBA2 gene fragment (Hb-CS mutation). After the target fragments were inserted into the lentiviral backbone vector, a lentiviral vector containing pCMV-HBA2 (Hb-CS) was constructed and sequenced for verification. Positive clones were used for lentiviral packaging.
[0107] Specifically, the pLenti6 / V5-GW / lacZ vector (Invitrogen, catalog number V49610 kit) used in this example was used as a lentiviral backbone vector, and the target gene fragment was reversely inserted and replaced the CMV promoter and lacZ gene fragment of the original backbone vector. The schematic diagram of the pLenti6-Hb-CS vector structure is shown in FIG. Figure 1 As shown, the vector structure includes a lentiviral backbone, the antibiotic module includes the promoter PSV40-Blasticidin (blasticidin), and the target gene module includes the promoter pCMV-HBA2 genomic fragment (Hb-CS mutation).
[0108] 2. Packaging and Concentrating Lentivirus
[0109] Resuscitate and expand 293T cells until exponential growth phase. Transfect 293T cells with lentiviral plasmids and helper plasmids using Lipofectamine 2000. After 48-72 hours, harvest the cells and concentrate the virus. Inoculate 293T cells and allow them to grow to 80-90% confluence for lentiviral packaging.
[0110] One hour before transfection, replace the culture medium with fresh complete medium. Taking transfection of T25 as an example, the specific steps for preparing the transfection complex are as follows:
[0111] ① Add plasmids to 500 μl of Opti-MEM and mix thoroughly. The plasmid dosages are: pCMV-VSV-G (source: ADDGENE #8454), pMDLg (source: ADDGENE #12251), pRSV-Rev (source: ADDGENE #12253), and pLenti6-Hb-CS = 2 μg, 4 μg, 3 μg, and 5-6 μg, respectively.
[0112] ② Add 3 times the amount of Lipo2000 to 500 μl OPTI-MEM and mix well;
[0113] Place ① and ② at room temperature for 5 minutes, mix well and place for another 20 minutes.
[0114] Add the transfection complex evenly to the cell culture flask and continue culturing for 4–6 hours. Replace with fresh complete medium and continue culturing for 48–72 hours. Collect the culture supernatant, centrifuge at 1500 g for 10 minutes, and collect the supernatant again. Pass the supernatant through a 0.45 μM PVDF syringe filter. Add 1 / 5 volume of 50% PEG 6000, mix thoroughly, and incubate at 4°C overnight. If a small amount of precipitate is visible, centrifuge at 1500 g for 10 minutes to allow it to accumulate at the bottom of the tube. Remove the supernatant and resuspend in serum-free DMEM to an appropriate volume. This is the concentrated Hb-CS lentivirus.
[0115] 3. Construction of Hb-CS cell model
[0116] Inoculate the host cells to be transfected (K562 cells, 293T cells, human HUDEP2 cells, human hematopoietic stem cells, erythroid progenitor / precursor cells, etc.) into a 6-well plate, add 5μl~10μl concentrated Hb-CS lentivirus to each well, add blasticidin antibiotics (concentration 10-40ug / mL) and culture for 48~72 hours. PCR is used to identify whether the positive fragment is inserted.
[0117] The positive clone cells were distributed into 96-well cell culture plates, and the positive monoclonal cell lines were screened and preserved as Hb-CS cell models for future use.
[0118] Example 2
[0119] 1. Design and synthesis of prime editors (PEs) based on the Cas9 nicking enzyme (nCas9-H840A / nCas9-NG-H840A / nSpRY-H840A). The PEs used in this example were PE2 or PEmax. The PE2 and PEmax plasmids for different nCas9 types were modified based on the pCMV-PE2-SpRY plasmid (source: ADDGENE#159979) and pCMV-PEmax plasmid (source: ADDGENE#174820), respectively.
[0120] 2. Design and synthesis of pegRNA for point mutation repair.
[0121] 1. Design of pegRNA
[0122] PegRNA includes a Spacer sequence, an RT sequence (reverse transcriptase template sequence) and a PBS sequence (primer binding site sequence), wherein the Spacer sequence is bound to or reverse-complemented within the upstream and downstream 50 nucleotide region Chr16 of the Hb-CS mutation site to be edited: 173548-173648 (GRch38 version genome) or the nucleic acid sequence (ccgttgggaggcccagcgggcaggaggaacggctaccgaggctccagcttAacggtatttggaggtcagcacggtgctcacagaagccaggaacttgtcca) (SEQ ID NO: 2). In the process of Spacer sequence design in this embodiment, it is preferred to cover the target sequence of the Hb-CS mutation or the target site specific to HBA2. The Spacer sequence information of pegRNA is shown in Table 1, and the pegRNA information (Spacer sequence, RT sequence and PBS sequence) is shown in Table 2.
[0123] Table 1 Spacer sequence information of pegRNA
[0124] Cas9 type Spacer Sequence SEQ ID NO. nCas9 / nCas9-NG / nSpRY CTACCGAGGCTCCAGCTTGA 3 nCas9 / nCas9-NG / nSpRY GGCAGGAGGAACGGCTACCG 4 nCas9-NG / nSpRY TACCGAGGCTCCAGCTTGAC 5 nCas9-NG / nSpRY CTGACCTCCAAATACCGTCA 6 nCas9-NG / nSpRY GGAACGGCTACCGAGGCTCC 7 nCas9-NG / nSpRY CCGTGCTGACCTCCAAATAC 8 nSpR GCTACCGAGGCTCCAGCTTG 9 nSpR TGACCTCCAAATACCGTCAA 10 nSpR TGCTGACCTCCAAATACCGT 11 nSpR GGCTACCGAGGCTCCAGCTT 12 nSpR GTGCTGACCTCCAAATACCG 13 nSpR GCTGACCTCCAAATACCGTC 14 nSpR CGGCTACCGAGGCTCCAGCT 15 nSpR ACGGCTACCGAGGCTCCAGC 16 nCas9-NG CGGGCAGGAGGAACGGCTAC 17
[0125] Table 2 Sequence information of pegRNA in Example 2
[0126]
[0127]
[0128] This example uses a single-molecule pegRNA, and the pegRNA comprises the structure: 5'-[spacer sequence]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc[pegRNA backbone sequence] (SEQ ID NO: 48)-[RT sequence]-[PBS sequence]-uuuu-3', or 5'-[spacer sequence]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc[pegRNA backbone sequence]-[RT sequence]-[PBS sequence]-caggagcccccccccugaacccaggauaacccucaaagucggggggc[hairpin structure] (SEQ ID NO: 49)-uuuu-3'.
[0129] If the guide sequence of the pegRNA corresponds to the target sequence numbered 1 above, the complete gRNA sequence is:
[0130] 5'-[cuaccgaggcuccagcuuga]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-[uccaaauaccguua]-[agcuggagccuc]-uuuu-3' (SEQ ID NO: 50, designated as pegRNA-1), or:
[0131] 5'-[cuaccgaggcuccagcuuga]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucg gugc-[uccaaauaccguua]-[agcuggagccuc]-[caggagcccccccccugaacccaggauaacccucaaagucggggggc]-uuuu-3'(SEQ ID NO:51).
[0132] 2. Preparation of pegRNA
[0133] 2.1 Construction of pegRNA / epegRNA Plasmids
[0134] The complete sequence of the pegRNA sequence in Table 1 above was synthesized by conventional methods, and primers were designed to amplify the full length of the pegRNA by gene fusion. The purified PCR fragment was recombined with the BpiI digestion product (linearized vector) of the plasmid vector of the pegRNA backbone sequence (such as PUC19-U6 promoter-BpiI-BpiI-gRNA backbone, PUC19-U6 background plasmid is derived from ADDGENE #121958, gRNA backbone sequence is: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc) (SEQ ID NO: 48), the ligation product was transformed, and monoclonal colonies were selected for PCR testing and Sanger sequencing verification to screen for positive clones, namely pegRNA plasmids.
[0135] 2.2. pegRNA / epegRNA Synthesis and Chemical Modification
[0136] According to the pegRNA guide sequence list in Table 2 above, methyl and phosphorothioate bond-modified pegRNAs were obtained by chemical synthesis and modification for later use.
[0137] For example, the synthetic sequence and modification of the modified single-molecule pegRNA1 are as follows:
[0138] 5'- mC*mU*mA*CCGAGGCUCCAGCUUGA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUCCAAAUACCGUUAAGCUGGAGCCUCU*mU*mU*mU-3' (SEQ ID NO: 52).
[0139] For example, the synthetic sequence and modification of the modified single molecule epegRNA1 are as follows:
[0140] 5'- mC*mU*mA*CCGAGGCUCCAGCUUGA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUCCAAAUACCGUUAAGCUGGAGCCUCCAGGAGCCCCCCCCCU GAACCCAGGAUAACCCUCAAAGUCGGGGGCU*mU*mU*mU-3′ (SEQ ID NO: 53) (the guide sequence is underlined, m indicates a 2′-O-methyl modification, and * indicates a phosphorothioate bond modification).
[0141] 2. Based on the prime editor (PE) with the nuclease Cas9 nicking enzyme (nCas9-H840A / nCas9-NG-H840A / nSpRY-H840A), a pegRNA that can insert a stop codon (TAA) before the mutant codon (CAA) was designed and synthesized.
[0142] The difference from step 1 is that a different RT sequence is used. The specific PegRNA information is shown in Table 3.
[0143] Table 3
[0144]
[0145]
[0146] 3. Based on the prime editor (PE) with the nuclease Cas9 nicking enzyme (nCas9-H840A / nCas9-NG-H840A / nSpRY-H840A), a pegRNA that can insert a stop codon (TAA) after the mutant codon (CAA) was designed and synthesized.
[0147] The difference from step 1 is that a different RT sequence is used. The specific PegRNA information is shown in Table 4.
[0148] Table 4
[0149]
[0150]
[0151] Example 3: Design and synthesis of tBE-based editor sequences
[0152] This embodiment provides a tBE system for targeted repair of Hb-CS mutation sites. The composition of the tBE system is based on the articles by Chen Jia et al. (Wang, L., et al. Eliminating base-editor-induced genome-wide and transcriptome-wide off-target mutations. Nat Cell Biol. 2021; Wenyan Han, et al. Design and application of the transformer base editor in mammalian cells and mice. Nature. 2023). The tBE system consists of four proteins: 1) single-stranded nicking enzyme D10A (nSpCas9) derived from SpCas9; 2) tobacco etch virus protease (TEV The tBE system consists of a 1:1 N-terminal fragment of the TEV protease (TEVn); 2: an RNA aptamer-binding protein (N22p) and a C-terminal fragment of the TEV protease (TEVc); and 4: an effector fusion protein (tBE-V5-mA3) comprising the cytidine deaminase catalytic domain (mA3CDA1), the cytidine deaminase inhibitory domain (mA3dCDI), a uracil DNA glycosylase inhibitor (UGI), and another RNA aptamer-binding protein (MCP). The tBE system also includes a sgRNA containing boxB (sgRNA-boxB) and a helper sgRNA containing MS2 (hsgRNA-MS2).
[0153] 1. Screening of gRNA
[0154] The tBE system includes: an sgRNA containing boxB (sgRNA-boxB) and a helper sgRNA containing MS2 (hsgRNA-MS2). Both sgRNA and hsgRNA contain: a guide sequence that binds to or is reverse-complementary to the target nucleic acid and a backbone sequence that binds to the editor. The target nucleic acid in this embodiment is selected as the region within the exon 3 nucleotides where the Hb-CS mutation site to be edited is located, Chr16:173472-173710 (GRch38 version genome), or the nucleotide sequence: Among them, uppercase bold underline C Indicates Hb-CS, Hb Constant Spring mutation, i.e. HBA2:c.427T>C.
[0155] The gRNA combinations screened in this example are shown in Tables 5 and 6. In Table 5, any one of hsgRNAs 1-9 can be used in combination with sgRNA 1, and similarly, any one of hsgRNAs 1-9 can be used in combination with sgRNA 2. In Table 6, any one of hsgRNAs 10-14 can be used in combination with any one of sgRNAs 3-9.
[0156] This example uses a single-molecule gRNA. The gRNA comprises the structure: 5'-[guide sequence]-[backbone sequence]-3'. When the guide sequence of the gRNA corresponds to sgRNA1 in Table 5, the complete gRNA sequence is: 5'-[ACCTCCAAATACCGTcAAGC]-[GUUUGAGAGCUAGGGCCCUGAAGAAGGGCCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGGGCCCUGAAGAAGGGCCCAAGUGGCACCGAGUCGGUGC]-3' (SEQ ID NO: 85). When the guide sequence of the gRNA corresponds to hsgRNA1 in Table 5, the complete gRNA sequence is: 5'-[GACAAGTTCC]-[GUUUGAGAGCUAGGCCAACAUGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUCAAAUAAGGCUAGUCC GUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC]-3' (SEQ ID NO: 86).
[0157] Table 5 tBE gRNA combinations based on nCas9
[0158]
[0159] Table 6 tBE gRNA combinations based on nSpRY
[0160]
[0161]
[0162] 2. gRNA synthesis
[0163] 2.1 Construction of gRNA Plasmid
[0164] The sense and antisense strands of the DNA sequences corresponding to the gRNA guide sequences in Table 1-2 above were synthesized by conventional methods, with caccg added to the 5'-end of the sense strand, aaac added to the 5'-end of the antisense strand, and C added to the 3'-end of the antisense strand.
[0165] Take 2 μl of the positive strand (Oligo-F) and antisense strand (Oligo-R) of the DNA sequence corresponding to the above gRNA guide sequence, mix them, add 2 μl NEB 10x cuttersmart buffer and 14 μl H2O, incubate at 95°C in a PCR instrument for 5 minutes, immediately remove and incubate on ice for 5 minutes to anneal to form a double-stranded guide sequence DNA with sticky ends.
[0166] The double-stranded guide sequence DNA with sticky ends was ligated with the BpiI digestion product (linearized vector) of the plasmid vector containing the sgRNA / hsgRNA backbone sequence (such as PUC19-U6 promoter-BpiI-BpiI-gRNA modified backbone, the PUC19-U6 background plasmid was derived from ADDGENE#121958) using T4 ligase, where the sgRNA backbone sequence is
[0167] "GUUUGAGAGCUAGGGCCCUGAAGAAGGGCCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGGGCCCUGAAGAAGGGCCCAAGUGGCACCGAGUCGGUGC" (SEQ ID NO:98),
[0168] The backbone sequence of hsgRNA is "GUUUGAGAGCUAGGCCAACAUGAGGAUCACCCAUGUCUGCAGGGCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC" (SEQ ID NO: 99). The ligation product was transformed, and monoclonal colonies were selected for PCR test and Sanger sequencing verification to obtain positive clones, namely gRNA plasmids.
[0169] 2.2gRNA Synthesis and Chemical Modification
[0170] According to the gRNA guide sequence list in Table 5, methyl and phosphorothioate bond-modified gRNAs were obtained by chemical synthesis and modification for later use.
[0171] For example, the synthetic sequence and modification of the modified single-molecule sgRNA1 are: 5'- mA*mC*mC*TCCAAATACCGTc AAGC GUUUGAGAGCUAGGGCCCUGAAGAAGGGCCCUAGCAAGUUCAAAUAA GGCUAGUCCGUUAUCAACUUGGGCCCUGAAGAAGGGCCCAAGUGGCACCGAGUCGGUGC*mU*mU*mU-3′ (the underline indicates the guide sequence, m indicates a 2′-O-methyl modification, and * indicates a phosphorothioate bond modification) (SEQ ID NO: 112).
[0172] Example 4: Sequence design and synthesis of TALE protein-based single-base editor (TALE-CBE)
[0173] Single-base editing developed based on the CRISPR-Cas system has shown great potential in treating genetic diseases caused by genomic point mutations. Compared with the CRISPR-Cas system, transcription activator-like effector (TALE) proteins only have the activity of binding to double-stranded DNA, but cannot undo double-stranded DNA. Therefore, simply combining single-stranded DNA deaminase with TALE cannot achieve effective base editing of DNA. In order to achieve effective editing, scientists have successfully established a TALE version of a single-base editor by integrating nickase (such as nCas9, BspD6I (C), FokI protein) and deaminase on the basis of the targeting provided by the TALE system. Figure 2As shown, the system consists of TALE-nickase and TALE-deaminase-2xUGI, and the primers of the nickase can successfully achieve strand-selective DNA editing. Based on this system, this example carried out research on TALE repair of CS mutations.
[0174] 1. Design of TALE binding sequences
[0175] TALE is composed of 18-24 tandem protein modules that specifically recognize DNA and N-terminal and C-terminal sequences on both sides. Each protein module contains 34 amino acids, and residues 12 and 13 are key sites for target recognition, known as repeated variable double amino acid residues (RVDs) sites. Each RVD on TALE can only recognize one base. Based on this feature, the following TALE sequence was designed for Hb-CS mutations in this example, see Table 7.
[0176] Table 7 TALE binding and editing sequences
[0177]
[0178]
[0179] 2. TALE-CBE Synthesis and mRNA Preparation
[0180] After the TALE sequence is designed, it is synthesized and assembled into eukaryotic expression vectors and IVT vectors by a vector construction company. The synthesized eukaryotic expression vector can be directly used for cell line testing. The IVT vector is linearized by single-enzyme digestion with HindIII to obtain a linearized vector. After purification, 5μg of the linearized vector is used as a template for an in vitro IVT reaction, followed by in vitro transcription at 37°C for 4 hours to produce mRNA. After the reaction is complete, 2μl of DNase I is added and the reaction is continued at 37°C for 15 minutes to digest the template strand. 1 / 2 volume of lithium chloride is added, mixed thoroughly, and incubated at -20°C overnight. The next day, the RNA is precipitated by centrifugation at 13,000g for 10 minutes at 4°C. The RNA is washed twice with 70% ethanol, air-dried, and then dissolved in an appropriate amount of sterile, enzyme-free water for later use.
[0181] Example 5
[0182] Deliver the PE system, tBE system, or TALE-CBE system to host cells.
[0183] 1. Resuscitating cells
[0184] The Hb-CS cell model successfully constructed in step 3 of Example 1 was revived and plated into a 6-well cell culture plate. After culturing in a CO2 incubator for 24 hours, it was used for cell transfection.
[0185] 2. Delivery Methods
[0186] 1. Lipofectamine transfection
[0187] 1) Prepare transfection complex A
[0188] Take three 1.5 ml EP tubes and add materials according to the following system to obtain transfection complex A.
[0189] PE system: Add Opti-MEM, pegRNA plasmid, and lead editor plasmid (PE2 / PEmax) in sequence and mix gently.
[0190] tBE system: Add Opti-MEM, sgRNA plasmid, Cas9 plasmid, and tBE plasmid in sequence and mix gently.
[0191] TALE-CBE system: Add Opti-MEM, TALE-left plasmid, and TALE-right plasmid in sequence and mix gently.
[0192] 2) Prepare transfection complex B
[0193] Take a 1.5ml EP tube, add Opti-MEM and Lipofectamine 2000 transfection reagent in sequence, mix gently and let it stand at room temperature for 5 minutes to obtain transfection complex B.
[0194] 3) Gently mix transfection complexes A and B respectively, let stand at room temperature for 15 minutes, then add the mixture to a 24-well plate, add 50 μl per well and continue to culture for 72 hours.
[0195] 2. Plasmid electroporation
[0196] Prepare plasmid solutions of different editing systems according to the required electroporation system. For example, in the PE editing system, mix the PE plasmid with the pegRNA plasmid (2 μg: 2 μg), in the tBE system, mix the Cas9, tBE plasmid and the sgRNA plasmid (0.5 μg: 0.5 μg: 0.5 μg), and in the TALE-CBE system, mix the TALE-left and TALE-right plasmids (2 μg: 2 μg).
[0197] Transfer the host cells from the 6-well plate to a T25 culture flask and culture for 24 hours, paying attention to controlling the cell density. Transfer the T25 cell culture medium to a 15 mL centrifuge tube, centrifuge at 300 x g for 10 minutes, remove the supernatant, and resuspend in 1 mL of PBS. Count the cells. Take 0.5 × 10 6The cells were centrifuged at 300 × g for 10 min, the supernatant was removed, and the cells were resuspended in approximately 20 μL of electroporation mixture (a mixture of SF solution / Supplement solution, implemented according to the instructions of Lonza product number V4XC-2032). After mixing with different systems, the cells were transferred to an electroporation cup and electroporated using the FF-120 electroporation program.
[0198] After electroporation, 80 μL of pre-warmed RPMI1640 medium (containing 10% FBS) was added and allowed to stand at room temperature for 10 min. The cells were transferred by gentle pipetting 3 times and cultured in a 24-well plate. The volume of the culture medium was supplemented to 400 μL.
[0199] 3. Electroporation of RNA system
[0200] Prepare RNA solutions of different editing systems according to the required electroporation system. For example, in the PE editing system, mix PE mRNA with pegRNA solution; in the tBE system, mix tBE mRNA, Cas9 mRNA, hsgRNA and sgRNA; in the TALE-CBE system, mix TALE-left mRNA and TALE-right mRNA.
[0201] Different editing systems were delivered into host cells by electroporation. Host cells from 6-well plates were transferred to T25 culture flasks and cultured for 24 hours, paying attention to controlling the cell density. T25 cell culture medium was transferred to a 15 mL centrifuge tube, centrifuged at 90 x g for 10 min, the supernatant was removed, and the cells were resuspended in 1 mL PBS. Cell count was performed. 0.5 × 10 6 The cells were centrifuged at 90 × g for 10 min, the supernatant was removed, and the cells were resuspended in approximately 20 μL of electroporation mixture (a mixture of SF-P3 solution / Supplement solution, according to the instructions of Lonza product number V4XC-2032). The cell suspension was added to different RNA systems and mixed five times before being transferred to an electroporation cup. The electroporation program corresponding to the host cells was selected for electroporation.
[0202] After electroporation, the cells were allowed to stand at room temperature for 10 minutes, and 80 μL of RPMI1640 medium (containing 10% FBS) was added. The cells were gently pipetted three times, transferred, and cultured in a 24-well plate. The volume of the medium was supplemented to 400 μL.
[0203] 4. Lipid nanoparticles (LNP) delivery
[0204] The PE system tools (PE mRNA and pegRNA), tBE system tools (tBE mRNA, Cas9 mRNA, sgRNA and hsgRNA), and TALE system tools (TALE-left mRNA and TALE-right mRNA) were respectively encapsulated in LNPs for in vitro delivery of editors.
[0205] 3. Sequencing after Transfection / Delivery
[0206] After transfection / delivery of various types of editing systems, the cells were cultured for 72 hours, and then the host cells were recovered, the genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced using the Sanger method.
[0207] 4. Results Analysis
[0208] The sequencing results were analyzed for gene editing efficiency using the EditR 10.10 website (https: / / moriaritylab.shinyapps.io / editr_v10 / ).
[0209] Example 6: Experiment on repairing Hb-CS mutations in Hb-CS cells obtained in Example 1.
[0210] 1. Method
[0211] This example refers to the method of plasmid electroporation in Example 5, and the PE system ( pegRNA Plasmid and PEmax-SpCas9 (addgene: 174820 ) plasmid), tBE system (sgRNA plasmid and tBE system plasmid), and TALE-CBE system (TALE-left and TALE-right plasmids) were electroporated into K562 Hb-CS cell line. After 72 hours of culture, the transfected cells were recovered and co-transfected with different editor plasmids. The genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced by Sanger method.
[0212] 2. Results
[0213] Sequencing results were analyzed using the EditR 10.10 website, and the gene editing efficiencies are shown in Tables 8 to 11. The results show that the PE system, tBE system, or TALE-CBE system can all repair the Hb-CS mutation in cell line models. The PE system achieved a 49% Hb-CS mutation repair efficiency. Using the tBE system, the editing efficiency of sgRNA2 + hsgRNA1, based on tBE (SpCas9), reached 38%, while using the tBE (SpRY) system, the editing efficiencies of sgRNA5 + hsgRNA12, sgRNA5 + hsgRNA13, sgRNA6 + hsgRNA12, and sgRNA6 + hsgRNA13 were all above 20%. Using the TALE-CBE system, the editing efficiencies of TALE-10 and TALE-14 reached 30%.
[0214] Table 8 Editing efficiency results using the PE (PEmax-SpCas9) system
[0215] PegRNA ID Editing efficiency 1 49% 2 12% 3 45% 5 20% 13 8% 14 24%
[0216] Table 9 Editing efficiency results using the tBE (SpCas9) system
[0217]
[0218] Table 10 Editing efficiency results using the tBE(SpRY) system
[0219]
[0220] Table 11 Editing efficiency results using TALE-CBE system
[0221]
[0222]
[0223] Example 7
[0224] Experiments using the PE system, tBE system, or TALE-CBE system to repair Hb-CS mutations in hematopoietic stem / progenitor cells derived from CS carrier cells.
[0225] 1. Method
[0226] The operation method of this example refers to the RNA system electroporation method in Example 5. After the CD34-positive cells (HSPCs) containing the Hb-CS mutation of the HBA2 gene were revived, they were cultured in StemSpan serum-free expansion medium (StemCell, StemSpan) rich in human cytokines (SCF, TPO, Flt3L, 100 ng / ml each). TM SFEM#09600) for two days.
[0227] The PE editing system (PE mRNA and pegRNA), the tBE editing system (tBE mRNA, Cas9 mRNA, and sgRNA), and the TALE-CBE editing system (TALE-left mRNA and TALE-right mRNA) for repairing Hb-CS were delivered into mPBSC cells. After electroporation, the cells were cultured for 72 hours in StemSpan serum-free expansion medium enriched with human cytokines (SCF, TPO, and Flt3L, 100 ng / ml each). The cells were then harvested, the genes were extracted, and the target fragments were amplified by PCR. The PCR products were then sequenced using the Sanger method.
[0228] 2. Results
[0229] The sequencing results were analyzed for gene editing efficiency using the EditR 10.10 website.
[0230] See Table 12 and Figure 3 , which shows the editing efficiency results of Example 7 using the tBE system to repair the Hb-CS mutation in hematopoietic stem / progenitor cells derived from CS carrier cells. The results showed that using tBE, the editing efficiency of repairing the Hb-CS mutation in hematopoietic stem / progenitor cells derived from CS carrier cells was 65.14% / 65.38%. After deducting the normal gene contribution (50%), the actual repair efficiency was 30.28% / 30.76%.
[0231] Table 12 Editing efficiency of repairing Hb-CS mutation in hematopoietic stem / progenitor cells derived from CS carrier cells using the tBE system in Example 7
[0232] Editor NC tBE(sgRNA2+hsgRNA1) Editing efficiency-NGS (%) 49.51 65.14% / 65.38%
[0233] Example 8
[0234] Experiments using the PE system, tBE system, or TALE-CBE system to repair Hb-CS mutations in hematopoietic stem / progenitor cells derived from CS patient cells.
[0235] 1. In vitro repair experiment
[0236] 2.1 Methods
[0237] After CD34-positive cells (HSPCs) with Hb-CS mutation in HBA2 gene were recovered, they were cultured in StemSpan serum-free expansion medium (StemCell, StemSpan) enriched with human cytokines (SCF, TPO, Flt3L, 100 ng / ml each). TM SFEM#09600) for two days.
[0238] The same method as in Example 7 was used to deliver different types of editor systems into HSPCs. After electroporation, the cells were placed in SFEM enriched with human cytokines (SCF, TPO, Flt3L, 100 ng / ml each) for one day of recovery culture. HSPCs were then induced to differentiate into erythroid cells in three stages. On the fourth day of differentiation induction, 2×10 5 Cells were collected and genomic DNA was extracted. The Hb-CS mutation site and adjacent fragments of the HBA2 gene were amplified by PCR and sent for Sanger sequencing. The sequencing results were analyzed for gene editing efficiency using the Edit R webpage.
[0239] See Table 13 and Figure 4 , which shows the editing efficiency results of Example 8 using the tBE system to repair the Hb-CS mutation in hematopoietic stem / progenitor cells derived from CS patient cells. The results showed that using tBE, the editing efficiency of repairing the Hb-CS mutation in hematopoietic stem / progenitor cells derived from CS patient cells was 24.51% / 16.43%.
[0240] Table 13 Editing efficiency of repairing Hb-CS mutations in hematopoietic stem / progenitor cells derived from CS patient cells using the tBE system in Example 8
[0241] Editor NC tBE(sgRNA2+hsgRNA1) Editing efficiency-NGS (%) 0 24.51% / 16.43%
[0242] On day 18 after the induction of differentiation, the relative expression of repaired HBA2 mRNA was detected by real-time quantitative qPCR, using the unrepaired erythrocyte experimental group after induction of differentiation of patient-derived hematopoietic stem / progenitor cells as a negative control. The percentage of α-globin / β-globin was analyzed by reversed-phase high-performance liquid chromatography (RP-HPLC) of hemoglobin.
[0243] 2.2 Results
[0244] Compared with the negative control, HSPCs cells treated with the editing tool showed partial repair of Hb-CS, the induced differentiated red blood cells restored the expression and function of HBA hemoglobin, and the α-globin / β-globin ratio increased.
[0245] 2. Repair in the body
[0246] The editing tools for repairing Hb-CS are loaded into viral vectors, or encapsulated by lipid nanoparticles, or expressed by engineered cells and secreted by encapsulating exosomes to make intravenous infusion preparations, which are delivered to the body's bone marrow through intravenous infusion to repair the Hb-CS mutation in hematopoietic stem cells and restore the expression and function of HBA hemoglobin.
[0247] Example 9: Inserting TAA before the Hb-CS mutation site to obtain an HBA2 gene that can terminate transcription normally
[0248] 1. pegRNA design
[0249] A pegRNA was designed to insert a TAA stop codon before the Hb-CS locus. The full-length sequence was: 5'-CTACCGAGGCTCCAGCTTGA[spacer sequence]-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTC C[pegRNA backbone sequence]-TCCAAATACCGTTAACA[RT sequence]-AGCTGGAGCCTC[PBS sequence]-TTTT-3' (SEQ ID NO: 142). This sequence was copied into the pegRNA plasmid backbone. The plasmid was extracted using an endotoxin-free plasmid extraction kit and then electroporated.
[0250] 2. Experimental methods
[0251] This example refers to the method of plasmid electroporation in Example 5. pegRNA Plasmid and PEmax-SpCas9 (addgene: 174820 ) plasmids were electroporated into K562 Hb-CS cell lines. After 72 hours of cell culture, the host cells transfected with the editor plasmids were recovered, the genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced using the second-generation sequencing technology.
[0252] 3. Results
[0253] The sequencing results are as follows Figure 5 As shown, Figure 5 This is a diagram showing the editing strategy and sequencing results of Example 9 of the present invention using PE to insert a stop codon. Figure 5 A is the TAA insert editing strategy pattern diagram, Figure 5 Figure B shows the editing efficiency results from high-throughput sequencing. The results demonstrate that PE editing successfully inserted a TAA stop codon before the Hb-CS locus, allowing normal translation of the HBA2 gene. This insertion of a TAA stop codon before the Hb-CS locus using PE editing is a feasible strategy for mutation repair in Hb-CS.
[0254] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0255] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A composition for treating α-thalassemia, characterized in that The composition comprises a gene editing system; The gene editing system is used to edit the HBA gene or its transcript containing the Hb-CS mutation, and to reverse the Hb-CS mutation.
2. The composition according to claim 1, wherein Said editing includes: (1) converting the cytosine at the Hb-CS mutation site in the Hb-CS mutation into thymine; and / or (2) inserting a stop codon upstream or downstream of the Hb-CS mutation site in the Hb-CS mutation.
3. The composition according to claim 2, wherein The step of inserting a stop codon upstream or downstream of the Hb-CS mutation site comprises: Inserting a stop codon adjacent to the codon where the Hb-CS mutation site is located (e.g., HBA2 gene CD142); The stop codon is selected from at least one of TAA, TAG and TGA.
4. The composition according to any one of claims 1 to 3, wherein The gene editing system includes: a gene editor that recognizes a target nucleic acid and cuts a double-stranded target nucleic acid chain, cuts a single-stranded target nucleic acid chain, or does not cut the target nucleic acid chain; Optionally, the gene editor is selected from one or more of the following: (1) Endonucleases; for example, RNA-guided nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEs), meganucleases, or homing endonucleases; (2) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a deaminase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; the deaminase domain is selected from adenine deaminase domain or cytosine deaminase domain; (3) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a reverse transcriptase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; the reverse transcriptase is selected from M-MLV reverse transcriptase, AMV-RT, MarathonRT, or RTX; (4) a nucleic acid recognition domain, a nucleic acid cleavage domain, and a polymerase domain; the nucleic acid recognition domain is selected from TALE or ZFP; the nucleic acid cleavage domain is selected from Cas nickase or FokI nickase; the polymerase domain is selected from DNA polymerase; Preferably, the gene editor is selected from Cas protein, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALE), Argonate, ARCUS, HYER, IscB, IsrB, TnpB, Fanzor and variants thereof; The variant has an editing activity that is at least equivalent to that of the gene editor before the alteration.
5. The composition according to claim 4, wherein The HBA gene is the HBA1 gene or the HBA2 gene, the target nucleic acid of the gene editing system is DNA or RNA, the DNA is, for example, coding DNA or cDNA, and the RNA is, for example, a transcript, including pre-mRNA and mature mRNA; Optionally, the locus location of the target nucleic acid is selected from Chr16:173548-173648, Chr16:173558-173638 and Chr16:173568-173628; optionally, the sequence of the target nucleic acid is shown in any one of SEQ ID NO:84, 143-146.
6. The composition according to any one of claims 1 to 5, wherein The gene editing system is selected from the group consisting of a CRISPR / Cas gene editing system, a lead editing system, a transposon-encoded nuclease-based gene editing system, a single-base editing system, a zinc finger ribonuclease gene editing system, a transcription activator-like effector gene editing system, and an RNA editing system; Preferably, the gene editing system is selected from the group consisting of CRISPR system, PE system, tBE system, LigoRNA system, OMEGA system, Fenzor system, ZFN, TALE, LEAPER, REPAIR, RESTORE, CUSPER, RESCUE and PASTE system.
7. The composition according to claim 6, wherein The gene editing system is a PE system, and the guide RNA of the gene editing system comprises a guide sequence, a backbone sequence, an RT sequence and a PBS sequence from the 5' to the 3' end; Preferably, the guide sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity to any one of SEQ ID NOs: 3-17; the RT sequence is selected from any one of SEQ ID NOs: 18-32 and 54-83; the PBS sequence is selected from any one of SEQ ID NOs: 33-47; For example, the guide sequence, RT sequence and PBS sequence are shown in any combination shown in Tables 2 to 4.
8. The composition according to claim 6, wherein The gene editing system is a tBE system, wherein the sgRNA guide sequence of the tBE system has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity to any one of SEQ ID NOs: 87-88 and 100-106, and the hsgRNA guide sequence of the tBE system is selected from any one of SEQ ID NOs: 89-97 and 107-111; For example, the sgRNA and hsgRNA sequences are shown in any combination shown in Table 5 and Table 6.
9. The composition according to claim 7, wherein The gene editing system is a transcription activator-like effector gene editing system, which comprises a first polypeptide and a second polypeptide; wherein the first polypeptide comprises a nuclear localization signal sequence, a TALE recognition module, and a nickase from the N-terminus to the C-terminus; and the second polypeptide comprises a nuclear localization signal sequence, a TALE recognition module, a deaminase, and a uracil glycosylase inhibitor from the N-terminus to the C-terminus; Optionally: The editing window of the TALE recognition module in the first polypeptide and the second polypeptide has a sequence as shown in any one of SEQ ID NOs: 122-134 and CCGTcAAGC; And / or, the sequence recognized by the TALE recognition module in the first polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any one of SEQ ID NOs: 113-121; And / or, the sequence recognized by the TALE recognition module in the second polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any one of SEQ ID NOs: 4, 7, 14, 17, 135-140; For example, the recognition sequences corresponding to the TALE recognition modules in the first polypeptide and the second polypeptide are shown in any combination of Table 7.
10. A guide polynucleotide, characterized in that comprising a guide sequence, said guide sequence being a guide sequence as defined in claim 7 or 8; Preferably, the guide polynucleotide comprises modified nucleotides; the modification is preferably selected from one or more of 3'-phosphorothioate, 2'-O-methyl, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-phosphorothioate, deoxy and 5' phosphate modification; more preferably, the three ribonucleotides at the 5' and 3' ends of the guide polynucleotide are 2'-O-methyl modified, and the four ribonucleotides at the 5' and 3' ends are modified with phosphorothioate bonds.
11. A polynucleotide, characterized in that The polynucleotide encodes the composition of any one of claims 1 to 9 or the guiding polynucleotide of claim 10.
12. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the polynucleotide according to claim 11.
13. A cell, characterized in that The cell comprises the composition according to any one of claims 1 to 9; and / or The cells are obtained by editing with the composition according to any one of claims 1 to 9.
14. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the composition of any one of claims 1 to 9, the guiding polynucleotide of claim 10, the polynucleotide of claim 11, the recombinant expression vector of claim 12 and / or the cell of claim 13.
15. Use of the composition according to any one of claims 1 to 9, the guiding polynucleotide according to claim 10, the polynucleotide according to claim 11, the recombinant expression vector according to claim 12, the cell according to claim 13 and / or the pharmaceutical composition according to claim 14 in the preparation of a medicament for treating α-thalassemia; Preferably, the α-thalassemia is Hb-CS thalassemia.
Citation Information
Cited By
Fusion protein expression cassette for rice multi-gene editing and application of fusion protein expression cassette
CN121137039A