Enterobacter strain and application thereof in phytoremediation of arsenic contaminated soil
By combining Enterobacter vittata.SL1-2 strain with Centipede Grass, the problem of insufficient arsenic absorption and translocation capacity of Centipede Grass was solved, achieving efficient and environmentally friendly remediation of arsenic-contaminated soil, significantly improving biomass and arsenic translocation efficiency, and reducing costs.
Patent Information
- Application Number
- CN202510594437.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2045-05-08
AI Technical Summary
In existing technologies, the ability of centipede grass to absorb and translocate arsenic is limited, resulting in low efficiency and high cost in the remediation of arsenic-contaminated soil. There is also a lack of effective methods for screening and applying functional microorganisms.
The Enterobacter vittata.SL1-2 strain is provided as a specific plant growth promoter to promote the growth of Centipede Grass and enhance its ability to absorb and translocate arsenic. By forming a microbial-plant co-remediation unit with Centipede Grass, it improves the enrichment effect of arsenic.
Significantly improves the biomass and arsenic translocation coefficient of Centipede Grass, enhances the hyperaccumulation capacity of arsenic, reduces remediation costs, and achieves efficient and environmentally friendly remediation of arsenic-contaminated soil. The cost is reduced by 75%, and the arsenic accumulation and translocation coefficient are increased by 138.13% and 206.26%, respectively.
Smart Images

Figure CN120505228B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and more specifically, to an Enterobacter strain and its application in phytoremediation of arsenic-contaminated soil. Background Technology
[0002] With the acceleration of industrialization, arsenic pollution has become a widespread environmental chemical pollution problem. Currently, large areas of agricultural soil in my country suffer from low to medium levels of arsenic contamination. Phytoremediation technology aims to reduce heavy metals in soil by removing heavy metals absorbed and transported by hyperaccumulating plants. Existing phytoremediation technologies for soil arsenic pollution mainly rely on the physiological characteristics of the plants themselves. Centipede grass, as an arsenic hyperaccumulator, exhibits high tolerance to arsenic, strong absorption and translocation capabilities, and can efficiently absorb and accumulate arsenic in large quantities in its aboveground parts. However, the efficiency of centipede grass in extracting arsenic is limited by its natural growth capacity and arsenic absorption and translocation capabilities. Furthermore, the slow growth and high cultivation costs of hyperaccumulating plants also limit the large-scale application of centipede grass in phytoremediation of soil arsenic pollution.
[0003] Rhizosphere microorganisms are closely linked to heavy metal behavior in plant rhizospheres and play a crucial role in phytoremediation. Investigating the key functional microorganisms in the rhizosphere of arsenic-hyperaccumulating plants and their practical application in the arsenic accumulation process of *Pteris vittata* is of great significance for promoting soil arsenic extraction and pollution remediation. Currently, research on *Pteris vittata* rhizosphere microorganisms is still in its early stages, relying on microbial community differential analysis combined with bioinformatics to predict and identify functional microorganisms with differentially expressed genes. Most studies lack screening of functional microorganisms and have not inoculated them into the *Pteris vittata* rhizosphere to assess their impact on plant growth and arsenic extraction. Therefore, it is impossible to determine whether the screened key functional microorganisms have a practical effect on improving arsenic extraction and remediation. Summary of the Invention
[0004] To address the aforementioned problems in the existing technology, this invention provides an Enterobacter strain and its application in phytoremediation of arsenic-contaminated soil. The aim is to enhance the hyperaccumulation capacity of Centipede Grass for arsenic and increase its biomass and arsenic translocation coefficient through the application of microbial strains.
[0005] The first objective of this invention is to provide an Enterobacter vittata.SL1-2.
[0006] A second objective of this invention is to provide the application of the Enterobacter vittata.SL1-2 in promoting the growth of Centipede Grass.
[0007] A third objective of this invention is to provide the application of the Enterobacter vittata.SL1-2 in enhancing the ability of Centipede Grass to accumulate, absorb, and / or transport arsenic.
[0008] A fourth objective of this invention is to provide the application of the Enterobacter vittata.SL1-2 in phytoremediation of arsenic-contaminated soil.
[0009] The fifth objective of this invention is to provide the application of Enterobacter vittata.SL1-2 in combination with Centipede Grass in the remediation of arsenic-contaminated soil.
[0010] The sixth objective of this invention is to provide a microbial inoculant.
[0011] The seventh objective of this invention is to provide a method for promoting the remediation of soil arsenic pollution by Centipede Grass.
[0012] To achieve the above objectives, the present invention is implemented through the following solution:
[0013] This invention isolates a novel species of *Enterobacter* strain from the soil around the roots of *Pteris vittata*, naming the species *Enterobacter vittata* and the strain *Enterobacter vittata* SL1-2. This strain not only promotes the growth of *Pteris vittata* and increases its biomass, but also enhances its ability to absorb, accumulate, and translocate arsenic, thus contributing to the remediation of arsenic-contaminated soil.
[0014] Enterobacter vittata.SL1-2 is a specific plant growth promoter (PGPR). This invention, based on the efficient accumulation of arsenic in soil using high-quality Centipede Grass, establishes a method for remediating arsenic-contaminated soil using this microbial strain. By exogenously adding Enterobacter vittata.SL1-2, a microbial-plant co-remediation unit is formed. The strain and Centipede Grass produce a synergistic effect, enhancing arsenic accumulation, improving the efficiency of soil arsenic remediation, reducing phytoremediation costs, and achieving effective arsenic removal. Furthermore, molecular analysis techniques are used to dissect the specific mechanisms of arsenic transport and absorption within this remediation unit.
[0015] Therefore, this invention seeks protection for the following:
[0016] A strain of Enterobacter vittata.SL1-2, with accession number GDMCC No:65612, was deposited on December 11, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, China (Postcode: 510070). Its taxonomic name is Enterobacter vittata.
[0017] The application of Enterobacter vittata.SL1-2 in promoting the growth of Centipede Grass.
[0018] The application of Enterobacter vittata.SL1-2 in enhancing the ability of Centipede Grass to accumulate, absorb and / or transport arsenic.
[0019] The application of Enterobacter vittata.SL1-2 in phytoremediation of arsenic-contaminated soil, wherein the plant includes Centipede Grass.
[0020] The application of Enterobacter vittata.SL1-2 in combination with Centipede Grass in the remediation of arsenic-contaminated soil.
[0021] Preferably, the 16S rDNA sequence of Enterobacter vittata.SL1-2 is shown in SEQ ID NO:1.
[0022] Preferably, the Enterobacter vittata.SL1-2 includes at least one of the live bacteria, culture medium, or culture supernatant of Enterobacter vittata.SL1-2.
[0023] A microbial inoculant comprising Enterobacter vittata.SL1-2.
[0024] A method for promoting the remediation of soil arsenic contamination by Centipede Grass involves planting Centipede Grass in the soil to be remediated and applying the aforementioned Enterobacter vittata.SL1-2 to the soil to be remediated.
[0025] Preferably, the Enterobacter vittata.SL1-2 is applied to the rhizosphere soil of the centipede grass.
[0026] Preferably, at the time of application, the OD of the Enterobacter vittata.SL1-2 bacterial culture is... 600 The value is 0.8 to 1.0.
[0027] More preferably, at the time of application, the OD of the Enterobacter vittata.SL1-2 bacterial culture is... 600 The value is 0.8.
[0028] Preferably, each centipede grass is treated with 25 mL to 100 mL of the bacterial solution of Enterobacter vittata.SL1-2.
[0029] More preferably, each centipede grass is treated with 50 mL of the bacterial solution of Enterobacter vittata.SL1-2.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] This invention provides a novel Enterobacter strain that significantly increases the biomass and arsenic translocation coefficient of Pteris vittata, thereby enhancing its hyperaccumulation capacity for arsenic. This has significant application value for further cultivating dominant microbial communities that specifically promote the remediation of arsenic-contaminated soil by Pteris vittata, developing functional microorganisms that can be widely used for soil arsenic pollution remediation, strengthening soil arsenic pollution remediation and control, and improving the ecological environment.
[0032] This invention, through the application of Enterobacter vittata.SL1-2 symbiosis, significantly enhances the biomass of Enterobacter vittata.SL1-2 and its efficiency in arsenic absorption and translocation, thereby strengthening the plant's hyperaccumulation capacity for arsenic. This provides a highly efficient, environmentally friendly, and cost-effective new technological solution for the bioremediation of arsenic-contaminated soil. Specifically, compared with existing technologies, Enterobacter vittata.SL1-2 of this invention has the following significant advantages:
[0033] 1. Enhances the plant's ability to accumulate arsenic—arsenic accumulation in pinnate leaves increased by 138.13%.
[0034] The application of Enterobacter vittata.SL1-2 significantly enhanced the arsenic absorption capacity of Centipede Grass, with a 138.13% increase in arsenic accumulation in its pinnate leaves. This highlights the significant advantage of Centipede Grass with added strains in absorbing more arsenic from the soil under the same conditions, significantly reducing the residual concentration of arsenic in the soil, and thus accelerating the remediation process of arsenic-contaminated soil.
[0035] 2. Enhanced arsenic absorption and transport efficiency – arsenic transport coefficient increased by 206.26%.
[0036] The application of Enterobacter vittata.SL1-2 enhanced the arsenic translocation capacity within Pteris vittata, increasing the arsenic translocation coefficient by 206.26%. This signifies a substantial improvement in the efficiency of arsenic movement within the plant, with more arsenic being transferred to the aboveground parts. This results in a more concentrated distribution of arsenic within the plant, facilitating harvesting and further arsenic processing, thereby improving arsenic hyperaccumulation and remediation effects.
[0037] 3. High efficiency, environmentally friendly and low cost
[0038] This invention utilizes natural microorganisms and plant resources for bioremediation, avoiding the secondary environmental pollution problems that may arise from traditional physical or chemical remediation methods, thus offering significant environmental advantages. Simultaneously, bioremediation technology can significantly reduce remediation costs, lowering the cost of remediating one acre of moderately arsenic-contaminated farmland by 75%, reducing dependence on energy and chemical reagents, and demonstrating good economic benefits and broad application prospects.
[0039] 4. High sustainability
[0040] Based on the self-repair mechanism of natural ecosystems, the symbiotic relationship between *Enterobactervitatata* SL1-2, a rhizosphere-specific functional bacterium of *Pteris vittata*, and *Pteris vittata* not only enhances remediation efficiency but also maintains stable remediation effects in long-term applications. This method requires no large external investment, maintains stable remediation effects in long-term applications, possesses sustainable development potential, is suitable for large-scale promotion and application, and contributes to achieving long-term and effective soil pollution remediation. Attached Figure Description
[0041] Figure 1 This is a colony morphology diagram of Enterobacter vittata.SL1-2 on LB solid medium.
[0042] Figure 2 The results of the alignment and identification of the 16S rDNA sequence of Enterobacter vittata.SL1-2 on NCBI.
[0043] Figure 3 Microscopic images of the Gram staining results for Enterobacter vittata.SL1-2.
[0044] Figure 4 The growth curves for Enterobacter vittata.SL1-2.
[0045] Figure 5 OD of Enterobacter vittata.SL1-2 after 24 h of growth in LB liquid medium at different pH values600 Value changes.
[0046] Figure 6 OD of Enterobacter vittata.SL1-2 grown in LB liquid medium at different pH values for 48 h 600 Value changes.
[0047] Figure 7 OD of Enterobacter vittata.SL1-2 grown in LB liquid medium at different pH values for 72 h 600 Value changes.
[0048] Figure 8 OD of Enterobacter vittata.SL1-2 after 24 h of growth in LB liquid medium with different salt concentrations 600 Value changes.
[0049] Figure 9 OD of Enterobacter vittata.SL1-2 grown in LB liquid medium with different salt concentrations for 48 h 600 Value changes.
[0050] Figure 10 OD of Enterobacter vittata.SL1-2 after 72 h of growth in LB liquid medium with different salt concentrations 600 Value changes.
[0051] Figure 11 OD values of Enterobacter vittata.SL1-2 after 72 h of growth in LB liquid medium containing 100 mg / L As(III) and LB liquid medium containing 100 mg / L As(V), respectively. 600 Value changes.
[0052] Figure 12 The growth of Centipeda minima in the experimental and control groups was compared before and 100 days after inoculation with Enterobacter vittata.SL1-2.
[0053] Figure 13 To compare the dry weight of the aboveground and basal parts of Centipeda minima in the experimental and control groups before and 100 days after inoculation with Enterobacter vittata.SL1-2.
[0054] Figure 14To compare the arsenic absorption of Centipeda minima in the experimental group and the control group before inoculation with Enterobacter vittata.SL1-2 and 100 days after inoculation, a represents the arsenic content in the aboveground and underground parts of the plant, b represents the arsenic translocation coefficient of the plant, and c represents the arsenic accumulation in the aboveground part of the plant.
[0055] Figure 15 The nutrient element accumulation of Centipeda minima in the experimental and control groups before and 100 days after inoculation with Enterobacter vittata.SL1-2 is shown in a-d, representing the accumulation of calcium (Ca), magnesium (Mg), potassium (K), and phosphorus (P) elements, respectively. Detailed Implementation
[0056] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0057] Example 1: Isolation, identification, and preservation of strain Enterobacter vittata.SL1-2
[0058] 1. Isolation of strains
[0059] Take 5g of *Centipeda minima* rhizosphere soil, add 45mL of sterile deionized water, and shake in a shaker at 25℃ for 1h to obtain a soil suspension. Take 1mL of the soil suspension, add sterile deionized water, and prepare soil dilutions at dilution ratios of 10, 100, 1000, and 10000 times. Take 100μL each of the 1000-fold and 10000-fold soil dilutions, spread them on LB agar plates, and incubate at 30℃ for 2 days. Select each single colony and streak it on fresh LB agar plates for single-colony purification. After three generations of purification, single-colony strains are obtained.
[0060] 2. Identification of strains
[0061] (1) Morphological identification
[0062] The isolated single-clone strains were streaked onto LB solid medium, and the colony morphology was as follows: Figure 1 As shown, the colonies are white, round, with neat edges, smooth surfaces, and slightly raised, with a diameter of approximately 3 mm. The colony growth pattern is concentrated, with clear boundaries between colonies and no obvious diffusion.
[0063] (2) Molecular biological identification
[0064] The 16S rRNA sequence of the isolated monoclonal strain was amplified using colony PCR, with primers 27F and 1492R (i.e., 27f-Bif and 1492r from the existing technology: "doi:10.1128 / AEM.02272-07"). The amplification products were collected and sequenced, yielding the 16S rDNA sequence of the monoclonal strain as follows:
[0065] CGGGGGGGGAGGACTCCAATGCAGTCGAGCGGCAGCGAGGAGAACTTTGTTACT
[0066] TTGCCGGAGAGCGGCGCGCGGGAGAGTAGTGTGTGAAAAACTGCCTGGTGGAGGGA
[0067] GATATCTACTGGAAACGATATCTAATACCGCATAGTGTCGCAAGACCAAAGAGGGACCC
[0068] CTTCGGCTCTTCTTGCCATCATGTGTGCCCAGATGAGATTATATAGTAGGTGGGAAAGTG
[0069] TCTCACCTACGAGACGATCCCTATGTGCTCTGAGAGGATGACCACCCACTGTGAAACT
[0070] GACACACGCCACACTCATACGAGAGGCAGCAGTGGAAAATATTGCACAGTGGGCG
[0071] CAAGTCTGGTGCACACGTGCCGCGTGTATGAAAAAGCTCTTCGTTGTGTAGAACACTT
[0072] TCAGCGGAGAGGAAGGTTGTGAGGTTAATACCCTCAGAAAGTGACGATCCCCGCAAA
[0073] AAAAGCCCCGTATATCTCCGTGCCAAGACGCGCGAAAATACAGAGGGCGCAAGCGTTA
[0074] ATCGAAATTAGTGGGCGAAAAGCGCACGCAGGCGCTGTGTCAAGTCATGTGAGAACT
[0075] CCCCGGTCTCACTGTGAAAAGTGTTTTAGACTGTGGGAGTATAGAGTCGTGTAGAGGG
[0076] GTATAAAATTCCATGTGTAGCGGAGAAGTGCATAGAGATGTGGAGGAATAGCGGTGGA
[0077] GAAGGCGCCCCTGTGCACAGACACTGACTCTCATGTGAGAGAGCGTGGAGAGCACAC
[0078] AATAATATATACTGTGAGTACTACACGGCGTACGACGATGTCGACGTTGGGAGTGTTGC
[0079] GCTCTTTGAACGTGTGTCTTGCGAGCATCATAACGCGTATTAAGCTACGCACCTGCTGC
[0080] TTGGGAGGAAGACTAACGCGCG (SEQ ID NO: 1).
[0081] The 16S rDNA sequence (SEQ ID NO:1) of this monoclonal strain was compared and analyzed for similarity in the NCBI database. Figure 2 As shown, the comparison results indicate that this monoclonal strain is a new species of the genus Enterobacter, named Enterobacter vittata., and the monoclonal strain is named Enterobacter vittata.SL1-2.
[0082] (3) Gram staining identification
[0083] Add 10 μL of Enterobacter vittata SL1-2 bacterial suspension to the center of a glass slide, and spread it evenly with an inoculation loop to form a thin layer approximately 1 cm in diameter. Allow the smear to air dry naturally, then fix it by quickly passing it through a flame three times. The staining process includes primary staining, mordanting, destaining, and counterstaining. For primary staining, add crystal violet solution, stain for 1 minute, and rinse with water; for mordanting, add iodine solution, stain for 1 minute, and rinse with water; for destaining, add 95% ethanol, gently shake the slide, and destain for 30 seconds until the effluent is no longer purple, then immediately rinse with water; finally, add safranin stain, stain for 1 minute, and rinse with water. After the specimen dries, examine it under an oil immersion microscope. Figure 3 As shown, Enterobacter vittata.SL1-2 turns red after Gram staining, indicating that this strain is a Gram-negative bacterium (G).- The cell wall structure of Gram-negative bacteria is characterized by a high lipid content in their outer membrane and a thin, poorly cross-linked peptidoglycan layer. During destaining, the outer membrane dissolves, causing the complex formed by crystal violet and iodine to be washed away, ultimately resulting in a red color after safranin counterstaining.
[0084] 3. Preservation of bacterial strains
[0085] The aforementioned Enterobacter vittata.SL1-2 was deposited on December 11, 2024, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC No:65612, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, China (Postcode: 510070). Its taxonomic name is Enterobacter vittata., and its accession name is Enterobacter vittata.SL1-2.
[0086] Example 2: Evaluation of the growth performance of strain Enterobacter vittata.SL1-2
[0087] 1. Plotting the growth curve of strain Enterobacter vittata.SL1-2
[0088] The bacterial concentration of strain Enterobacter vittata.SL1-2 was adjusted to OD. 600 The value was 0.5, and the inoculum was added to LB liquid medium at a rate of 1% (v / v). The initial optical density (OD) was measured. 600 The sample was then incubated at 30℃ and 180rpm in a shaker for 16 hours, with the optical density (OD) measured every hour during this period. 600 The growth curve of strain Enterobacter vittata.SL1-2 was plotted. Six replicates were set up, and the average value of the results was taken.
[0089] Growth curves as follows Figure 4 As shown, the OD of strain Enterobacter vittata.SL1-2 600 The OD value exhibits an "S"-shaped change over time, with a lag phase of approximately 1 hour in LB liquid medium during which *Enterobacter vittata* SL1-2 grows relatively slowly. The logarithmic growth phase occurs from 2 to 10 hours, during which *Enterobacter vittata* SL1-2 grows rapidly, with OD values reaching a peak at 9–10 hours. 600 The value has already reached around 1; the growth plateau period is from 10 to 16 hours, during which the growth rate of Enterobacter vittata.SL1-2 remains stable, and the OD value is...600 The value remains basically unchanged.
[0090] 2. Environmental adaptability test of strain Enterobacter vittata.SL1-2
[0091] (1) pH adaptability test
[0092] The bacterial concentration of strain Enterobacter vittata.SL1-2 was adjusted to OD. 600 With a value of 0.5, 1% (v / v) inoculum was inoculated into 4 mL of LB liquid medium at different pH values (adjusted to pH 4, 5, 6, 7, 8, 9, and 10 using HCl and NaOH solutions, respectively), and the initial optical density OD was measured. 600 The sample was then incubated at 30℃ and 180rpm in a shaker for 72 hours, with the optical density (OD) measured every 24 hours during this period. 600 Six parallel samples were set up, and the average value of the results was taken.
[0093] pH adaptability test results are as follows Figures 5-7 As shown, strain Enterobacter vittata.SL1-2 can grow normally under pH conditions ranging from 5 to 10, with the optimal pH for growth within 24 hours being 5 and the optimal pH for growth from 24 to 72 hours being 4. This indicates that strain Enterobacter vittata.SL1-2 has strong pH tolerance.
[0094] (2) Salt tolerance test
[0095] The bacterial concentration of strain Enterobacter vittata.SL1-2 was adjusted to OD. 600 The value was 0.5. 1% (v / v) of the inoculum was inoculated into 4 mL of LB liquid medium with different salt concentrations (NaCl content of 0%, 0.5%, 1%, 1.5%, 2%, 3%, 4%, and 5%). The initial optical density (OD) was then measured. 600 The sample was then incubated at 30℃ and 180rpm in a shaker for 72 hours, with the optical density (OD) measured every 24 hours during this period. 600 Six parallel samples were set up, and the average value of the results was taken.
[0096] Salt tolerance test results are as follows Figures 8-10As shown, strain Enterobacter vittata.SL1-2 grows normally under salt concentrations ranging from 0.5% (w / v) to 5% (w / v), with the optimal salt concentration for growth being 0.5% (w / v) within 48 hours and 2% (w / v) from 48 to 72 hours. This indicates that strain Enterobacter vittata.SL1-2 has strong NaCl tolerance.
[0097] (3) Arsenic tolerance test
[0098] The bacterial concentration of strain Enterobacter vittata.SL1-2 was adjusted to OD. 600 The value was 0.5. Inoculum was added at a rate of 1% (v / v) to LB liquid medium containing 100 mg / L As (V) and LB liquid medium containing 100 mg / L As (III), respectively. The media were cultured using a 96-well microplate system, and the initial optical density (OD) was measured. 600 The sample was then placed in a shaker at 30℃ and 180 rpm for 72 hours, during which the optical density (OD) was measured every 24 hours. 600 Six parallel samples were set up, and the average value of the results was taken.
[0099] Arsenic adaptability test results as follows Figure 11 As shown, strain Enterobacter vittata.SL1-2 grew normally under conditions containing 100 mg / L As(V) and 100 mg / L As(III). Initially (0–24 h), Enterobacter vittata.SL1-2 grew more vigorously in As(V), while from 24 h to 72 h, its growth performance in As(III) was better, with a faster growth rate. This indicates that strain Enterobacter vittata.SL1-2 has strong arsenic tolerance.
[0100] Application Example 1: Application of strain Enterobacter vittata.SL1-2 in the bioremediation of arsenic-contaminated soil
[0101] 1. Cultivation of Centipede Grass
[0102] Experimental and control groups were set up. In each group, 50 spores of Pteris vittata were evenly sown on nutrient soil in plastic flowerpots, covered with a film, and sprayed with water regularly to keep the soil moist. After the seedlings had grown for 3 months, when the plants had 5 pinnate leaves and were 7 cm tall, they were transplanted into farmland soil (arsenic content 350 mg / kg) from a mining area mixed with 40% (volume fraction) vermiculite.
[0103] After growth stabilized, the average leaf length of the control group was measured to be 7.01 cm, while the average leaf length of the experimental group was 7.81 cm. Stable surviving *Pteris vittata* plants were selected for subsequent strain re-inoculation.
[0104] All potted centipede grass plants were cultivated in an artificial climate chamber. The greenhouse cultivation conditions were: 14 hours of light + 10 hours of darkness, day and night temperatures of 26℃ and 20℃ respectively, relative humidity of 60%, and light intensity of 210 μmol / m². 2 / s(PAR).
[0105] 2. Bacterial culture
[0106] Enterobacter vittata.SL1-2, stored at -80℃, was revived and activated, then streaked onto LB solid medium. After single colonies emerged, they were inoculated into LB liquid medium using a sterile pipette tip for further amplification. The OD of the bacterial culture was measured using a UV spectrophotometer. 600 Value, up to OD 600 When the value reaches 0.8, collect the bacterial solution for subsequent strain re-inoculation.
[0107] 3. Strain tieback
[0108] The cultured Enterobacter vittata.SL1-2 bacterial solution was poured onto the rhizosphere of stably surviving Centipede Grass, with one Centipede Grass plant per pot. Each pot contained 50 mL of the bacterial solution and served as the experimental group, denoted as Enterobacter vittata. Similarly, 50 mL of pure water was poured onto the rhizosphere of the Centipede Grass plants using the same method, serving as the control group, denoted as CK. Twenty pots of Centipede Grass were used in each of the experimental and control groups.
[0109] 4. Subsequent cultivation of Centipede Grass
[0110] Spray water on the centipede grass in the experimental and control groups regularly to keep the soil in the flower pots moist. The greenhouse conditions in which the plants grow are the same as in step 1 of this application example.
[0111] The growth status of the experimental and control groups before reinoculation and on day 100 is as follows: Figure 12As shown in the figure. Measurements showed that on day 100 after inoculation, the average leaf length of the control group of *Enterobacter vittata* was 8.23 cm, and the average net leaf growth was 1.22 cm; the average leaf length of the experimental group was 14.96 cm, and the average net leaf growth was 7.15 cm. This indicates that compared to the control group, the upper leaf length of *Enterobacter vittata* SL1-2 inoculated with *Enterobacter vittata* SL1-2 increased by 81.9%, and the net leaf growth was nearly five times that of the control group. This demonstrates that *Enterobacter vittata* SL1-2 promotes the growth of *Enterobacter vittata*.
[0112] 5. Determination of the biomass of Centipede Grass
[0113] On day 100 after inoculation, the *Pteris vittata* plants from both the experimental and control groups were harvested. The above-ground and below-ground parts of both groups of *Pteris vittata* were first washed with tap water. The above-ground parts were dried and placed in envelopes. The below-ground parts were washed with ultrapure water and then soaked in an desorption solution for 15 minutes for desorption treatment. After washing again with ultrapure water and drying, they were stored in envelopes. All envelopes were placed in an oven and dried to constant weight. The dry weights of the above-ground and below-ground parts of the *Pteris vittata* were then measured separately.
[0114] like Figure 13 As shown, compared with the control group, the aboveground biomass of *Enterobacter vittata* SL1-2 increased by 12.6% and the underground biomass increased by 10.9% in the experimental group. This indicates that *Enterobacter vittata* SL1-2 can promote the biomass growth of *Enterobacter vittata* SL1-2.
[0115] 5. Determination of arsenic and nutrient content in centipede grass plants
[0116] To determine the arsenic content in the aboveground and underground parts of *Scolopendra subspinipes* in the experimental and control groups, approximately 0.05 g of dried and pulverized aboveground and underground parts of *Scolopendra subspinipes* were weighed into digestion tubes. The plant tissues were digested at 105 °C using a USEPA 3050B concentrated nitric acid-hydrogen peroxide system (10 mL 1:1 (w / v) HNO3 and 2 mL 30% H2O2). Two empty digestion tubes were used as blank controls. The total arsenic content in the samples was determined using inductively coupled plasma mass spectrometry (ICP-MS). The arsenic translocation coefficient was calculated based on the total arsenic content using the formula: Arsenic translocation coefficient = Arsenic content in aboveground parts / Arsenic content in underground parts.
[0117] like Figure 14 As shown in a, the arsenic content in the experimental group's centipede leaves was as high as 77.99 μg / g, which was 50.4% higher than that of the control group. Figure 14As shown in b, the arsenic translocation coefficient of the experimental group of *Pteris vittata* was as high as 4.37, significantly higher than that of the control group (1.43) (p<0.05), a relative increase of 206.3%. Figure 14 As shown in c, the arsenic enrichment in the experimental group of Centipede Grass Feather Leaves was as high as 46.64 μg, which was significantly higher than that in the control group (19.59 μg) (p<0.05), and was 138.1% higher.
[0118] In addition, the total calcium, magnesium, potassium, and phosphorus contents of the centipede grass in the experimental and control groups were determined by ICP-MS. Figure 15 As shown in a to d, compared with the control group, the total accumulation of calcium, magnesium, potassium and phosphorus in the centipede grass plants in the experimental group increased by 16.6%, 2.7%, 29.5% and 24.3% respectively, and the total accumulation of the four nutrients was higher than that of the control group, by a relative 22.7%.
[0119] The above results indicate that Enterobacter vittata.SL1-2 can promote the growth of Pteris vittata, increase biomass, and significantly enhance the arsenic translocation capacity of Pteris vittata, significantly increase arsenic accumulation, promote nutrient absorption, and significantly improve the remediation efficiency of Pteris vittata for arsenic-contaminated soil.
[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A plant Enterobacter vittata SL1-2, characterized in that, The strain has the accession number GDMCCNo: 65612 and was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 11, 2024.
2. The claim 1 Enterobacter vittata Application of SL1-2 in promoting the growth of Centipede Grass.
3. The claim 1 Enterobacter vittata Application of SL1-2 in enhancing the ability of Centipede Grass to accumulate, absorb and / or transport arsenic.
4. The claim 1 Enterobacter vittata The application of SL1-2 in phytoremediation of arsenic-contaminated soil is characterized by, The plant in question is centipede grass.
5. The claim 1 Enterobacter vittata Application of SL1-2 in combination with Centipede Grass in the remediation of arsenic-contaminated soil.
6. The application according to any one of claims 2 to 5, characterized in that, The Enterobacter vittata The 16S rDNA sequence of .SL1-2 is shown in SEQ ID NO:
1.
7. The application according to any one of claims 2 to 5, characterized in that, The Enterobacter vittata .SL1-2 includes the aforementioned Enterobacter vittata SL1-2 live bacteria or culture medium.
8. A microbial inoculant, characterized in that, Includes the claims of claim 1 Enterobacter vittata SL1-2.
9. A method for promoting the remediation of soil arsenic pollution by Centipede Grass, characterized in that, Plant centipede grass in the soil to be remediated, and apply the method described in claim 1 to the soil to be remediated. Enterobacter vittata SL1-2.
10. The method according to claim 9, characterized in that, As described in claim 1 Enterobacter vittata SL1-2 is applied to the rhizosphere soil of the centipede grass.
Citation Information
Patent Citations
Selenium-tolerant bacterial strain Enterobacter ludwigii GX-C3 and application thereof
CN112725230A
Recombinant vector for creating high-arsenic-accumulation engineering rice and application of recombinant vector in arsenic-polluted water body and soil remediation
CN118308416A